Search

Chromatographic separation processes are described by nonlinear partial differential and algebraic equations, which may result in high computational cost, hindering further online applications. To decrease the computational burden, different data‐driven modeling approaches can be implemented. In this work, we investigate different strategies of data‐driven modeling for chromatographic processes, using artificial neural networks to predict pseudo‐dynamic elution profiles, without the use of explicit temporal information. We assess the performance of the surrogates trained on different dataset sizes, achieving good predictions with a minimum of 3400 data points. Different activation functions are used and evaluated against the original high‐fidelity model, using accuracy, interpolation, and simulation time as performance metrics. Based on these metrics, the best performing data‐driven models are implemented in a process optimization framework. The results indicate that data‐driven models can capture the nonlinear profile of the process and that can be considered as reliable surrogates used to aid process development. [ABSTRACT FROM AUTHOR]

Since its coinage ca. 1850 AD by Philip Barker Webb, the biogeographical region of Macaronesia, consisting of the North Atlantic volcanic archipelagos of the Azores, Madeira with the tiny Selvagens, the Canaries and Cabo Verde, and for some authors different continental coastal strips, has been under dispute. Herein, after a brief introduction on the terminology and purpose of regionalism, we recover the origins of the Macaronesia name, concept and geographical adscription, as well as its biogeographical implications and how different authors have positioned themselves, using distinct terrestrial or marine floristic and/or faunistic taxa distributions and relationships for accepting or rejecting the existence of this biogeographical region. Four main issues related to Macaronesia are thoroughly discussed: (i) its independence from the Mediterranean phytogeographical region; (ii) discrepancies according to different taxa analysed; (iii) its geographical limits and the role of the continental enclave(s), and, (iv) the validity of the phytogeographical region level. We conclude that Macaronesia has its own identity and a sound phytogeographical foundation, and that this is mainly based on three different floristic components that are shared by the Macaronesian core (Madeira and the Canaries) and the outermost archipelagos (Azores and Cabo Verde). These floristic components are: (i) the Palaeotropical‐Tethyan Geoflora, formerly much more widely distributed in Europe and North Africa and currently restricted to the three northern archipelagos (the Azores, Madeira and the Canaries); (ii) the African Rand Flora, still extant in the coastal margins of Africa and Arabia, and present in the southern archipelagos (Madeira, the Canaries and Cabo Verde), and (iii) the Macaronesian neoendemic floristic component, represented in all the archipelagos, a result of allopatric diversification promoted by isolation of Mediterranean ancestors that manage to colonize Central Macaronesia and, from there, the outer archipelagos. Finally, a differentiating floristic component recently colonized the different archipelagos from the nearest continental coast, providing them with different biogeographic flavours. [ABSTRACT FROM AUTHOR]

INTRODUCTION: Few studies have examined the relationship between education and cognition among the oldest–old. METHODS: Cognitive assessments were conducted biannually for 803 participants (62.6% women) of LifeAfter90, a longitudinal study of individuals ≥ 90 years old. Gender differences in associations between education (< high school, high school, some college, and ≥ college) and cognition (verbal episodic memory, semantic memory, and executive function) were examined at baseline and longitudinally using linear mixed models. RESULTS: Higher education levels were associated with better cognitive performance at baseline for both men and women. College completion was more strongly associated with better baseline executive function among women. Education‐cognition associations for baseline verbal episodic memory and baseline semantic memory did not differ by gender. Education was not associated with a decline in any domain‐specific cognitive scores, regardless of gender. DISCUSSION: Education is associated with cognitive function among the oldest–old and varies by gender and cognitive domain at baseline but not over time. Highlights: In the oldest–old, higher education was associated with better cognitive function.College completion was more strongly associated with executive function in women.Education was not associated with cognitive decline after age 90 regardless of gender.Improving education could decrease gaps in cognitive level among older individuals. [ABSTRACT FROM AUTHOR]

With the increasing rate of infections caused by multidrug‐resistant organisms (MDRO), selecting appropriate empiric antibiotics has become challenging. We aimed to develop and externally validate a model for predicting the risk of MDRO infections in patients with cirrhosis. Methods: We included patients with cirrhosis and bacterial infections from two prospective studies: a transcontinental study was used for model development and internal validation (n = 1302), and a study from Argentina and Uruguay was used for external validation (n = 472). All predictors were measured at the time of infection. Both culture‐positive and culture‐negative infections were included. The model was developed using logistic regression with backward stepwise predictor selection. We externally validated the optimism‐adjusted model using calibration and discrimination statistics and evaluated its clinical utility. Results: The prevalence of MDRO infections was 19% and 22% in the development and external validation datasets, respectively. The model's predictors were sex, prior antibiotic use, type and site of infection, MELD‐Na, use of vasopressors, acute‐on‐chronic liver failure, and interaction terms. Upon external validation, the calibration slope was 77 (95% CI.48–1.05), and the area under the ROC curve was.68 (95% CI.61–.73). The application of the model significantly changed the post‐test probability of having an MDRO infection, identifying patients with nosocomial infection at very low risk (8%) and patients with community‐acquired infections at significant risk (36%). Conclusion: This model achieved adequate performance and could be used to improve the selection of empiric antibiotics, aligning with other antibiotic stewardship program strategies. [ABSTRACT FROM AUTHOR]

Background: The present study sought to determine the prevalence of chronic non‐cancer pain (CNCP) among older adult inpatients with polypharmacy. It also aimed to analyse prescription patterns and assess the therapy adequacy and patient complexity for those with and without CNCP. Methods: This 4‐year longitudinal study examined data from an exhaustive acute care hospital register on home‐dwelling older adult patients (≥65) with polypharmacy. Commonly known combinations of potentially inappropriate medications were used to estimate therapy adequacy. Patient complexity was evaluated by comparing number of comorbidities and investigating physical and cognitive deficits. Results: We determined a prevalence of CNCP of 9.7% among all older adult inpatients with polypharmacy, rising to 11.3% for those aged ≥85. Overall, CNCP patients were prescribed more drugs and had more comorbidities and physical and cognitive deficits than patients without CNCP. Older adult patients with CNCP received more analgesics, greater quantities of opioids, paracetamol and co‐analgesics and elevated opioid dosages. Older adult patients with CNCP aged ≥85 received fewer analgesics, opioids, non‐steroidal anti‐inflammatory drugs and co‐analgesics but more paracetamol. Older adult patients with CNCP were prescribed more potentially inappropriate medications involving opioids. In particular, 24.5% received an opioid and a hypnotic (benzodiazepine or Z‐drug), and 8.6% received an opioid and a gabapentinoid. Conclusion: Observed differences in medication use between older adult inpatients with or without CNCP may be relevant for clinical practice. Potentially inadequate co‐prescribing (such as hypnotics and opioids) affects a higher proportion of patients with CNCP and may have serious unintended consequences. Significance Statement: This study describes differences in prescription patterns between people with and without chronic non‐cancer pain in a large dataset of 20,422 discharges. The differences found may be relevant to clinical practice. In particular, high co‐prescribing of opioids and hypnotics may have serious unintended consequences. Greater physical and cognitive deficits may indicate greater patient complexity, and appropriate interventions need to be developed to improve the management of this vulnerable patient group. [ABSTRACT FROM AUTHOR]

