Search

Idiopathic membranous nephropathy (iMN) is considered an immune-mediated disease where circulating autoantibodies against podocyte targets (mainly the PLA2R) cause the deposition of in-situ subepithelial immune-complexes. The consequent podocyte damage may cause cell detachment in urine (Podocyturia-PdoU). PdoU has been assessed in different kidney diseases, but limited data are available in iMN. In this study all patients with a diagnosis of iMN between 15/12/1999–16/07/2014 were tested for PLA2R antibodies (Ab anti-PLA2R, ELISA kit) and PdoU by flow cytometry with anti-podocalyxin antibody. A semi-quantitative PdoU score was defined according to the percentage of podocalyxin positive cells normalized to the total volume of sample and set relative to the urine creatinine measured in the supernatant. PdoU was positive in 17/27 patients (63%; 1+ score in 6/27—22.2%, 2+ in 4/27—14.8%, 3+ in 2/27—7.4%, 4+ in 5/27—18.5%). Only 2/7 patients with complete remission showed a positive PdoU (1+) while all six patients without remission have significant PdoU. PdoU+ was statistically correlated with the absence of remission and Ab anti-PLA2R + (p 2R antibody levels also in the cohort of patients with two available PdoU tests. In conclusion, PdoU could be detected in iMN and seems to be associated with commonly considered markers of disease activity (proteinuria and Ab anti-PLA2R) with a non-linear correlation. Despite data should be confirmed in large and prospective cohorts, according to the podocyte depletion hypothesis PdoU may represent an early marker of immunological activation with potential prognostic utility.

Idiopathic membranous nephropathy (iMN) is considered an immune-mediated disease where circulating autoantibodies against podocyte targets (mainly the PLA

Acute kidney injury following traumatic brain injury is associated with poor outcome. We investigated in vitro the effects of plasma of brain injured patients with acute tubular kidney injury on kidney tubular epithelial cell function. we performed a prospective observational clinical study in ICU in a trauma centre of the University hospital in Italy including twenty-three ICU patients with traumatic brain injury consecutively enrolled. Demographic data were recorded on admission: age 39 ± 19, Glasgow Coma Score 5 (3–8). Neutrophil Gelatinase-Associated Lipocalin and inflammatory mediators were measured in plasma on admission and after 24, 48 and 72 hours; urine were collected for immunoelectrophoresis having healthy volunteers as controls. Human renal proximal tubular epithelial cells were stimulated with patients or controls plasma. Adhesion of freshly isolated human neutrophils and trans-epithelial electrical resistance were assessed; cell viability (XTT assay), apoptosis (TUNEL staining), Neutrophil Gelatinase-Associated Lipocalin and Megalin expression (quantitative real-time PCR) were measured. All patients with normal serum creatinine showed increased plasmatic Neutrophil Gelatinase-Associated Lipocalin and increased urinary Retinol Binding Protein and α1-microglobulin. Neutrophil Gelatinase-Associated Lipocalin was significantly correlated with both inflammatory mediators and markers of tubular damage. Patient’ plasma incubated with tubular cells significantly increased adhesion of neutrophils, reduced trans-epithelial electrical resistance, exerted a cytotoxic effect and triggered apoptosis and down-regulated the endocytic receptor Megalin compared to control. Plasma of brain injured patients with increased markers of subclinical acute kidney induced a pro-inflammatory phenotype, cellular dysfunction and apoptotic death in tubular epithelial cells.

