Search

PDF file - 40K, Effect of Erlotinib (6 mg/kg BW/day) on Time of Appearance of Methylnitrosourea- Induced Mammary Cancers in Female Sprague-Dawley Rats.

PDF file - 50K

Treatment results for patients with newly diagnosed FMS-like tyrosine kinase 3 (FLT3)-mutated (FLT3mut+) acute myeloid leukemia (AML) ineligible for intensive chemotherapy are disappointing. This multicenter, open-label, phase 3 trial randomized (2:1) untreated adults with FLT3mut+ AML ineligible for intensive induction chemotherapy to receive gilteritinib (120 mg/d orally) and azacitidine (GIL + AZA) or azacitidine (AZA) alone. The primary end point was overall survival (OS). At the interim analysis (August 26, 2020), a total of 123 patients were randomized to treatment (GIL + AZA, n = 74; AZA, n = 49). Subsequent AML therapy, including FLT3 inhibitors, was received by 20.3% (GIL + AZA) and 44.9% (AZA) of patients. Median OS was 9.82 (GIL + AZA) and 8.87 (AZA) months (hazard ratio, 0.916; 95% CI, 0.529-1.585; P = .753). The study was closed based on the protocol-specified boundary for futility. Median event-free survival was 0.03 month in both arms. Event-free survival defined by using composite complete remission (CRc) was 4.53 months for GIL + AZA and 0.03 month for AZA (hazard ratio, 0.686; 95% CI, 0.433-1.087; P = .156). CRc rates were 58.1% (GIL + AZA) and 26.5% (AZA) (difference, 31.4%; 95% CI, 13.1-49.7; P < .001). Adverse event (AE) rates were similar for GIL + AZA (100%) and AZA (95.7%); grade ≥3 AEs were 95.9% and 89.4%, respectively. Common AEs with GIL + AZA included pyrexia (47.9%) and diarrhea (38.4%). Gilteritinib steady-state trough concentrations did not differ between GIL + AZA and gilteritinib. GIL + AZA resulted in significantly higher CRc rates, although similar OS compared with AZA. Results support the safety/tolerability and clinical activity of upfront therapy with GIL + AZA in older/unfit patients with FLT3mut+ AML. This trial was registered at www.clinicaltrials.gov as #NCT02752035.

Background: Patients with acute myeloid leukemia (AML) in remission are at high risk of relapse, warranting remission-prolonging therapy. Gilteritinib is the first FMS-like tyrosine kinase 3 (FLT3) inhibitor approved as monotherapy in FLT3-mutated relapsed/refractory AML. The aim of the study was to compare relapse-free survival (RFS) in patients with FLT3/internal tandem duplication AML in first complete remission who received gilteritinib or placebo. Method: In this phase 2, double-blind trial, patients were randomized 2:1 to gilteritinib (120 mg) or placebo once daily for up to 2 years, beginning after completion of induction/consolidation (I/C) therapy. RFS, defined as time from randomization date until the date of documented relapse or death from any cause was assessed via independent review committee adjudication (primary efficacy endpoint). Overall survival (OS) was defined as the time from date of randomization until date of death from any cause. Survival and treatment-emergent adverse events (TEAEs) were assessed 30 days after treatment discontinuation, and every 3 months thereafter. Due to a slow accrual rate, this trial (NCT02927262) was changed from a planned phase 3 to phase 2 based on the reduction in sample size. Results: 124 patients were screened and 98 were randomized (gilteritinib 63, placebo 35) and are included in the full analysis set (FAS), of whom 32 (gilteritinib 20, placebo 12) completed 2 years of treatment. The safety analysis set (SAF) comprised 97 patients (gilteritinib 62, placebo 35) who had received ≥1 dose of study drug. In the FAS, relapse occurred in 31/63 (49.2%) gilteritinib- and 