Background Objectives Methods Results Conclusions Maternal preeclampsia is associated with both congenital heart defects and changes in left ventricular structure and function in the offspring. Whether preeclampsia and gestational hypertension also affect the offspring's cardiac conduction system is unknown.This study assesses whether infants exposed to maternal hypertensive disorders of pregnancy (HDPs) exhibit changes in their electrocardiogram (ECG) compared with infants unexposed to HDPs.This population‐based cohort study included newborns from the Copenhagen Baby Heart Study who had an ECG performed within 30 days of birth and had available obstetric information. ECG parameters of newborns exposed to maternal HDPs were compared with those of unexposed newborns using linear regression.Our study cohort included 11,826 newborns, including 441 exposed to maternal preeclampsia and 320 exposed to gestational hypertension. Infants exposed to preeclampsia had prolonged QRS durations (adjusted mean difference 0.6 ms, 95% confidence interval [CI] 0.04, 1.16) and lower maximum amplitudes of the R‐wave in V1 (adjusted mean difference, linear scale 0.95, 95% CI 0.90, 1.00), compared with unexposed infants. Exposure to maternal preeclampsia was not associated with changes in other ECG parameters. Exposure to gestational hypertension was associated with increased QT interval durations (QTc Bazett, adjusted mean difference 2.48 ms, 95% CI −0.23, 5.20; QTc Fridericia, adjusted mean difference 2.32 ms, 95% CI −0.19, 4.83).Our findings suggest that the newborn cardiac conduction system is affected by exposure to maternal preeclampsia. This could reflect the previously described thickening of the left ventricular myocardium in infants exposed to preeclampsia. [ABSTRACT FROM AUTHOR]

BACKGROUND: Low rumen pH is proposed to be a major mechanism for low methane (CH4) emissions from sheep fed forage rape. However, it is difficult to separate this from other in vivo factors, such as rumen passage rate. The objective of this study was to determine the effect of pH alone on CH4 production in vitro using different pH buffers. Ryegrass, white clover and forage rape were incubated in vitro using three different incubation buffers with starting pH values of 5.5, 6.2 and 6.8. RESULTS: Decreasing pH reduced overall in vitro CH4 emission relative to fermented hexoses (CH4/FHex) by up to 54% and overall fermentation by 40%. pH also changed fermentation profiles where the acetate + butyrate to propionate + valerate ratio decreased when pH decreased. Within the three forages, forage rape led to the lowest CH4/FHex, but only in pH 5.5 and 6.2 buffer, and this was enhanced when the pH fell below 6. CONCLUSION: Reducing pH in vitro decreased CH4 production and overall fermentation across all forages. The lower pH reached by forage rape compared to ryegrass and white clover appears to drive the lower CH4 production relative to the extent of fermentation from forage rape compared to the other forages. © 2024 The Author(s). Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. [ABSTRACT FROM AUTHOR]

In the dynamic world of animal production, many challenges arise in disease control, animal welfare and the need to meet antibiotic‐free demands. Emerging diseases have a significant impact on the poultry industry. Managing gut microbiota is an important determinant of poultry health and performance. Introducing precision glycans as feed additives adds another dimension to this complex environment. The glycans play pivotal roles in supporting gut health and immunological processes and are likely to limit antibiotic usage while enhancing intestinal well‐being and overall poultry performance. This study explores precision glycan product as a feed additive supplemented at a continuous dose of 900 g per tonne of feed, in a free‐range production system on a large commercial farm. Forty thousand 17‐week‐old pullets were randomly allocated to one of two separated sections of the production shed, with individual silos and egg‐collecting belts. The flock performance, gut microbiota and its functionality were analysed throughout the laying cycle until 72 weeks of age. The results demonstrated that introducing precision glycans improved a range of performance indicators, including reduced cumulative mortality, especially during a major smothering event, where the birds pile up until they suffocate. There was also significantly increased hen‐housed egg production, reduced gut dysbiosis score and undigested feed, increased number of goblet cells and improved feed conversion ratio. Additionally, microbiota analysis revealed significant changes in the composition of the gizzard, ileum content, ileum mucosa, and caecal and cloacal regions. Overall, the findings suggest that precision glycans have the potential to enhance poultry egg production in challenging farming environments. [ABSTRACT FROM AUTHOR]

Endophytic bacteria have not been reported widely for their lipolytic abilities, so they are not used for large‐scale lipase production. The purpose of this study was to explore an endophytic bacterium for the production of lipase implementing cost‐effective techniques, including the use of Cassia fistula seeds, as a substrate in the production medium and stem pieces of Phragmites karka as the immobilization matrix. The endophytic strain Bacillus sp. E4 was originally isolated from the halophytic plant Arthrocnemum macrostachyum. Bacillus sp. E4 produced 6.05 IU mL−1 lipase in the presence of powdered seeds of Cassia fistula (golden shower tree). Initial trial experiments using a one‐factor‐at‐a‐time approach led to an improvement in lipase titers to 10.05 IU mL−1. Consequently, investigations using the Plackett–Burman design suggested the influence of three significant factors – incubation period, inoculum size, and substrate concentration – on lipase production. They were optimized using the Box–Behnken design (BBD). In the response optimization experiment, strain E4 yielded 52.35 IU mL−1 lipase, which was in accordance with the predicted yield and indicated an overall 8.65 fold improvement in lipase production. To investigate the use of free cells, strain E4 was immobilized on the stem pieces of a halophytic plant, Phragmites karka, which was used for the first time as an immobilization matrix. The immobilized cells retained lipase production ability for up to six cycles with the highest yield of 110 IU mL−1, which corresponded to an improvement of more than eighteenfold. Scanning electron micrographs confirmed the colonization of E4 cells in the matrix and demonstrated the utilization of C. fistula seeds. Fourier transform infrared spectroscopy affirmed the utilization of components including fatty acids by the immobilized E4 cells. The study suggests that endophytic bacterial strains could be applied for the production of lipase with the utilization of nontraditional oil sources. [ABSTRACT FROM AUTHOR]

Background and Objectives: The potential of Plectranthus amboinicus aqueous extract (PAAE) to enhance the quality properties of wheat bread was investigated. PAAE was incorporated as an ingredient in bread formulations to improve shelf life. Findings: The results indicate that the technological characteristics of bread formulations were enhanced with the inclusion of up to 75% PAAE. This enhancement led to increased specific volume and expansion properties. Scanning electron microscopy analysis demonstrated improved interaction between gluten and starch. PAAE exhibited potential in retarding bread hardening and preventing mold growth. Conclusions: PAAE holds promise as a novel ingredient for use in baked products. Its inclusion in bread formulations significantly improved technological characteristics, including specific volume and color, and positively influenced the interaction between gluten and starch. Additionally, PAAE showed potential in extending the shelf life of bread and inhibiting fungal growth. Significance and Novelty: This study is significant due to the introduction of a novel ingredient, PAAE, in the field of baking. The incorporation of this extract represents an innovation in the quest for improvements in the nutritional and technological properties of baked goods. The ability of PAAE to function as an antifungal agent holds great relevance for the food industry. [ABSTRACT FROM AUTHOR]

The urgent need for sustainable waste management strategies has led to the exploration of innovative approaches for the valorization of waste. In this study, a method is proposed for carbonizing waste biomass materials, particularly paper mill waste sludges (primary and biological) and knots, to produce porous carbonaceous supports. Through an initial hydrothermal carbonization followed by carbonization with nitrogen flow, porous carbon materials are successfully generated. The findings of this investigation validate the successful generation of effective carbonaceous supports utilizing waste biomass materials. These materials are then evaluated for their effectiveness as porous supports in the ionic liquid‐catalyzed cycloaddition reaction of CO2 to styrene oxide, achieving a remarkable conversion rate of up to 98% and an impressive selectivity exceeding 99%. Additionally, the results underscore the significant impact of the selected IL on the overall conversion process. Overall, this study presents a promising pathway for the valorization of paper mill waste sludge through the production of porous carbon materials with potential applications in catalysis and beyond. [ABSTRACT FROM AUTHOR]