Filippo Mariano,1 Chiara Cogno,1 Fulvia Giaretta,2,3 Ilaria Deambrosis,2,3 Simona Pozza,4 Maurizio Berardino,5 Giuseppe Massazza,6 Luigi Biancone1,3 1Department of General and Specialist Medicine, Nephrology, Dialysis and Transplantation Unit, City of Health and Science, CTO Hospital, Turin, 2Department of General and Specialist Medicine, Laboratory of Nephrology and Immunopathology, City of Health and Science, Molinette Hospital, Turin, 3Department of Medical Sciences, University of Turin, Turin, 4Department of Radiology and Radiotherapy, CTO Radiology, City of Health and Science, CTO Hospital, Turin, 5Department of Anesthesiology and Intensive Care, Anesthesiology and Intensive Care5, City of Health and Science, CTO Hospital, Turin, 6Department of Orthopedics and Traumatology, Week Hospital Unit, City of Health and Science, CTO Hospital, and University of Turin, Turin, Italy Background: Parenteral administration of ketorolac is very effective in controlling postoperative pain for orthopedic surgery. Ketorolac can induce clinically relevant renal alterations in elderly patients, whereas its short course is considered safe for young adults with normal preoperative renal function. In this study, of a cohort of young adults undergoing elective orthopedic day surgery, we sought cases complicated by readmission due to acute kidney injury (AKI).Patients and methods: Among 1397 young adults, aged 18–32years who were admitted to undergo orthopedic day surgery from 2013 to 2015, four patients (0.29%, three males/one female) treated in postprocedure with ketorolac (from 60 to 90mg/day for 1–2days) were readmitted for suspected severe AKI. We evaluated functional outcome, urinary protein profiles and kidney biopsy (1 patient).Results: After day surgery discharge, they experienced gastrointestinal disturbances, flank pain and fever. Readmitted on post-surgery days 3–4, they presented with oliguric AKI (creatinine range 158.4–466.4µmol/L) and frank proteinuria (albumin range 2.1–6.0 g/L). Urine protein profiles demonstrated a nonselective glomerular proteinuria, with a significant 9.4-fold increase in glomerular/tubular index on day 6. Kidney biopsy on day 19 showed normal glomeruli and minimal tubular alterations and negative immunofluorescence. All patients recovered their renal function, and after 20days proteinuria disappeared.Conclusion: AKI can ensue even in young adults who have undergone a short course of ketorolac, when they suffered from relative dehydration, abdominal disturbances, flank pain and oliguria after discharge. Urine findings were characterized by a marked nonselective glomerular proteinuria disappearing in 2–3weeks. Keywords: ketorolac, acute kidney injury, glomerular tubular index, orthopedic day surgery

Objective Autologous transplantation of bone marrow (BM) and peripheral blood progenitor cells (PBPC) is commonly used for treatment of multiple myeloma (MM). Although both stem cell sources harbor residual clonal cells, a quantitative evaluation of their level of tumor contamination (LTC) still needs to be performed through highly accurate and reproducible approaches. In this study, we used a validated real-time polymerase chain reaction (PCR) strategy to evaluate LTC of BM and PBPC samples obtained from MM patients. Materials and Methods. The patients underwent two different mobilization courses (defined as early or late course) following two cycles of cyclophosphamide 5 g/m 2 . LTC was evaluated by measuring the number of clonal immunoglobulin heavy-chain rearrangements followed by normalization of samples using the GAPDH gene. Results. Overall, 26 PBPC and 12 BM samples were analyzed. Main results are as follows. 1) PBPC harvests are less contaminated than BM samples taken immediately after each mobilization course (median difference 2.68 logs; range 1.7 to 4.6) ( p bright cells is compared to real-time PCR results. This suggests that in PBPC, most CD38 bright cells do not belong to the neoplastic clone. Conclusions. Real-time PCR using the IgH rearrangement proved an effective tool for monitoring LTC in stem cell harvests from MM patients. The smaller LTC of PBPC harvests supports the role of PBPC as stem cell rescue for MM patients compared to BM cells.

Bcr/abl fusion gene, in experimental models, induces survival to growth factor deprivation and hypersensitivity to IL3. However, conflicting data were reported about chronic myeloid leukemia (CML) progenitors. We investigated the responsiveness of purified CML CFU-GM to GM-CSF/IL3 and their survival to growth factor deprivation. CFU-GM hypersensitivity to IL3 and/or GM-CSF was found in 3/11 CML cases only. CML CFU-GM survived well in stroma-free 'mass' culture (5 x 10(4) cells/ml) without cytokine addition, up to day 11, average recovery being around 95% in medium + 10% fetal bovine serum and 67-81% in serum-free medium. Conversely, normal progenitors declined steadily, particularly after extensive purification (18 +/- 10% recovery at the 7th day), and in serum-free medium (4 +/- 6% recovery). By contrast, normal and CML CFU-GM declined in a similar way in limiting dilution cultures (1-10 cells/50 microl). We also investigated the effects of retinoic acid and alpha-interferon on CFU-GM survival. Both all-trans- and 13-cis retinoic acid, particularly in combination with alpha-interferon, reduced CML CFU-GM recovery down to normal progenitors' values. In conclusion, hypersensitivity to CSFs is rare in CML, whereas resistance to growth factor deprivation has been confirmed in mass, but not in limiting, dilution cultures. Both stereoisomers of retinoic acid, at therapeutic concentrations and in combination with alpha-interferon, can overcome the survival advantage of CML progenitors.