20/35 (57.1%) placebo-treated patients; 3/63 (4.8%) gilteritinib-treated patients died without relapse. RFS was not significantly improved with gilteritinib vs placebo (hazard ratio [HR] 0.738, 95% confidence interval [CI] 0.407-1.336; 1-sided stratified log-rank p-value 0.163). Median RFS was 24.02 months for gilteritinib and 15.84 months for placebo. OS in the FAS was not significantly different between treatments (gilteritinib 21/63, [33.3%], placebo 11/35 [31.4%]; HR 1.130, 95% CI 0.540-2.364; 1-sided stratified log-rank p-value 0.627). Median OS was not reached in either arm. TEAEs in the SAF occurred in 58/62 (93.5%) gilteritinib- and 33/35 (94.3%) placebo-treated patients including, respectively, 51/62 (82.3%) and 20/35 (57.1%) drug-related TEAEs and 10/62 (16.1%) and 3/35 (8.6%) serious drug-related TEAEs. The most common TEAEs were increased blood creatine phosphokinase (gilteritinib 18/62 [29.0%], placebo 1/35 [2.9%]) and thrombocytopenia (gilteritinib 12/62 [19.4%], placebo 4/35 [11.4%]). Conclusion: Gilteritinib showed improved RFS versus placebo, but the difference was not statistically significant. There were no new safety findings in the gilteritinib arm. Citation Format: Mark D. Minden, Jacob M. Rowe, Emmanuel Gyan, Kohmei Kubo, Nahla Hasabou, David Delgado, Wensheng He, Stanley C. Gill, Jason E. Hill, Ramon Tiu. A phase 2, multicenter, randomized, double-blind trial of maintenance therapy with FLT3 inhibitor gilteritinib (ASP2215) in patients with FLT3/ITD AML (GOSSAMER study) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr CT537.

There are few options for prophylaxis after exposure to Bacillus anthracis , especially in children and women of childbearing potential. Faropenem is a β-lactam in the penem subclass that is being developed as an oral prodrug, faropenem medoxomil, for the treatment of respiratory tract infections. Faropenem was shown to have in vitro activity against B. anthracis strains that variably express the bla1 β-lactamase (MIC range, ≤0.06 to 1 μg/ml). In this study we evaluated the pharmacokinetic-pharmacodynamic (PK-PD) relationships between the plasma faropenem free-drug ( f ) concentrations and efficacy against B. anthracis in a murine postexposure prophylaxis inhalation model. The plasma PKs and PKs-PDs of faropenem were evaluated in BALB/c mice following the intraperitoneal (i.p.) administration of doses ranging from 2.5 to 160 mg/kg of body weight. For the evaluation of efficacy, mice received by inhalation aerosol doses of B. anthracis (Ames strain; faropenem MIC, 0.06 μg/ml) at 100 times the 50% lethal dose. The faropenem dosing regimens (10, 20, 40, and 80 mg/kg/day) were administered i.p. at 24 h postchallenge at 4-, 6-, and 12-h intervals for 14 days. The sigmoid maximum-threshold-of-efficacy ( E max ) model fit the survival data, in which the free-drug area under the concentration-time curve ( f AUC)/MIC ratio, the maximum concentration of free drug in plasma ( fC max )/MIC ratio, and the cumulative percentage of a 24-h period that the free-drug concentration exceeds the MIC under steady-state pharmacokinetic conditions ( f % T MIC ) were each evaluated. Assessment of f % T MIC demonstrated the strongest correlation with survival ( R 2 = 0.967) compared to the correlations achieved by assessment of f AUC/MIC or fC max /MIC, for which minimal correlations were observed. The 50% effective dose (ED 50 ), ED 90 , and ED 99 corresponded to f % T MIC values of 10.6, 13.4, and 16.4%, respectively, and E max was 89.3%. Overall, faropenem demonstrated a high level of activity against B. anthracis in the murine postexposure prophylaxis inhalation model.