Cognitive control is a predictor of later‐life outcomes and may underpin higher order executive processes. The present study examines the development of early cognitive control during the first 24‐month. We evaluated a tablet‐based assessment of cognitive control among infants aged 18‐ and 24‐month. We also examined concurrent and longitudinal associations between attentional disengagement, general cognitive skills and cognitive control. Participants (N = 60, 30 female) completed the tablet‐task at 18‐ and 24‐month of age. Attentional disengagement and general cognitive development were assessed at 5‐, 8‐, 12‐, 18‐ and 24‐month using an eye‐tracking measure and the Mullen Scales of Early Learning (MSEL), respectively. The cognitive control task demonstrated good internal consistency, sensitivity to age‐related change in performance and stable individual differences. No associations were found between infant cognitive control and MSEL scores longitudinally or concurrently. The eye‐tracking task revealed that slower attentional disengagement at 8‐month, but faster disengagement at 18‐month, predicted higher cognitive control scores at 24‐month. This task may represent a useful tool for measuring emergent cognitive control. The multifaceted relationship between attention and infant cognitive control suggests that the rapid development of the attentional system in infancy results in distinct attentional skills, at different ages, being relevant for cognitive control development. [ABSTRACT FROM AUTHOR]

Summary: Algae and field crops can innovate and improve pasta; however, incorporation of high‐fibre materials can weaken the protein‐starch matrix. This study's aim was to verify how ratios of xanthan gum (XG) and linseed flour (LF) would influence physical, sensory attributes and bioactivity of pasta supplemented with algae. Fucus vesiculosus and Chlorella vulgaris were incorporated into durum wheat along with LF or XG. Samples were evaluated for optimal cooking time (OCT), cooking loss, colour variation, texture profile analysis (TPA), sensory evaluation, total phenolic content and antioxidant activity. XG increased cooking time and cooking loss. The phenolic content and antioxidant activity were highest in samples with LF. TPA showed texture is influenced by incorporation of algae. Sensory analysis showed that LF‐enriched pasta had better acceptance. Observations in biochemical composition and physical parameters revealed the potential to formulate dry or fresh pasta with a better nutritional content. [ABSTRACT FROM AUTHOR]

What is the nature of lexical meanings such that they can both compose with others and also appear boundless? We investigate this question by examining the compositional properties of for‐time adverbial as in “Ana jumped for an hour.” At issue is the source of the associated iterative reading which lacks overt morphophonological support, yet, the iteration is not disconnected from the lexical meanings in the sentence. This suggests an analysis whereby the iterative reading is the result of the interaction between lexical meanings under a specific compositional configuration. We test the predictions of two competing accounts: Mismatch‐and‐Repair and Partition‐Measure. They differ in their assumptions about lexical meanings: assumptions that have implications for the possible compositional mechanisms that each can invoke. Mismatch‐and‐Repair assumes that lexical meaning representations are discrete, separate from the conceptual system from which they originally emerged and brought into sentence meaning through syntactic composition. Partition‐Measure assumes that lexical meanings are contextually salient conceptual structures substantially indistinguishable from the conceptual system that they inhabit. During comprehension, lexical meanings construe a conceptual representation, in parallel, morphosyntactic and morphophonological composition as determined by the lexical items involved in the sentence. Whereas both hypotheses capture the observed cost in the punctual predicate plus for‐time adverbial composition (e.g., jump (vs. swim) for an hour), their predictions differ regarding iteration with durative predicates; for example, swim for a year (vs. for an hour). Mismatch‐and‐Repair predicts contrasting processing profiles and nonoverlapping activation patterns along punctuality differences. Partition‐Measure predicts overlapping processing and cortical distribution profiles, along the presence of iterativity. Results from a self‐paced reading and an functional Magnetic Resonance Imaging (fMRI) studies bear out the predictions of the Partition‐Measure account, supporting a view of linguistic meaning composition in line with an architecture of language whereby combinatoriality and generativity are distributed, carried out in parallel across linguistic and nonlinguistic subsystems. [ABSTRACT FROM AUTHOR]

The physiological aging process is well known for functional decline in visual abilities. Among the components of the visual system, the dorsal lateral geniculate nucleus (DLG) and superior colliculus (SC) provide a good model for aging investigations, as these structures constitute the main visual pathways for retinal inputs reaching the visual cortex. However, there are limited data available on quantitative morphological and neurochemical aspects in DLG and SC across lifespan. Here, we used optical density to determine immunoexpression of glial fibrillary acidic protein (GFAP) and design‐based stereological probes to estimate the neuronal number, total volume, and layer volume of the DLG and SC in marmosets (Callithrix jacchus), ranging from 36 to 143 months of age. Our results revealed an age‐related increase in total volume and layer volume of the DLG, with an overall stability in SC volume. Furthermore, a stable neuronal number was demonstrated in DLG and superficial layers of SC (SCv). A decrease in GFAP immunoexpression was observed in both visual centers. The results indicate region‐specific variability in volumetric parameter, possibly attributed to structural plastic events in response to inflammation and compensatory mechanisms at the cellular and subcellular level. Additionally, the DLG and SCv seem to be less vulnerable to aging effects in terms of neuronal number. The neuropeptidergic data suggest that reduced GFAP expression may reflect morphological atrophy in the astroglial cells. This study contributes to updating the current understanding of aging effects in the visual system and stablishes a crucial foundation for future research on visual perception throughout the aging process. [ABSTRACT FROM AUTHOR]

Skin architecture and its underlying vascular structure could be used to assess the health status of skin. A non‐invasive, high resolution and deep imaging modality able to visualize skin subcutaneous layers and vasculature structures could be useful for determining and characterizing skin disease and trauma. In this study, a multispectral high‐frequency, linear array‐based photoacoustic/ultrasound (PAUS) probe is developed and implemented for the imaging of rat skin in vivo. The study seeks to demonstrate the probe capabilities for visualizing the skin and its underlying structures, and for monitoring changes in skin structure and composition during a 5‐day course of a chemical burn. We analayze composition of lipids, water, oxy‐hemoglobin, and deoxy‐hemoglobin (for determination of oxygen saturation) in the skin tissue. The study successfully demonstrated the high‐frequency PAUS imaging probe was able to provide 3D images of the rat skin architecture, underlying vasculature structures, and oxygen saturation, water, lipids and total hemoglobin. [ABSTRACT FROM AUTHOR]

Summary: Background: Data on cost‐effectiveness of first‐line infliximab in paediatric patients with Crohn's disease are limited. Since biologics are increasingly prescribed and accompanied by high costs, this knowledge gap needs to be addressed. Aim: To investigate the cost‐effectiveness of first‐line infliximab compared to conventional treatment in children with moderate‐to‐severe Crohn's disease. Methods: We included patients from the Top‐down Infliximab Study in Kids with Crohn's disease randomised controlled trial. Children with newly diagnosed moderate‐to‐severe Crohn's disease were treated with azathioprine maintenance and either five induction infliximab (biosimilar) infusions or conventional induction treatment (exclusive enteral nutrition or corticosteroids). Direct healthcare consumption and costs were obtained per patient until week 104. This included data on outpatient hospital visits, hospital admissions, drug costs, endoscopies and surgeries. The primary health outcome was the odds ratio of being in clinical remission (weighted paediatric Crohn's disease activity index<12.5) during 104 weeks. Results: We included 89 patients (44 in the first‐line infliximab group and 45 in the conventional treatment group). Mean direct healthcare costs per patient were €36,784 for first‐line infliximab treatment and €36,874 for conventional treatment over 2 years (p = 0.981). The odds ratio of first‐line infliximab versus conventional treatment to be in clinical remission over 104 weeks was 1.56 (95%CI 1.03–2.35, p = 0.036). Conclusions: First‐line infliximab treatment resulted in higher odds of being in clinical remission without being more expensive, making it the dominant strategy over conventional treatment in the first 2 years after diagnosis in children with moderate‐to‐severe Crohn's disease. Trial registration number: NCT02517684. [ABSTRACT FROM AUTHOR]

