Search

Indeed, CLL patients with a CD49d bimodal expression experience a clinical behavior similar to that of CD49d SP + sp CLL and show an overall increase of the CD49d SP + sp subpopulation under multiple lines of therapy, consistent with its selection in the microenvironmental niche. CD49d has emerged as one of the strongest negative prognosticators in chronic lymphocytic leukemia (CLL), marking a subset of ~40% of patients characterized by an aggressive and accelerated clinical course [[1]]. (B) CD49d modulation on D14 in CLL samples with or without stable CLLlow counts over time (i.e. CLL <0.1 × 103/ l for all time points of MRD analysis evaluated, CLLlown = 12, 8/12 CD49d+ samples vs. [Extracted from the article]

These granules, negative to the myeloperoxidase cytochemistry reaction, were found in a median of 5% (range 0-70%) of blasts in I BCR/ABL1 i -like, 0% (range 0-50%) in I BCR/ABL1 i + and 0% (range 0-54%) in non I BCR/ABL1 i -like, respectively (Mann-Whitney I p i =.01 for I BCR/ABL1 i -like I vs. Finally, 67% of I BCR/ABL1 i -like cases underwent an allogeneic hematopoietic stem cell transplantation compared to 33% of I BCR/ABL1 i + cases and 10% of non I BCR/ABL1 i -like cases, confirming the high-risk features of the I BCR/ABL1 i -like subgroup. We selected 36 I BCR/ABL1 i + ALL and, from a cohort of B-lineage ALL negative for the common transcripts ( I BCR/ABL1 i , I KMT2A/AF4 i , I KMT2A/ENL i , I ETV6/RUNX11 i , I E2A/PBX1 i ), 34 I BCR/ABL1 i -like, and 31 non I BCR/ABL1 i -like ALL, identified by the I BCR/ABL1 i -like predictor. Ph-like acute lymphoblastic leukemia ( I BCR/ABL1 i -like ALL) is a subset of B-lineage ALL with a gene expression profile (GEP) similar to that of I BCR/ABL1 i -positive ( I BCR/ABL1 i +) ALL, but lacking the I BCR-ABL1 i fusion protein derived from the t(9;22)(q34;q11) translocation [[1]]. [Extracted from the article]

(B) RT-PCR analysis confirmed the fusion gene in patient, with a specific amplification at the 442 bp expected product size (primers EBF1 exon 14: CACGAGCATGAACGGATACGGCTCT; PDGFRB exon 12: ATGGCCGTCAGAGCTCACAGACTCA); positive control corresponded to a positive case previously characterized in our laboratory. Clinically, Ph-like ALL patients have a higher WBC count at presentation than non-Ph-like or Ph-positive ALL, present high levels of MRD at the end of induction and poor survival rates compared to non Ph-like ALL [[4]]. In particular, BCP-ALL Ph-like patients carrying the I PDGFRB i fusion seem to be clinically refractory to conventional therapy but highly sensitive to TKIs, as shown by recent reports [[11]]. Ph-like ALL-related novel fusion kinase ATF7IP-PDGFRB exhibits high sensitivity to tyrosine kinase inhibitors in murine cells. [Extracted from the article]

The article presents case study of a 50-year old white male who was diagnosed with lymphomatoid granulomatosis (LYG) and granular lymphocyte leukemia. It mentions that T-cell receptor (TCR) clonality was assessed by polymerase chain reaction (PCR) amplification of the TCR c chain variable region genes from peripheral blood mononuclear cell DNA. It presents information on absence of hepatitis C virus (HCV), hepatitis B virus (HBV), human immunodeficiency virus (HIV) and cytomegalovirus (CMV).