Background: Gilteritinib (ASP2215) is a novel, highly selective, potent oral FLT3/AXL inhibitor with preclinical activity against FLT3-ITD activating and FLT3-D835 resistance mutations. The objectives of this phase 1/2 study were to assess gilteritinib safety/tolerability, pharmacokinetic (PK) and pharmacodynamic (PD) profiles after single- and multiple-day dosing, and antileukemic effects in patients with R/R AML. Methods: This open-label study (NCT02014558) enrolled patients (≥18 yr) into 1 of 7 dose-escalation cohorts (20-450 mg once daily [QD]) or concomitant dose-expansion cohorts. While confirmed FLT3 mutation was not an inclusion criterion, each expanded dose level enrolled ≥10 patients with FLT3 mutations (FLT3mut+); 120 and 200 mg dose levels were further expanded with ≥40 FLT3mut+ patients. The choice to expand these dose cohorts was based upon FLT3 inhibition in correlative assays and clinical activity seen during dose escalation. Safety and tolerability were primary endpoints; blood samples were drawn from patients in the dose-escalation cohorts to evaluate gilteritinib PK parameters and PD effects. Antileukemic response rates (eg, complete remission [CR], CR with incomplete platelet recovery [CRp], CR with incomplete hematological recovery [CRi], overall response rate [ORR]) were secondary endpoints. Results: Patients (N=252; 129M:123F, median age 62 yr [range: 21-90]) enrolled between October 2013 and August 2015 received ≥1 dose of gilteritinib. The study population was heavily pretreated: 70% (n=177) had ≥2 prior AML therapies, 29% (n=73) had a prior stem cell transplant, and 25% (n=63) had prior TKI treatment with sorafenib most commonly used. Across the study, 194 patients had a locally confirmed FLT3 mutation (ITD, n=159; D835, n=13; ITD-D835, n=16; other, n=6). For all enrolled patients, progressive disease (n=75), lack of efficacy (n=44), adverse events (n=34), and death (n=29) were the most common reasons for treatment discontinuation. Seven deaths were considered possibly/probably related to treatment: pulmonary embolism, respiratory failure, hemoptysis, intracranial bleed, ventricular fibrillation, septic shock, and neutropenia (all n=1). Maximum tolerated dose was determined to be 300 mg when 2 of 3 patients in the 450 mg cohort experienced diarrhea and/or hepatic transaminase elevation as dose-limiting toxicities. Diarrhea (16%) and fatigue (15%) were the most commonly reported treatment-related adverse events of any grade. Less than 5% of patients (11/252) had a maximum post-baseline QTcF interval >500 msec. Gilteritinib concentrations were generally dose proportional and showed both a long-elimination half-life (45-159 h) and substantial accumulation (3.2-10 fold) by day 15. An exposure-related increase in the inhibition of FLT3 phosphorylation with increasing doses of gilteritinib was also observed. Gilteritinib showed strong antileukemic activity in FLT3mut+ patients (ORR=49%); response was observed less frequently in patients with wild-type FLT3 (ORR=12%). While CR, CRi, and CRp occurred at all doses, responses were enriched among FLT3mut+ patients with gilteritinib steady-state trough concentrations ≥100 ng/mL, which correlated with potent FLT3 inhibition in PD assays and corresponded to doses ≥80 mg. The ORR in 169 FLT3mut+ patients receiving ≥80 mg was 52% (Table); median overall survival in this patient population was ~31 wk (range: 1.7-61; Figure) and median duration of response was 20 wk (range: 1.1-55). Clinical responses occurred in FLT3mut+ patients with -ITD, -D835, and both mutations (ORR: 55%, 17%, and 62%, respectively) as well as in FLT3mut+ patients with or without prior TKI treatment (ORR: 42% vs 56%, respectively). Conclusions: This PD-driven, first-in-human study shows that gilteritinib was well tolerated and generated frequent, prolonged, clinically important responses in FLT3mut+ patients with R/R AML. Antileukemic