Background and aims: E‐cigarette and other electronic nicotine delivery systems (ENDS) use has grown considerably over the past decade, with notable increases among young people. US state policy contexts for ENDS and tobacco may shape initiation into ENDS use among adolescents as they age into early adulthood. We aimed to determine whether state‐level comprehensive vaping ban policies reduce the odds of youth initiation into ENDS use, net of additional state‐level ENDS and tobacco policies, as well as the youth's cigarette smoking status. Design: Longitudinal data from the Population Assessment of Tobacco and Health study were merged with a state‐year database on tobacco and ENDS policies. Multivariable discrete‐time event history models of ENDS initiation were estimated. Setting: United States. Participants: Twenty thousand twelve youth assessed over six waves from 2013 to 2019 (n = 53 974 observations). Measurement We examined comprehensive indoor vaping bans (i.e. 100% vape‐free workplaces, restaurants and bars) as a key factor in initiation into ENDS use (i.e. first instance of vaping) from age 13 to 22. Findings Among young people, residing in a state with a comprehensive vaping ban was associated with 18% lower odds of ENDS initiation (odds ratio = 0.82; 95% confidence interval =[0.71, 0.94]), even after controlling for other state ENDS and tobacco policies, the youth's cigarette smoking and socio‐demographic background and state‐level covariates. Conclusions: In the United States, state‐level vaping bans (i.e. 100% vape‐free workplaces, restaurants and bars) are associated with reduced odds of youth initiation into electronic nicotine delivery systems use. [ABSTRACT FROM AUTHOR]

Summary: Synthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter. [ABSTRACT FROM AUTHOR]

Purpose: To assess the longitudinal vision‐related quality of life among patients with CRB1‐associated inherited retinal dystrophies. Methods: In this longitudinal questionnaire study, the National Eye Institute Visual Function Questionnaire (39 items, NEI VFQ‐39) was applied at baseline, two‐year follow‐up, and 4‐year follow‐up in patients with pathogenic CRB1 variants. [Correction added on 20 November 2023, after first online publication: The preceding sentence has been updated in this version.] Classical test theory was performed to obtain subdomain scores and in particular 'near activities' and 'total composite' scores. The Rasch analysis based on previous calibrations of the NEI VFQ‐25 was applied to create visual functioning and socio‐emotional subscales. Results: In total, 22 patients with a CRB1‐associated retinal dystrophy were included, [...] with a median age of 25.0 years (interquartile range: 13–31 years) at baseline and mean follow‐up of 4.0 ± 0.3 years. [Correction added on 20 November 2023, after first online publication: The preceding sentence has been updated in this version.] A significant decline at 4 years was observed for 'near activities' (51.0 ± 23.8 vs 35.4 ± 14.7, p = 0.004) and 'total composite' (63.0 ± 13.1 vs 52.0 ± 12.1, p = 0.001) subdomain scores. For the Rasch‐scaled scores, the 'visual functioning' scale significantly decreased after 2 years (−0.89 logits; p = 0.012), but not at 4‐year follow‐up (+0.01 logits; p = 0.975). [Correction added on 20 November 2023, after first online publication: In the preceding sentence, "...after 4 years..." has been corrected to "...after 2 years..." in this version.] The 'socio‐emotional' scale also showed a significant decline after 2 years (−0.78 logits, p = 0.033) and 4 years (−0.83 logits, p = 0.021). Conclusion: In the absence of an intervention, a decline in vision‐related quality of life is present in patients with pathogenic CRB1 variants at 4‐year follow‐up. Patient‐reported outcome measures should be included in future clinical trials, as they can be a potential indicator of disease progression and treatment efficacy. [ABSTRACT FROM AUTHOR]

The main purpose of this study was the comparison of the results of quantification obtained via different sample preparation approaches such as microwave‐assisted wet digestion (MAWD) and suspension preparation. Two total reflection x‐ray fluorescence (TXRF) spectrometers equipped with Mo x‐ray tubes were used to compare results obtained via two different paths of sample preparations which would further be compared to the conventional way of analysis by inductively coupled plasma optical emission spectrometry (ICP‐OES) including MAWD. Three dietary supplement samples with different sets and concentrations of elements were analyzed. The benefits and limitations of the simplified path of sample preparation were highlighted. A round‐robin test between TXRF and ICP‐OES was discussed. Accuracy as the percentage of recovery in all measurements ranged from 80 to 120. Precision for all results did not exceed 8% for TXRF and 5% for ICP‐OES. Limits of quantification by TXRF are ranged from 1 to 0.01 mg/pill for different elements. It was shown that suspension preparation of samples might be a useful response to increasing demand for quality control of dietary supplements since it is less time consuming and cost efficient. [ABSTRACT FROM AUTHOR]

Incorporating historical data into a current data analysis can improve estimation of parameters shared across both datasets and increase the power to detect associations of interest while reducing the time and cost of new data collection. Several methods for prior distribution elicitation have been introduced to allow for the data‐driven borrowing of historical information within a Bayesian analysis of the current data. We propose scaled Gaussian kernel density estimation (SGKDE) prior distributions as potentially more flexible alternatives. SGKDE priors directly use posterior samples collected from a historical data analysis to approximate probability density functions, whose variances depend on the degree of similarity between the historical and current datasets, which are used as prior distributions in the current data analysis. We compare the performances of the SGKDE priors with some existing approaches using a simulation study. Data from a recently completed phase III clinical trial of a maternal vaccine for respiratory syncytial virus are used to further explore the properties of SGKDE priors when designing a new clinical trial while incorporating historical data. Overall, both studies suggest that the new approach results in improved parameter estimation and power in the current data analysis compared to the considered existing methods. [ABSTRACT FROM AUTHOR]

Although Eastern Canadian liberal arts universities are portrayed as progressive work environments that cultivate inclusivity and diversity, the corporatisation of these public spaces has transformed them from institutions that once encouraged pluralism and acceptance among all social groups to spaces that unevenly distribute privileges among faculty and students based on ascribed characteristics, social class, and adherence to cisnormative and heteronormative expectations. Under neoliberal reforms, universities and unions adopt their own policies and procedures that legitimate institutional power abuse over marginalised women Contract Limited Term (CLT) assistant professors. Using material evidence from complaints filed with a province's Human Rights Commission and Labour Board, this critical autoethnographic case study explores the institutionalised responses to a disenfranchised woman CLT's discrimination and harassment by a student, departmental chair, faculty and university staff. A theory of genocidal mobbing is developed to conceptualise the organisational processes and practices that maintain the status quo of white heteropatriarchy and disentitle women CLTs to safety, equality and fair representation by their unions. Genocidal mobbing is efficient, because misogynistic administrators only require weaponising one disgruntled student, and effective, because administrators utilise the most fatal and insidious of gendered narcissistic abuse: gaslighting. The current neoliberal climate within academia puts marginalised women faculty at increased risk of genocidal mobbing from those with institutional power and from students with ethnic/racial and/or economic privilege. This article illuminates the union's culpability in the genocidal mobbing of women CLTs disenfranchised by multiple marginalised intersectional identities. Implications for future research and on policy are presented. [ABSTRACT FROM AUTHOR]