The possibility of reducing tumour cell contamination by cytotoxic drug courses prior to peripheral blood progenitor cell (PBPC) collection was evaluated in two consecutives groups of multiple myeloma (MM) patient candidates for autograft. All patients were at disease onset and received two VAD (vincristine. doxorubicin and dexamethasone) courses as initial debulking. In the first group (44 patients), mobilization and harvest were performed 'upfront'. after a single cyclophosphamide (CY) administration of 4 g/m 2 : in the second group (17 patients). PBPC were collected at the end of a high-dose sequential chemotherapy programme, including: CY 5 g/m 2 , etoposide (VP16) 2 g/m 2 . a chemotherapy-free interval with three courses of high-dose dexamethasone, a final mobilizing CY at 7 g/m 2 . G-CSF was given following each high-dose cytotoxic drug. Cytofluorimetric analysis was performed to quantify progenitors (CD34 + cells) and plasma cells, identified by the high CD38 expression and/or CD38 and CD138 coexpression. Large amounts of PBPC were collected in either group (median harvested CD34 + /kg: 15.8 x10 6 and 13.4 x 10 6 , respectively; P= 0.9). Circulating plasma cells were significantly higher in patients mobilized 'upfront' compared to those who received the high-dose sequence (median peak values of CD38 bright /μl: 39 and 10, respectively; P= 0.02); a similar difference was observed in the amount of contaminating plasma cells in the harvest products (median CD38 bright /kg: 7.4 x 10 6 and 1.3x10 6 , respectively; P= 0.02). The results demonstrate that an in vivo purging approach is feasible in myeloma patients through repeated high-dose chemotherapy courses; this may provide less-contaminated material suitable for further in vitro purging procedures.

Peripheral blood progenitor cell (PBPC) mobilization was evaluated in 53 patients receiving the high-dose sequential (HDS) regimen: 27 had non-Hodgkin's lymphoma or Hodgkin's disease, primary refractory or at first relapse, 26 had non-Hodgkin's lymphoma at diagnosis. Mobilization was assessed following either 7 g/m2 cyclophosphamide (48 patients) or 2 g/m2 etoposide, both followed by G-CSF (filgrastim) at 5 microg/kg/d. PBPC mobilization was significantly higher in patients at diagnosis compared to refractory/relapsed patients (median peak values of circulating CFU-GM: 25,209/ml v 4270/ml, P < 0.0001 and CD34+ cells: 286/microl v 47/microl, P < 0.0001). All patients receiving HDS as up-front treatment mobilized enough PBPC for an autograft, often requiring a single leukapheresis; whereas only 15 patients under salvage treatment with HDS were able to complete PBPC autograft. Bone marrow (BM) cells, alone or with PBPC, were needed in six patients, and autograft could not be performed in six patients. Among refractory/relapsed patients, those having a high PBPC mobilization experienced a significantly longer EFS compared to those who had not; autograft completion also significantly enhanced EFS. Thus, the use of an effective mobilizing protocol does not ensure adequate PBPC mobilization in moderately pretreated patients; low mobilization must be considered as an early sign of poor outcome in patients receiving a high-dose salvage programme.