responses were enriched in FLT3mut+ patients treated at doses that consistently and potently inhibited FLT3 phosphorylation. The survival of these patients appears better than expected for this patient population when treated with standard therapy. Our data suggest that FLT3 inhibition may improve survival in patients with FLT3mut+R/R AML; as such, phase 3 testing of oral gilteritinib 120 mg QD in patients with FLT3mut+R/R AML after first-line therapy is underway (NCT02421939). Disclosures Perl: Astellas US Pharma Inc.: Consultancy, Membership on an entity's Board of Directors or advisory committees; Daichi Sankyo: Consultancy, Membership on an entity's Board of Directors or advisory committees; Asana Biosciences: Consultancy, Membership on an entity's Board of Directors or advisory committees; Arog Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees; Actinium Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees. Altman:Janssen: Other: advisory board; BMS: Membership on an entity's Board of Directors or advisory committees; Spectrum: Other: advisory board; Ariad: Other: advisory board; Seattle Genetics: Other: advisory board; Syros: Other: advisory board. Cortes:ARIAD: Consultancy, Research Funding; BMS: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; Pfizer: Consultancy, Research Funding; Teva: Research Funding. Smith:Astellas: Research Funding. Erba:Jannsen: Consultancy, Research Funding; Millennium Pharmaceuticals, Inc.: Research Funding; Agios: Research Funding; Juno: Research Funding; Incyte: Consultancy, DSMB, Speakers Bureau; Daiichi Sankyo: Consultancy; Ariad: Consultancy; Amgen: Consultancy, Research Funding; Astellas: Research Funding; Gylcomimetics: Other: DSMB; Seattle Genetics: Consultancy, Research Funding; Sunesis: Consultancy; Novartis: Consultancy, Speakers Bureau; Celator: Research Funding; Celgene: Consultancy, Speakers Bureau; Pfizer: Consultancy. Gill:Astellas: Employment. Goldberg:Bristol Myers Squibb, Novartis: Speakers Bureau; Novartis: Consultancy; COTA Inc: Employment; Pfizer: Honoraria; Neostem: Equity Ownership. Jurcic:Astellas: Research Funding. Larson:Astellas: Consultancy, Research Funding; Bristol-Myers Squibb: Consultancy. Liu:Astellas: Employment. Ritchie:Celgene: Consultancy, Other: Travel, Accomodations, Expenses, Speakers Bureau; Incyte: Consultancy, Speakers Bureau; Novartis: Consultancy, Other: Travel, Accommodations, Expenses, Research Funding, Speakers Bureau; Ariad: Speakers Bureau; Pfizer: Consultancy, Research Funding; Astellas Pharma: Research Funding; Bristol-Meyers Squibb: Research Funding; NS Pharma: Research Funding. Schiller:Incyte Corporation: Research Funding. Strickland:Celator: Research Funding; Cyclacel: Research Funding; Karyopharm Therapeutica: Research Funding; GlaxoSmithKline: Research Funding; Baxalta: Consultancy; Boehringer Ingelheim: Consultancy, Research Funding; Ambit: Consultancy; Alexion Pharmaceuticals: Consultancy; Astellas Pharma: Research Funding; CTI Biopharma: Consultancy; Daiichi Sankyo: Consultancy; Sunesis Pharmaceuticals: Consultancy, Research Funding; Abbvie: Research Funding; Sanofi: Research Funding. Wang:Incyte: Speakers Bureau; Immunogen: Research Funding. Stuart:Sunesis: Consultancy, Honoraria, Other: Travel, Accomodations, Expenses, Research Funding; Agios: Research Funding; Incyte: Research Funding; Bayer: Research Funding; Celator: Research Funding; Astellas: Research Funding. Martinelli:Ariad: Consultancy, Speakers Bureau; Pfizer: Consultancy, Speakers Bureau; BMS: Speakers Bureau; Roche: Consultancy, Speakers Bureau; MSD: Consultancy; Genentech: Consultancy; Novartis: Speakers Bureau; Celgene: Consultancy, Speakers Bureau; Amgen: Consultancy, Speakers Bureau. Bahceci:Astellas: Employment. Levis:Millennium: Consultancy, Research Funding; Astellas: Consultancy, Honoraria, Research Funding; Daiichi-Sankyo: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Research Funding.