Grasses are one of the most successful and dispersed plant families worldwide and their environmental and economic values are widely acknowledged. They dominate the landscape of Cabo Verde, the southernmost and driest archipelago of Macaronesia, and are relevant natural resources for local populations, but a comprehensive evaluation of their distribution patterns is still lacking. In this study, we aim to evaluate the potential effects of climate change using the long‐term data concerning grass distribution in Cabo Verde and the widely recognized climatic variability of this archipelago, which entails a huge irregularity in spatial and temporal rainfall. We identified two contrasting climatic periods (wet, from 1929 to 1968, and dry, from 1969 to 2007) and gathered all the information available from the bibliography, herbaria, and fieldwork concerning spontaneous grass species recorded in Cabo Verde during those two periods, which amounted to 107 taxa. This information was then used to disclose the patterns of grass diversity as related to climatic and topographic variables (altitude and windward vs. leeward aspects). Different altitudinal shifts in the distribution patterns of grass species assemblages and an assemblage specific to the wet period were revealed by comparing the two climatic periods. The role of exposure in delimiting the altitudinal distribution of the various assemblages was highlighted; the trade winds clearly determine the distribution of grass assemblages. We detected shifts in the distribution of grass assemblages according to the climatic periods (related to the macroclimate) and local topographic factors (associated with mesoclimates). Also, functional traits (i.e., annuals vs. perennials, C3 vs. C4 grasses, and tropical vs. temperate species) were found to vary between wet and dry periods, as well as with altitude and with slope aspect. Understanding species distributions and the role of the climatic variability of Cabo Verde is crucial to predicting how climate change will affect them and thus to support effective management and conservation actions. [ABSTRACT FROM AUTHOR]

Spinocerebellar ataxia type 3/Machado–Joseph disease is the most common autosomal dominant ataxia. In view of the development of targeted therapies, knowledge of early biomarker changes is needed. We analyzed cross‐sectional data of 292 spinocerebellar ataxia type 3/Machado–Joseph disease mutation carriers. Blood concentrations of mutant ATXN3 were high before and after ataxia onset, whereas neurofilament light deviated from normal 13.3 years before onset. Pons and cerebellar white matter volumes decreased and deviated from normal 2.2 years and 0.6 years before ataxia onset. We propose a staging model of spinocerebellar ataxia type 3/Machado–Joseph disease that includes a biomarker stage characterized by objective indicators of neurodegeneration before ataxia onset. ANN NEUROL 2024;95:400–406 [ABSTRACT FROM AUTHOR]

The demand for information processing at ultrahigh speed with large data transmission capacity is continuously rising. Necessary building blocks for on‐chip photonic integrated circuits (PICs) are reconfigurable integrated low‐loss high‐speed modulators and switches. Phase change materials (PCMs) provide unique opportunities for integration into PICs. Here, the investigation of layered gallium monosulfide (GaS) as a novel low‐loss PCM from infrared to optical frequencies is pioneered, with high index contrast (Δn ≈0.5) at the optical telecommunication band. The GaS bandgap switches from 1.5 ± 0.2 eV for the amorphous state to 2.1 ± 0.1 eV for the crystalline state. It is demonstrated that the reversible GaS amorphous‐to‐crystalline phase transition can be operated thermally and by picosecond green (532 nm) laser irradiation. The design of a reconfigurable integrated optical modulator on‐chip based on Mach‐Zehnder Interferometers (MZI) with the GaS PCM cell deposited on one of the arms for application is presented at the telecommunication wavelength of λ = 1310 nm, where the standard single mode optical fiber exhibits zero chromatic dispersion, and at λ = 1550 nm, where a minimum optical loss of 0.22 dB km−1 is obtained. This opens the route to applications such as reconfigurable modulators, beam steering using phase modulation, and photonic neural networks. [ABSTRACT FROM AUTHOR]

Lasmiditan is an in vitro inhibitor of P‐glycoprotein (P‐gp) and breast cancer resistance protein (BCRP) efflux transporters. We aimed to confirm predictions from physiologically based pharmacokinetic models of lasmiditan, and assess the safety and tolerability of rosuvastatin and dabigatran co‐administered with lasmiditan. In this open‐label, post‐marketing drug–drug interaction, phase 1 clinical trial, eligible participants were adults aged 21‐70 years with a body mass index of 18.5‐35.0 kg/m2. Part 1 (P‐gp, 150 mg dabigatran etexilate with 200 mg lasmiditan) and part 2 (BCRP, 10 mg rosuvastatin with 200 mg lasmiditan) employed similar designs: a single dose of probe substrate administered on day −2 with pharmacokinetic evaluation; 1‐week washout; lasmiditan administered on days 8 and 9 alone; lasmiditan co‐administered with a single dose of probe substrate on day 10, with pharmacokinetic evaluation of probe substrate and lasmiditan. Sixty‐six participants were included in part 1 and 30 participants were included in part 2. Following dabigatran co‐administration with lasmiditan, versus dabigatran alone, 90% confidence intervals for geometric least‐squares (LS) mean ratios of area under the plasma concentration–time curve from time 0 extrapolated to infinity (AUC0–∞) and maximum observed drug concentration (Cmax) were not contained within the non‐effect boundaries (0.80 to 1.25). Dabigatran AUC0–∞ increased by 25% and Cmax increased by 22%. The median time of maximum observed drug concentration (tmax) for dabigatran was 2.0 to 3.0 hours. Following rosuvastatin co‐administration with lasmiditan, versus rosuvastatin alone, 90%CIs for geometric LS mean ratios of AUC0–∞ and Cmax were contained within non‐effect boundaries (0.80‐1.25). Rosuvastatin AUC0–∞ increased by 15% and Cmax increased by 7%. The median tmax for rosuvastatin was 4.0 hours. Results suggest that lasmiditan has a weak effect on P‐gp substrates and no clinically relevant effect on BCRP substrates. [ABSTRACT FROM AUTHOR]

This article explores the fundamental right to food, examining its legal framework, its relationship with other human rights, and the efforts being made globally to improve this right. It begins by looking at international and national laws that protect the right to food and examining their importance in ensuring food security and sovereignty. It then explores how food rights intersect with other rights, such as health, education, and labor, revealing the interrelated web of human rights. The article further highlights how the right to food is closely tied to the objectives of reducing poverty and promoting social justice, which are crucial components in the collective effort to achieve food security for all. Additionally, it evaluates the effectiveness of current policies and strategies in promoting the right to food, particularly in sub‐Saharan Africa. The novelty of the article is that it brings into perspective, the encumbrance of food sovereignty in sub‐Saharan Africa and concludes with potential solutions. [ABSTRACT FROM AUTHOR]

Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease caused by loss-of-function of SMN1. SMA is characterized by degeneration of motor neurons in the spinal cord, leading to progressive muscle weakness and atrophy. One of three currently available treatments is onasemnogene abeparvovec, an AAV9-based gene replacement therapy. Despite its effectiveness in improving motor function in SMA patients, its long-term safety profile remains unclear and adverse events such as liver toxicity are common. This may be caused by high vector dose or supraphysiological levels of SMN, driven by its strong, ubiquitous promoter. In this issue of EMBO Molecular Medicine, Xie et al addressed this by replacing the promoter of a benchmark virus—equivalent to onasemnogene abeparvovec—by an endogenous SMN1 promoter. In a common mouse model of SMA, treatment with this 2nd generation vector restored SMN expression close to physiological levels across tissues, resulting in improved safety and efficacy. This approach holds promise for safer and more efficacious AAV gene therapy for SMA and other diseases. E. Groen and M. Zwartkruis discuss improved gene therapy for spinal muscular atrophy as reported by J. Xie and colleagues, in this issue of EMBO Mol Med. [ABSTRACT FROM AUTHOR]

Although we have shown that steroid receptor coactivator-2 (SRC-2), a member of the p160/SRC family of transcriptional coregulators, is essential for decidualization of both human and murine endometrial stromal cells, SRC-2's role in the earlier stages of the implantation process have not been adequately addressed. Using a conditional SRC-2 knockout mouse (SRC-2d/d) in timed natural pregnancy studies, we show that endometrial SRC-2 is required for embryo attachment and adherence to the luminal epithelium. Implantation failure is associated with the persistent expression of Mucin 1 and E-cadherin on the apical surface and basolateral adherens junctions of the SRC-2d/d luminal epithelium, respectively. These findings indicate that the SRC-2d/d luminal epithelium fails to exhibit a plasma membrane transformation (PMT) state known to be required for the development of uterine receptivity. Transcriptomics demonstrated that the expression of genes involved in steroid hormone control of uterine receptivity were significantly disrupted in the SRC-2d/d endometrium as well as genes that control epithelial tight junctional biology and the emergence of the epithelial mesenchymal transition state, with the latter sharing similar biological properties with PMT. Collectively, these findings uncover a new role for endometrial SRC-2 in the induction of the luminal epithelial PMT state, which is a prerequisite for the development of uterine receptivity and early pregnancy establishment. [ABSTRACT FROM AUTHOR]

Objective: To develop a new method to quantify visually‐enhanced vestibulo‐ocular reflex (VVOR) gain, in patients with vestibular function loss, that is mathematically suitable given the nature of the test, and determine the reliability of the method by comparing results with those of the gold standard, the video head impulse test (vHIT). Materials and Methods: We developed a new method for VVOR gain quantification and conducted a cross‐sectional study in patients diagnosed with vestibular function loss and controls, all participants undergoing both a VVOR test and a vHIT. We measured VVOR gain with three different methods: area under the curve (AUC), slope regression, and a Fourier method (VVORAUC, VVORSP, and VVORFR, respectively); and compared these gain values with vHIT gain calculated using the AUC method. Results: Overall, 111 patients were included: 29 healthy subjects and 82 patients with vestibular function loss. Intraclass correlation coefficients (ICC(1,1)) between gain from the gold standard and each of the VVOR gain methods were: 0.68 (CI: 0.61–0.75) for VVORAUC, 0.66 (CI: 0.58–0.73) for VVORSP and 0.71 (CI: 0.64–0.77) for VVORFR. No interference was found between VVOR gain calculation methods and potentially influential variables considered (p ≥ 0.98). Conclusion: The new method for quantifying VVOR gain showed good concordance with the vHIT method. Level of Evidence: 2: Individual cross‐sectional studies with consistently applied reference standard and blinding (Diagnosis) Laryngoscope, 133:3554–3563, 2023 [ABSTRACT FROM AUTHOR]

Therapies reconstituting autologous antiviral immunocompetence may represent an important prophylaxis and treatment for immunosuppressed individuals. Following hematopoietic cell transplantation (HCT), patients are susceptible to Herpesviridae including cytomegalovirus (CMV). We show in a murine model of HCT that macrophage colony‐stimulating factor (M‐CSF) promoted rapid antiviral activity and protection from viremia caused by murine CMV. M‐CSF given at transplantation stimulated sequential myeloid and natural killer (NK) cell differentiation culminating in increased NK cell numbers, production of granzyme B and interferon‐γ. This depended upon M‐CSF‐induced myelopoiesis leading to IL15Rα‐mediated presentation of IL‐15 on monocytes, augmented by type I interferons from plasmacytoid dendritic cells. Demonstrating relevance to human HCT, M‐CSF induced myelomonocytic IL15Rα expression and numbers of functional NK cells in G‐CSF‐mobilized hematopoietic stem and progenitor cells. Together, M‐CSF‐induced myelopoiesis triggered an integrated differentiation of myeloid and NK cells to protect HCT recipients from CMV. Thus, our results identify a rationale for the therapeutic use of M‐CSF to rapidly reconstitute antiviral activity in immunocompromised individuals, which may provide a general paradigm to boost innate antiviral immunocompetence using host‐directed therapies. Synopsis: Herpesviridae like CMV are a major cause of morbidity and mortality in patients after HCT. Therapies reconstituting the host's antiviral immunocompetence for prophylaxis and treatment are an unmet medical need since licensed therapies are either insufficiently effective or have severe side effects. M‐CSF protects from lethal murine CMV viremia during leukopenia following hematopoietic cell transplantation, a vulnerable period of immunosuppression, by rapidly reconstituting donor hematopoietic stem and progenitor cells.M‐CSF stimulates a coordinated myeloid and NK cell differentiation program resulting in increased NK cell numbers and activity, which depends on M‐CSF‐induced myelopoiesis generating IL‐15‐producing monocytes and I‐IFN‐producing pDCs.No impairment of long‐term hematopoietic stem cell engraftment or acute graft‐versus‐host‐disease after M‐CSF treatment was observed.In G‐CSF‐mobilized human PBMCs M‐CSF also stimulates monopoiesis, IL15Rα expression in monocytes and functional NK cell differentiation.M‐CSF could provide a general host‐directed antiviral cytokine therapy, to complement pathogen‐directed antiviral therapies in immunosuppressed conditions beyond HCT, such as post‐chemotherapy leukopenia or septicemia. [ABSTRACT FROM AUTHOR]

Transplantation is a high‐risk, high‐cost treatment for end‐stage diseases and is the most strictly regulated area of healthcare in the United States. Thus, achieving success for patients and the program requires skillful and collaborative leadership. Various factors, such as outcomes, volume, and financial health, may measure the success of a transplant program. Strong collaboration between clinical and administrative leaders is key to achieving and maintaining success in those three categories. Clinical leaders of adult programs, such as medical and surgical directors, bear the primary responsibility for a program's volume, outcomes, and patient safety, while administrative directors are focused on business intelligence and regulatory compliance. This paper aims to provide readers with insights into the critical role of collaborative leadership in running a successful program, with a focus on clinical, business, and regulatory perspectives. [ABSTRACT FROM AUTHOR]

Ultraviolet (UV) radiation can elicit both bactericidal and bacteriostatic activity depending on light parameters and targeted bacteria. Current methods based on bacterial growth on solid medium allow measurement of only bactericidal but not bacteriostatic activity, while liquid cultures exhibit low light penetration. Here, we propose a method to quantify both bactericidal and bacteriostatic activity of radiation based on (a) bacterial cultures on solid medium, (b) acquisition and quantitative analysis of photographic images of plates containing bacterial colonies, (c) application of two mathematical equations to evaluate bactericidal and bacteriostatic activity. The proposed method considers the differences in growth on test and control (unexposed) plates. The measurements performed on the plates image are the independent variables of the mathematical equations returning the values of bactericidal and bacteriostatic activity. Experimentally, a test was performed using Escherichia coli grown on a solid medium and exposed to UVA (365 nm) radiation. The standard method allowed quantifying bactericidal activity and evaluating only qualitatively bacteriostatic activity of the radiation. Differently, the new method here proposed allowed quantification of both activities. The proposed method proved to be simple, enabling deep assessment of the antibacterial effects of UV radiation directly on the solid medium through image acquisition and analysis. [ABSTRACT FROM AUTHOR]