Genomic DNA extraction is a primary component of genomic research and diagnostic routine analysis. Recently, the importance of this process has been highlighted by the necessity to standardize the diagnostic procedure. In this regard, the Minimal Residual Disease (MRD) Network of the Fondazione Italiana Linfomi (FIL MRD Network) has performed a comparative study of four different commercially available kits for DNA extraction, applying them on a panel of cellular pellets, with the aim of defining possible technical recommendations in order to harmonize and standardize diagnostic procedures in the clinical setting. Overall, all four kits usually allowed the recovery of a significant quantity of high-quality DNA (in most conditions), although specific indications could be addressed for cellular pellets of different sizes. [ABSTRACT FROM PUBLISHER]

In chronic lymphocytic leukemia, NOTCH1, SF3B1, BIRC3 and TP53 disruptions are recurrent and affect survival. To define their incidence and clinical impact in patients undergoing first-line treatment, we evaluated 163 cases enrolled in the GIMEMA (Gruppo Italiano Malattie EMatologiche dell'Adulto) LLC0405 protocol (fludarabine plus alemtuzumab or fludarabine plus cyclophosphamide), for young patients, or in the ML21445 protocol (chlorambucil plus rituximab), for elderly patients. NOTCH1, SF3B1, BIRC3 and TP53 disruptions were detected in 15.9%, 12.2%, 8.6% and 10.4% of cases. NOTCH1 mutations correlated with a shorter treatment-free interval ( p = 0.058), an unmutated immunoglobulin heavy variable gene ( IGHV) status ( p < 0.0001), CD38 and ZAP-70 expression ( p = 0.0025 and 0.026, respectively) and trisomy 12 ( p = 0.0028), SF3B1 mutations with an unmutated IGHV status ( p = 0.02), and BIRC3 disruptions with an unmutated IGHV configuration ( p = 0.01) and 11q deletion ( p < 0.0001). NOTCH1 and SF3B1 did not appear to impact on overall response, while an inferior response was observed for BIRC3- and TP53-disrupted cases in the LLC0405 and ML21445 protocols, respectively. Progression-free survival, evaluable in the LLC0405 protocol - not affected by NOTCH1, SF3B1 and TP53 - appeared inferior for BIRC3 disruption. NOTCH1 and SF3B1 mutations may be overcome by aggressive regimens, while BIRC3 might impact on outcome also in intensive regimens. [ABSTRACT FROM AUTHOR]

The management of 'slow-go' patients with chronic lymphocytic leukemia (CLL) remains a primary unmet clinical need. This subgroup of patients, underrepresented in clinical trials, represents the burden of patients with CLL that will progressively increase in future years. Diagnostic tools to identify this patient population are emerging: the Cumulative Illness Rating Scale and reproducible geriatric functionality tests should be included, in addition to the traditional performance status assessment, in the work-up of elderly patients prior to treatment, in order to use a common language and better focus the aims of therapy. Quality of life has to be preserved and evaluated with dedicated tests. Evidence-based therapeutic strategies for 'slow-go' patients with CLL are still lacking. Therefore, monotherapy with chlorambucil ± rituximab and possibly fludarabine or bendamustine remains a first-line option outside clinical trials. Bendamustine ++ rituximab, pentostatin++rituximab±cyclophosphamide, fludarabine ++ cyclophosphamide at reduced doses, and chlorambucil plus new anti-CD20 antibodies can be options to be assessed within clinical trials, as their claimed acceptable toxicity is formally unproven. Clinical trials specifically designed for 'slow-go' CLL are strongly needed, and the enrollment of patients in dedicated trials is recommended. New non-chemotherapeutic drugs could be also explored in this setting. [ABSTRACT FROM AUTHOR]

ZAP-70, CD38 and IGHV mutations have all been reported to have prognostic impact in chronic lymphocytic leukemia (CLL), both individually and in paired combinations. We aimed to determine whether the combination of all three factors provided more refined prognostic information concerning the treatment-free interval (TFI) from diagnosis. ZAP-70, CD38 and IGHV mutations were evaluated in 142 patients. Combining all three factors, the ZAP-70-/CD38-/Mutated group showed the longest median TFI (62 months, n = 37), ZAP-70+/CD38+/Unmutated cases the shortest (11 months, n = 37) and cases discordant for ≥1 factor, an intermediate TFI (27 months, n = 68) (p = 0.006). Analysis of discordant cases revealed values that were otherwise masked when measuring single prognostic factors. The presence or absence of cytogenetic abnormalities did not explain the variability among discordant cases. Simultaneous analysis of ZAP-70, CD38 and IGHV mutations in CLL provides more discriminatory prediction of TFI than any factor alone. [ABSTRACT FROM AUTHOR]