Mesangial cell proliferation and matrix accumulation, driven by platelet-derived growth factor (PDGF), contribute to many progressive renal diseases. In a novel approach to antagonize PDGF, we investigated the effects of a nuclease-resistant high-affinity oligonucleotide aptamer in vitro and in vivo. In cultured mesangial cells, the aptamer markedly suppressed PDGF-BB but not epidermal- or fibroblast-growth-factor-2-induced proliferation. In vivo effects of the aptamer were evaluated in a rat mesangioproliferative glomerulonephritis model. Twice-daily intravenous (i.v.) injections from days 3 to 8 after disease induction of 2.2 mg/kg PDGF-B aptamer, coupled to 40-kd polyethylene glycol (PEG), led to 1) a reduction of glomerular mitoses by 64% on day 6 and by 78% on day 9, 2) a reduction of proliferating mesangial cells by 95% on day 9, 3) markedly reduced glomerular expression of endogenous PDGF B-chain, 4) reduced glomerular monocyte/macrophage influx on day 6 after disease induction, and 5) a marked reduction of glomerular extracellular matrix overproduction (as assessed by analysis of fibronectin and type IV collagen) both on the protein and mRNA level. The administration of equivalent amounts of a PEG-coupled aptamer with a scrambled sequence or PEG alone had no beneficial effect on the natural course of the disease. These data show that specific inhibition of growth factors using custom-designed, high-affinity aptamers is feasible and effective.

EGF receptor (EGFR) inhibitors are used in the therapy of lung and pancreatic cancers and effectively prevent cancers in multiple animal models. Although daily dosing with erlotinib is effective, weekly dosing may reduce toxicity and have advantages, particularly for prevention. We tested alternative dosing regimens for preventive/therapeutic efficacy in a rat mammary cancer model. For prevention, erlotinib was administered by gavage beginning 5 days after methylnitrosourea (MNU). For therapy and biomarker studies, rats with palpable mammary cancers were treated for six weeks or for six days, respectively. Experiment A, erlotinib (6 mg/kg body weight/day, intragastric): daily (7 times/week); one day on/one day off; and two days on/two days off. All regimens decreased tumor incidence, increased tumor latency, and decreased cancer multiplicity versus controls (P < 0.01). However, intermittent dosing was less effective than daily dosing (P < 0.05). Experiment B, erlotinib (6 mg/kg body weight/day) daily or two days on/two days off or one time per week at 42 mg/kg body weight. All regimens reduced cancer incidence and multiplicity versus controls (P < 0.01). Interestingly, daily and weekly dosing were equally effective (P > 0.5). Experiment C, erlotinib administered at 42 or 21 mg/kg body weight 1 time per week, decreased tumor incidence and multiplicity (P < 0.01). Erlotinib had a serum half-life of ≤8 hours and weekly treatment yielded effective serum levels for ≤48 hours. Daily or weekly treatment of cancer bearing rats reduced mammary tumor size 25% to 35%, whereas control cancers increased >250%. Levels of phosphorylated extracellular signal-regulated kinase (ERK) were strongly decreased in rats treated daily/weekly with erlotinib. Thus, altering the dose of erlotinib retained most of its preventive and therapeutic efficacy, and based on prior clinical studies, is likely to reduce its toxicity. Cancer Prev Res; 6(5); 448–54. ©2013 AACR.