Demand for nonhuman primates in research has increased over the past several years, while nonhuman primate supply remains a challenge in the United States. Global nonhuman primate supply issues make it increasingly important to maximize domestic colony production. To explore how housing conditions across primate breeding colonies impact infant survival and animal production more broadly, we collected medical records from 7959 rhesus macaques (Macaca mulatta) and 492 pigtail macaques (Macaca nemestrina) across seven breeding facilities and used generalized mixed‐effect modeling to determine prenatal and infant survival odds by housing type and group size. Infant survival odds for each housing type and group size varied for prenatal, neonatal, early infant, and late infant age groups. Odds of prenatal survival were lowest in paired indoor housing and small and medium outdoor groups. No housing type performed better than large outdoor groups for neonatal survival. Odds of early infant survival was greatest in indoor and mixed indoor/outdoor housing compared to large outdoor enclosures. Large outdoor housing was associated with higher survival odds for late infant survival compared to small and medium outdoor housing. These results may influence housing choices at macaque breeding facilities hoping to maximize infant success, although there are relative care costs, the promotion of species‐typical behaviors, and infrastructure factors to also consider. Our study used an interinstitutional collaboration that allowed for the analysis of more infant macaque medical records than ever before and used the broad variations across the seven national primate research centers to make the results applicable to many other facilities housing macaques. Research highlights: Small indoor and small mixed indoor/outdoor housing types were associated with positive or similar odds of survival to large outdoor housing from prenatal to 1 year of age.Small and medium outdoor housing provided negative or similar odds of prenatal and infant survival compared to large outdoor housing.This interinstitutional collaboration allowed examination of infant macaque medical records across the broad variations of the seven national primate research centers to make the results applicable to many other facilities housing macaques. [ABSTRACT FROM AUTHOR]

Background and Aims: The mechanisms governing the progression of non‐alcoholic fatty liver disease (NAFLD) towards steatohepatitis (NASH) and hepatocellular carcinoma (HCC) remain elusive. Here, we evaluated the role of hsa‐miRNA‐21‐5p in NASH‐related hepatocarcinogenesis. Methods: Hepatic hsa‐miR‐21‐5p expression was evaluated in two cohorts of patients with biopsy‐proven NAFLD (n = 199) or HCC (n = 366 HCC and n = 11 NAFLD‐HCC). Serum/liver metabolomic profiles were correlated with hsa‐miR‐21‐5p in NAFLD obese patients. Wild‐type (WT) and Mir21 KO mice were fed a choline‐deficient, amino acid‐defined (CDAA) diet for 32 and 66 weeks to induce NASH and NASH‐HCC, respectively. Results: In obese individuals, hsa‐miR‐21‐5p expression increased with NAFLD severity and associated with a hepatic lipotoxic profile. CDAA‐fed WT mice displayed increased hepatic mmu‐miR‐21‐5p levels and progressively developed NASH and fibrosis, with livers presenting macroscopically discernible pre‐neoplastic nodules, hyperplastic foci and deregulated cancer‐related pathways. Mir21 KO mice exhibited peroxisome‐proliferator‐activated receptor α (PPARα) activation, augmented mitochondrial activity, reduced liver injury and NAS below the threshold for NASH diagnosis, with the pro‐inflammatory/fibrogenic milieu reversing to baseline levels. In parallel, Mir21 KO mice displayed reduced number of pre‐neoplastic nodules, hepatocyte proliferation and activation of oncogenic signalling, being protected from NASH‐associated carcinogenesis. The hsa‐miRNA‐21‐5p/PPARα pathway was similarly deregulated in patients with HCC‐ or NASH‐related HCC, correlating with HCC markers and worse prognosis. Conclusions: Hsa‐miR‐21‐5p is a key inducer of whole‐spectrum NAFLD progression, from simple steatosis to NASH and NASH‐associated carcinogenesis. The inhibition of hsa‐miR‐21‐5p, leading to a pro‐metabolic profile, might constitute an appealing therapeutic approach to ameliorate NASH and prevent progression towards HCC. [ABSTRACT FROM AUTHOR]

Introduction: Bronchial anastomotic dehiscence (AD) is an uncommon complication following lung transplantation that carries significant morbidity and mortality. The objective of this study was to characterize fungal and bacterial infections in ADs, including whether infections following AD were associated with progression to bronchial stenosis. Methods: This was a single‐center study of 615 lung transplant recipients between 6/1/2015 and 12/31/2021. Airway complications were defined according to ISHLT consensus guidelines. Results: 22 of the 615 recipients (3.6%) developed an AD. Bronchial ischemia or necrosis was common prior to dehiscence (68.1%). Fourteen (63.6%) recipients had bacterial airway infections, most commonly with Gram‐negative rods, prior to dehiscence. Thirteen (59.1%) recipients had an associated pleural infection, most commonly with Candida species (30.8%). Post‐dehiscence Aspergillus species were isolated in 4 recipients, 3 of which were de novo infections. Eleven had bacterial infections prior to dehiscence resolution, most commonly with Pseudomonas aeruginosa. Eleven recipients developed airway stenosis requiring dilation and/or stenting. Development of secondary infection prior to AD resolution was not associated with progression to stenosis (OR =.41, 95% CI =.05‐3.30, p =.41). Conclusions: Gram‐negative bacterial infections are common before and after AD. Pleural infection should be suspected in most cases. Infections prior to healing were not associated with subsequent development of airway stenosis. [ABSTRACT FROM AUTHOR]

Background and Objectives: The objective of this work was to evaluate the processing of black rice grains to obtain flour and to verify the influence of pretreatments on mass transfer, in vitro digestibility, and technological properties. The grains were submitted to heat moisture treatment (HMT) with a final humidity of 30% at 110°C for 2 h, black rice pretreatment with ethanol (BRE) in the proportion 1:1 (wt/wt) for 5 min/25°C, and high hydrostatic pressure (HHP) under conditions of 200 MPa for 10 min/25°C. Then, the grains were dried at 60°C at an air velocity of 1.5 m/s and ground in an electric multigrain grinder. Was analyzed the mass transfer, in vitro digestion, water, oil, and milk retention capacity, total phenolic compounds (TPC), total anthocyanins (TA), antioxidant activities by (2,2′‐azino‐bis‐(3‐ethylbenzothiazoline‐6‐sulfonic) acid, 2,2‐diphenyl‐1‐picrylhydrazyl, ferric‐reducing antioxidant power, and oxygen radical absorbance capacity Surface appearance by scanning electron microscopy, and thermal analysis by differential scanning calorimetry was carried out. Findings: The grains when submitted to the HHP obtained a reduction of 58.82% in the drying time, while the HMT promoted an increase of 23.5% when compared to the control. The pretreatments influenced the in vitro digestibility, where the HHP had the highest value (86.33), as well as the highest water, oil, and milk retention capacities. BRE positively impacted TPC, TA, and antioxidant activities regardless of the methods used. HMT promoted the formation of cavities, fissures, and holes on the surface, resulting in a rough appearance and presenting greater thermal resistance with an enthalpy of 12.35 J/g. Conclusions: This research paved the way for potential commercial applications of black rice flour as an ingredient in functional foods. Significance and Novelty: This study adds to the significance and novelty of research on black rice processing by evaluating the influence of different pretreatments on mass transfer, in vitro digestibility, and technological properties. [ABSTRACT FROM AUTHOR]

