5 results on '"Fanyun ZENG"'
Search Results
2. Chiral Diamine in Small Molecule Biomimetic Asymmetric Catalysis
- Author
-
Yifan Li, Yanfeng Dang, Fanyun Zeng, Bo Li, Jianhui Huang, Yuan Zhang, Chen Chen, Liu Liu, Guotao Lin, Yuting Yan, Mingyu Zhang, and Shihao Huang
- Subjects
Addition reaction ,Chemistry ,Ligand ,Commodity chemicals ,Enantioselective synthesis ,Reactivity (chemistry) ,Enantiomer ,Combinatorial chemistry ,Small molecule ,Catalysis - Abstract
Enzymatic reaction, as an environmentally friendly approach, has made great progress producing commodity chemicals comparing to the conventional metallo/organo catalysis. However, the reaction compatibility is not satisfactory. The development of biomimetic catalysis balancing both strategies for the green and broad application in synthesis is desirable. Here, we report the design and synthesis of a chiral diamine catalyst fulfilling this requirement. Asymmetric addition reactions using this ligand in water were demonstrated and the corresponding products were produced in excellent yields and enantiomeric ratios. This pluripotent ligand has also shown good reactivity/enantioselectivity on a number of representative reactions in both green and organic solvents. We anticipate that the ligand would allow further development of other catalysts for important yet challenging green stereoselective transformations.
- Published
- 2021
3. First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China
- Author
-
Haibo Long, Jun Peng, Fanyun Zeng, and C. Bai
- Subjects
Meloidogyne enterolobii ,Nematology ,Intergenic region ,biology ,Marantaceae ,Botany ,Root-knot nematode ,Plant Science ,Fabaceae ,Internal transcribed spacer ,biology.organism_classification ,Convolvulaceae ,Agronomy and Crop Science - Abstract
Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.
- Published
- 2019
4. Development of a real-time fluorescence loop-mediated isothermal amplification assay for rapid and quantitative detection of Fusarium oxysporum f. sp. niveum in soil
- Author
-
Yuelin Pei, Haibo Long, Guo Jianrong, Yuanfeng Zhan, Jun Peng, and Fanyun Zeng
- Subjects
Fusarium ,Detection limit ,biology ,Loop-mediated isothermal amplification ,Reproducibility of Results ,biology.organism_classification ,Real-Time Polymerase Chain Reaction ,Microbiology ,Sensitivity and Specificity ,Fusarium wilt ,law.invention ,Spore ,law ,Fusarium oxysporum ,Genetics ,DNA, Fungal ,Molecular Biology ,Pathogen ,Nucleic Acid Amplification Techniques ,Polymerase chain reaction ,Soil Microbiology - Abstract
Fusarium wilt caused by Fusarium oxysporum f. sp. niveum (Fon) is one of the major limiting factors for watermelon production worldwide. Rapid and accurate detection of the causal pathogen is the cornerstone of integrated disease management. In this paper, a real-time fluorescence loop-mediated isothermal amplification (RealAmp) assay was developed for the rapid and quantitative detection of Fon in soil. Positive products were amplified only from Fon isolates and not from any other species or formae speciales of F. oxysporum tested, showing a high specificity of the primer sets. The detection limit of the RealAmp assay was 1.2 pg μL(-1) genomic DNA or 10(3) spores g(-1) of artificially inoculated soil, whereas real-time PCR could detect as low as 12 fg μL(-1) or 10(2) spores g(-1). The RealAmp assay was further applied to detect eight artificially inoculated and 85 field soil samples. No significant differences were found between the results tested by the RealAmp and real-time PCR assays. The RealAmp assay is a simple, rapid and effective technique for the quantitative detection and monitoring of Fon in soil under natural conditions.
- Published
- 2013
5. The Kinome of Edible and Medicinal Fungus Wolfiporia cocos.
- Author
-
Wei Wei, Shaohua Shu, Wenjun Zhu, Ying Xiong, Fang Peng, Joerger, Rolf Dieter, and Fanyun Zeng
- Subjects
EDIBLE fungi ,SCLEROTIUM (Mycelium) - Abstract
Wolfiporia cocos is an edible and medicinal fungus that grows in association with pine trees, and its dried sclerotium, known as Fuling in China, has been used as a traditional medicine in East Asian countries for centuries. Nearly 10% of the traditional Chinese medicinal preparations contain W. cocos. Currently, the commercial production of Fuling is limited because of the lack of pine-based substrate and paucity of knowledge about the sclerotial development of the fungus. Since protein kinase (PKs) play significant roles in the regulation of growth, development, reproduction, and environmental responses in filamentous fungi, the kinome of W. cocos was analyzed by identifying the PKs genes, studying transcript profiles and assigning PKs to orthologous groups. Of the 10 putative PKs, 11 encode atypical PKs, and 13, 10, 2, 22, and 11 could encoded PKs from the AGC, CAMK, CK, CMGC, STE, and TLK Groups, respectively. The level of transcripts from PK genes associated with sclerotia formation in the mycelium and sclerotium stages were analyzed by qRT-PCR. Based on the functions of the orthologs in Sclerotinia sclerotiorum (a sclerotia-formation fungus) and Saccharomyces cerevisiae, the potential roles of these W. cocos PKs were assigned. To the best of our knowledge, our study is the first identification and functional discussion of the kinome in the edible and medicinal fungus W. cocos. Our study systematically suggests potential roles of W. cocos PKs and provide comprehensive and novel insights into W. cocos sclerotial development and other economically important traits. Additionally, based on our result, genetic engineering can be employed for over expression or interference of some significant PKs genes to promote sclerotial growth and the accumulation of active compounds. [ABSTRACT FROM AUTHOR]
- Published
- 2016
- Full Text
- View/download PDF
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.