Introduction: ASP2215, a new tyrosine kinase inhibitor with activity against FMS-like receptor tyrosine kinase-3 (FLT3) and AXL receptor tyrosine kinase, is currently in development for the treatment of acute myeloid leukemia (AML). Methods: In an ongoing, first-in-human Phase 1/2, dose-escalation/dose-expansion study, the pharmacokinetic (PK) profile and pharmacodynamic (PD) effects of ASP2215 were evaluated under fasting conditions in patients with relapsed or refractory AML (R/R AML). Patients who met study criteria were assigned to treatment in the dose-escalation cohorts or were randomized to an open dose level in the dose-expansion cohorts. The dose-escalation cohort was a modified 3+3 with accelerated titration design that evaluated ascending oral doses of ASP2215 (20-450 mg), the dose-expansion cohort was a parallel, multi-dose-expansion cohort. Blood samples were collected and safety/tolerability assessments, including 12-lead electrocardiogram, were evaluated at protocol-specified time points for both cohorts. Effect of increasing ASP2215 exposure on inhibition of FLT3 phosphorylation, assessed via plasma inhibitory assay (PIA), was evaluated using an inhibitory PK/PD Emaxmodel. PK/PD analyses were performed to evaluate the relationship between ASP2215 exposure and changes from baseline in QTcF intervals (ΔQTcF) and changes from baseline in clinical laboratory values (e.g., creatinine kinase [ΔCK], aspartate aminotransferase [ΔAST]). Results: Data from an interim analysis of the dose-escalation/dose-expansion study were available from 215 subjects (n=23 [dose escalation], n=192 [dose expansion]). The ASP2215 PK parameters across the dose range (20-450 mg), evaluated after both single- and multiple-dose administration, are presented (Table); statistical analyses suggest the ASP2215 PK parameters are dose proportional from 20-450 mg. Median time to maximal concentration (Tmax) was observed between 2 hr and 6 hr after single and repeated oral dosing. The estimated median half-life (t1/2) ranged from approximately 45 hr to 159 hr based on the accumulation ratio; ASP2215 accumulation was extensive after multiple dose administration as reflected by the accumulation index (Rac) ranging from approximately 3.2-10. A strong correlation was shown for ASP2215 exposure-related inhibition of FLT3 phosphorylation, with >90% FLT3 inhibition observed by Day 8 at ASP2215 doses of ≥80 mg. Although a positive slope was observed between ΔQTcF and ASP2215 exposure, only 5% of the study population were reported as having a maximum post-baseline QTcF interval >500 msec. A similar trend was observed with ASP2215 concentration-related increases in ΔCK and ΔAST; however, Conclusions: ASP2215 has demonstrated exposure-related FLT3 inhibition and a pharmacokinetic profile that support once-daily oral administration for the treatment of AML in subjects who relapsed after, or are refractory to, induction or salvage treatment. Table. ASP2215 Pharmacokinetic Parameters after Multiple-Dose Administration 20 mg (n=4) 40 mg (n=3) 80 mg (n=3) 120 mg (n=3) 200 mg (n=2) 300 mg (n=3) 450 mg (n=3) Cmax(ng/mL) 45.6 (30.5, 137) 106 (76.7, 140) 396 (217, 516) 282 (248, 593) 1460 (886, 2040) 1260 (1040, 2280) 1150 (776, 1530) Tmax(hr) 4.01 (4.00, 6.00) 3.87 (0.500, 6.00) 4.33 (4.00, 4.42) 2.02 (1.95, 5.75) 6.03 (6.00, 6.07) 6.05 (4.08, 6.07) 5.00 (4.07, 5.93) AUC0-24(ng·h/mL) 926 (543, 2480) 2460 (1750, 2800) 