INTRODUCTION: Cardiovascular fat is a novel risk factor that may link to dementia. Fat volume and radiodensity are measurements of fat quantity and quality, respectively. Importantly, high fat radiodensity could indicate healthy or adverse metabolic processes. METHODS: The associations of cardiovascular fat (including epicardial, paracardial, and thoracic perivascular adipose tissue [PVAT]) quantity and quality assessed at mean age of 51 with subsequent cognitive performance measured repeatedly over 16 years of follow‐up were examined using mixed models among 531 women. RESULTS: Higher thoracic PVAT volume was associated with a higher future episodic memory (β[standard error (SE)] = 0.08 [0.04], P = 0.033), while higher thoracic PVAT radiodensity with lower future episodic (β[SE] = −0.06 [0.03], P = 0.045) and working (β[SE] = −0.24 [0.08], P = 0.003) memories. The latter association is prominent at higher volume of thoracic PVAT. DISCUSSION: Mid‐life thoracic PVAT may have a distinct contribution to future cognition possibly due to its distinct adipose tissue type (brown fat) and anatomical proximity to the brain circulation. HIGHLIGHTS: Higher mid‐life thoracic perivascular adipose tissue (thoracic PVAT) volume is related to a better future episodic memory in women.Higher mid‐life thoracic PVAT radiodensity is related to worse future working and episodic memories.Negative association of high thoracic PVAT radiodensity with working memory is prominent at higher thoracic PVAT volume.Mid‐life thoracic PVAT is linked to future memory loss, an early sign of Alzheimer's disease.Mid‐life women's epicardial and paracardial fat are not related to future cognition. [ABSTRACT FROM AUTHOR]

INTRODUCTION: The challenge of accounting for practice effects (PEs) when modeling cognitive change was amplified by the COVID‐19 pandemic, which introduced period and mode effects that may bias the estimation of cognitive trajectory. METHODS: In three Kaiser Permanente Northern California prospective cohorts, we compared predicted cognitive trajectories and the association of grip strength with cognitive decline using three approaches: (1) no acknowledgment of PE, (2) inclusion of a wave indicator, and (3) constraining PE based on a preliminary model (APM) fit using a subset of the data. RESULTS: APM‐based correction for PEs based on balanced, pre‐pandemic data, and with current age as the timescale produced the smallest discrepancy between within‐person and between‐person estimated age effects. Estimated associations between grip strength and cognitive decline were not sensitive to the approach used. DISCUSSION: Constraining PEs based on a preliminary model is a flexible, pragmatic approach allowing for meaningful interpretation of cognitive change. Highlights: The magnitude of practice effects (PEs) varied widely by study.When PEs were present, the three PE approaches resulted in divergent estimated age‐related cognitive trajectories.Estimated age‐related cognitive trajectories were sometimes implausible in models that did not account for PEs. The associations between grip strength and cognitive decline did not differ by the PE approach used.Constraining PEs based on estimates from a preliminary model allows for a meaningful interpretation of cognitive change. [ABSTRACT FROM AUTHOR]

Maturation of functional liquid‐like biomolecular condensates into solid‐like aggregates has been linked to the onset of several neurodegenerative disorders. Low‐complexity aromatic‐rich kinked segments (LARKS) contained in numerous RNA‐binding proteins can promote aggregation by forming inter‐protein β‐sheet fibrils that accumulate over time and ultimately drive the liquid‐to‐solid transition of the condensates. Here, atomistic molecular dynamics simulations are combined with sequence‐dependent coarse‐grained models of various resolutions to investigate the role of LARKS abundance and position within the amino acid sequence in the maturation of condensates. Remarkably, proteins with tail‐located LARKS display much higher viscosity over time than those in which the LARKS are placed toward the center. Yet, at very long timescales, proteins with a single LARKS—independently of its location—can still relax and form high viscous liquid condensates. However, phase‐separated condensates of proteins containing two or more LARKS become kinetically trapped due to the formation of percolated β‐sheet networks that display gel‐like behavior. Furthermore, as a work case example, they demonstrate how shifting the location of the LARKS‐containing low‐complexity domain of FUS protein toward its center effectively precludes the accumulation of β‐sheet fibrils in FUS‐RNA condensates, maintaining functional liquid‐like behavior without ageing. [ABSTRACT FROM AUTHOR]

This study was carried out to evaluate the effects of supplementation with different levels of copper (Cu) and zinc (Zn), using two mineral sources (sulphate and hydroxy forms), on the bone characteristics, skin strength/elasticity, and haematological parameters of broilers. A total of 1792 1‐day‐old male Cobb‐500 broiler chickens were randomly distributed among eight dietary treatments, using Cu sulphate (CSM) or hydroxychloride (CHC), and Zn sulphate (ZSM) or hydroxychloride (ZHC). The dietary treatments were as follows: (1) low‐CSM/high‐ZSM, (2) high‐CSM/high‐ZSM, (3) low‐CHC/low‐ZHC, (4) low‐CHC/medium‐ZHC, (5) low‐CHC/high‐ZHC, (6) high‐CHC/low‐ZHC, (7) high‐CHC/medium‐ZHC, and (8) high‐CHC/high‐ZHC. On Day 42, blood samples were collected from one bird/pen to analyze the haematological parameters. Finally, two birds/pen were slaughtered, and the tibia and femur were collected to analyze the quality of bone and skin. The means were subjected to ANOVA and, when significant, compared by Tukey's test (p < 0.05) or Dunnett's (p < 0.05) test. The haematological parameters were not influenced by mineral supplementation. However, the inclusion of low ZHC enhanced the skin strength compared to high ZHC (p = 0.046). Furthermore, the bone mineral density of the tibia proximal epiphysis, tibia ash and tibia mineral content were positively improved with supplementation of low‐CHC/medium‐ZHC compared to high‐CHC/medium‐ZHC. This study demonstrated that hydroxy compounds are potential alternatives for replacing sulphate supplements in broiler diets. Moreover, among the Cu and Zn levels, the low CHC (15 mg/kg) and medium ZHC (100 mg/kg) improved bone development and skin integrity, suggesting that the combination of Cu and Zn can be a nutritional strategy to prevent the incidence of leg disorders in broilers. [ABSTRACT FROM AUTHOR]

Agricultural commodity production is a major driver of tropical deforestation and biodiversity loss. Natural rubber from Hevea brasiliensis, a valuable commodity without viable substitutes, has recently been included in the European Union (EU) deforestation regulation that aims to halt imports of goods containing embedded deforestation. Sustained growth in demand for rubber is driven by increasing tire production, caused by rising transport flows and personal car ownership. We show that average natural rubber yields remain static, meaning 2.7–5.3 million ha of additional plantations could be needed by 2030 to meet demand. A systematic literature search identified 106 case studies concerning transitions to and from rubber, revealing that substantial rubber plantation area expansion since 2010 has occurred at the expense of natural forest. Eliminating deforestation from rubber supply chains requires support for millions of smallholder growers to maintain or increase production from existing plantations, without land or water degradation. Supply chain traceability efforts offer opportunities to deliver such support. While the inclusion of rubber in EU legislation is a positive step, it is critical to ensure that smallholders are not marginalized to avoid exacerbating poverty, and that other markets follow suit to avoid displacement of rubber‐driven deforestation to unregulated markets. [ABSTRACT FROM AUTHOR]