6280 (4160, 10600) 6190 (4200, 11300) 31500 (16500, 46600) 28700 (22300, 43300) 11500 (8070, 14900) t1/2 (hr) 52.8 (39.7, 83.1) 83.7 (68.5, 243) 91.5 (60.9, 108) 45.3 (30.5, 63.3) 143 (99.7, 186) 159 (83.3, 187) 56.9 (51.5, 62.3) Rac 3.70 (2.92, 5.51) 5.55 (4.64, 15.1) 6.02 (4.18, 7.02) 3.25 (2.38, 4.33) 9.08 (6.51, 11.7) 10.1 (5.53, 11.7) 3.94 (3.62, 4.27) Data are presented as median (minimum, maximum). AUC0-24, area under the concentration-time curve between 0-24 hr; Cmax, maximal concentration; t1/2, elimination half-life; Tmax, time to maximal concentration; Rac, accumulation ratio. Disclosures Smith: Astellas: Research Funding; Plexxikon: Research Funding. Off Label Use: ASP2215 is an investigational product for the treatment of AML. Perl:Astellas US Pharma Inc.: Consultancy; Ambit/Daichi Sankyo: Consultancy; Arog Pharmaceuticals: Consultancy; Asana Biosciences: Consultancy; Actinium Pharmaceuticals: Consultancy. Altman:Novartis: Other: Advisory board; BMS: Other: Advisory board; Seattle Genetics: Other: Advisory board; Spectrum: Other: Advisory board; Ariad: Other: Advisory board; Astellas: Other: Advisory board; assistance with abstract preparation. Gill:Astellas Pharma US, Inc: Employment. Kadokura:Astellas Pharma Global Development: Employment, Other: Personal fees. Yuen:Astellas Pharma, Inc.: Employment. Fisniku:Astellas: Employment. Liu:Astellas: Employment. Nagase:Astellas: Employment. Sargent:Astellas Pharma US, Inc: Employment. Bahceci:Astellas Pharma Global Development: Employment.

Background : Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) is a potent inducer of new blood vessel growth (angiogenesis) that contributes to the pathology of many angiogenesis-associated disease states such as psoriasis, rheumatoid arthritis and cancer. Few molecular entities capable of binding to VPF/VEGF with high affinity and specificity have been described to date. Results : Nuclease-resistant 2′-amino-2′-deoxypyrimidine nucleotide RNA (2′-aminopyrimidine RNA) ligands that bind to VPF/VEGF with high affinity have been identified by iterative rounds of affinity-selection/amplification from two independent random libraries. The sequence information that confers high affinity binding toVPF/VEGF is contained in a contiguous stretch of 24 nucleotides, 5′- CCCUGAUGGUAGACGCCGGGGUG -3′ (2′-aminopyrimidine nucleotides are designated with italic letters). Of the 14 ribopurines in this minimal ligand, 10 can be substituted with the corresponding 2′-O-methylpurine nucleotides without a reduction in binding affinity to VPF/VEGF. In fact, the 2′ O-methyl substitution at permissive positions leads to a ∼17-fold improvement in the binding affinity to VPF/VEGF The higher affinity results from the reduction in the dissociation rate constant of the 2′-O-methyl-substituted RNA ligand from the protein compared to the unsubstituted ligand. The 2′-O-methyl-substituted minimal ligand, which folds into a bulged hairpin motif, is also more thermally stable than the unsubstituted ligand. Nuclease resistance of the ligand is further improved by the 2′-O-methyl substitutions and the addition of short phosphorothioate caps to the 3′- and 5′-ends. Conclusions : We have used the SELEX (systematic evolution of ligands by exponential enrichment) process in conjunction with post-SELEX modifications to define a highly nuclease-resistant oligonucleotide that binds to VPF/VEGF with high affinity and specificity.

Abstract 4327 Quizartinib (AC220) is an oral tyrosine kinase inhibitor that has shown promising activity in refractory/relapsed acute myeloid leukemia patients in a Phase 1 and a Phase 2 study. The absorption, metabolism, and excretion of quizartinib were characterized in healthy volunteers in a Phase 1 mass balance study. Six healthy males (mean ± SD age 29 ± 8.4 years) received a single oral dose of 60 mg quizartinib as a solution; approximately 1.6% of the total dose was labeled with 14C (approximately 100 μCi). Blood, plasma, urine, and feces were collected for 14 days (336 h) after dosing. Maximum mean ± SD blood radioactivity concentrations, reached 4 h after dosing, were 296 ± 67.4 ng equivalents/g. Maximum blood radioactivity concentrations in individual subjects occurred 4 h after dosing and ranged from 228 to 397 ng equivalents/g. Excretion of radioactivity was relatively consistent throughout the study. The maximum mean ± SD urinary concentration of radioactivity was 112 ± 52.3 ng equivalents/g at 8 to 24 hours after dosing, and the maximum mean ± SD fecal concentration of radioactivity was 51,100 ± 21,300 ng equivalents/g at 24 to 48 h after dosing. A mean ± SD of 1.64 ± 0.482% of the dose was recovered in urine, and 76.3 ± 6.23% was recovered in feces. The overall mean ± SD recovery of radioactivity in urine and feces was 78.0 ± 6.24% over the course of the study, with recovery from individual subjects ranging from 72.4% to 88.3%. Excretion of radioactivity was still ongoing at study completion (336 h). Recovery of The major radiolabeled components of plasma were unchanged quizartinib and the oxidative metabolite AC886. Five additional metabolites in plasma were identified by LC-MS but could not be identified by measurement of radioactivity, because of low levels. Eighteen radioactive peaks in urine were detected, representing less than 0.09% of the administered dose, but their putative structures could not be identified because of low levels. Quizartinib was extensively metabolized, with the metabolites excreted primarily in feces, suggesting hepatobiliary excretion of radioactivity, non-biliary excretion into the gastrointestinal tract, or metabolism within the gastrointestinal tract. Forty-two radioactive peaks were detected in fecal extracts, of which unchanged quizartinib was a significant radioactive component (mean of 4.0% of the administered radioactive dose), and 15 metabolites, each representing a mean of 1.0% to 3.5% of the administered radioactive dose, were identified. Quizartinib was predominantly metabolized by phase I biotransformations, as was evident by the absence of any conjugates of quizartinib or of oxidative metabolites under the analytical conditions used to profile plasma, urine, and feces. Quizartinib was metabolized by multiple biotransformation pathways, including oxidation, reduction, dealkylation, deamination, and hydrolysis, and by combinations of these pathways. Quizartinib was well tolerated as a single 60 mg dose in this study. There were no clinically significant changes in vital signs, ECGs, or laboratory test results. Two subjects experienced adverse events. Grade 1 dry skin in 1 subject was considered to be unrelated to study treatment, and Grade 1 diarrhea in 1 subject was considered to be possibly related to treatment. The results of this study indicated that, in humans, quizartinib was orally available and predominantly eliminated in feces, with renal clearance as a minor elimination route, and that AC886 was the only major metabolite in the circulation. Disclosures: Li: Ambit Biosciences: Employment. Bresnahan:Ambit Biosciences: Employment. Gammon:Ambit Biosciences: Employment. Sanga:Covance Laboratories, Inc.: Employment. Hale:Covance, Inc.: Employment. Hashimoto:Astellas Pharma, Inc.: Employment. Gill:Astellas Pharma, Inc.: Employment. James:Ambit Biosciences: Employment.

Species of RNA that bind with high affinity and specificity to the bronchodilator theophylline were identified by selection from an oligonucleotide library. One RNA molecule binds to theophylline with a dissociation constant Kd of 0.1 microM. This binding affinity is 10,000-fold greater than the RNA molecule's affinity for caffeine, which differs from theophylline only by a methyl group at nitrogen atom N-7. Analysis by nuclear magnetic resonance indicates that this RNA molecule undergoes a significant change in its conformation or dynamics upon theophylline binding. Binding studies of compounds chemically related to theophylline have revealed structural features required for the observed binding specificity. These results demonstrate the ability of RNA molecules to exhibit an extremely high degree of ligand recognition and discrimination.