Peripheral blood (PB) T cells from 56 patients with B-cell chronic lymphocytic leukemia (B-CLL) were analyzed by two- and three-color immunofluorescence (IF) to determine the expansion of distinct T-cell subsets and their relationship with the clinical and biological features of the disease. We detected the expansion of an unusual T-cell subpopulation expressing lower CD4 or CD8 levels (CD4lo, CD8lo) than classic T cells (CD4hi, CD8hi). This subpopulation also expressed low levels of the CD3/TCR alpha/beta complex and was CD19-CD13-CD14-. A phenotypic analysis probing the activation level of CD4lo, CD8lo, CD4hi, and CD8hi cells showed that they comprised increased counts of HLA-DR+, CD11b+, CD45R0+, and CD45RA+ cells. Subset expansion ranged from 2.1- to 13.6-fold. Statistical analysis showed that the size of some of these subsets was correlated to intrinsic features of the tumor. First, CD4loHLA-DR+ cell counts were higher in patients with stage A than those with stages B and C disease. Second, CD8loHLA-DR+ cell counts were higher in patients in stable remission than in those at diagnosis. Third, CD4loHLA-DR+, CD4loCD45R0+, CD4loCD45RA+, and CD4hiCD11b+ cell counts were higher in patients whose tumor cells expressed high levels of surface immunoglobulin (sIg) than in those expressing low levels. The involvement of CD4lo and CD8lo cells in most of these correlations suggests that they may be tumor-reactive cells. Similar cells described in human and murine autoimmune disease have been shown to be autoreactive anergic cells, which may derive from nonclassic pathways of T-cell development.

Association of type 1 diabetes and cytomegalovirus (CMV) is suspected and CMV infections have also been linked to increased risk of new onset post-transplantation diabetes. We monitored response to islet autoantigens, pancreatic endocrine function, and CMV infections in one type 1 diabetic patient receiving pancreas allograft. Time course analyses of levels of islet autoantibodies (Abs), IFN-gamma ELISPOT response, analysis of T cell function, levels of C peptide together with CMV pp65 antigenaemia and viraemia and graft biopsy histopathology were performed in comparison with a cohort of diabetic recipients. Evidence of autoimmune activation to GAD and IA2, modification of CD4(+) CD25hi T cells, loss of pancreatic function, concomitantly with multiple CMV infections and allograft rejection with peri-insulitis is provided. The parallel between metabolic outcome, initiation and progression of autoreactivity to islet autoantigens and early CMV infections after transplantation, suggests that persistent CMV infections may be relevant to the pathogenesis of type 1 diabetes.

Human herpesvirus 8 (HHV-8) is causally associated with Kaposi's sarcoma (KS). KS is most frequently observed in HIV patients and in solid organ transplant recipients. The role of HHV-8 in allogeneic haematopoietic cell transplantation (HCT) remains to be determined. Here we describe a case in which KS concomitantly occurred with CMV reactivation after a non-myeloablative allogeneic HCT and presented with skin lesions, but not visceral involvement. Skin biopsy confirmed the diagnosis and ruled out graft versus host disease or disease recurrence. Molecular findings indicated viral reactivation of the recipient's primary infection. Tumour lesions completely receded when immunosuppression was tapered. Prevalence studies in donors and recipients are needed to determine the clinical impact of HHV-8 in HCT.

Autologous transplantation of bone marrow (BM) and peripheral blood progenitor cells (PBPC) is commonly used for treatment of multiple myeloma (MM). Although both stem cell sources harbor residual clonal cells, a quantitative evaluation of their level of tumor contamination (LTC) still needs to be performed through highly accurate and reproducible approaches. In this study, we used a validated real-time polymerase chain reaction (PCR) strategy to evaluate LTC of BM and PBPC samples obtained from MM patients.The patients underwent two different mobilization courses (defined as early or late course) following two cycles of cyclophosphamide 5 g/m(2). LTC was evaluated by measuring the number of clonal immunoglobulin heavy-chain rearrangements followed by normalization of samples using the GAPDH gene.Overall, 26 PBPC and 12 BM samples were analyzed. Main results are as follows. 1) PBPC harvests are less contaminated than BM samples taken immediately after each mobilization course (median difference 2.68 logs; range 1.7 to 4.6) (p0.0001). 2) LTC of PBPC harvests has only minimal variation among different leukaphereses performed during the same mobilization course (median difference 0.45 logs; range 0.22 to 1.2). 3) No difference was observed among PBPC and BM samples obtained after the late mobilization course as compared to the early mobilization course (median reduction 0.21 logs; range -0.39 to 1.3) (p = 0.84). 4) In PBPC but not in BM samples, there is a clear overestimation of the percentage of plasma cells when flow cytometric evaluation of CD38(bright) cells is compared to real-time PCR results. This suggests that in PBPC, most CD38(bright) cells do not belong to the neoplastic clone.Real-time PCR using the IgH rearrangement proved an effective tool for monitoring LTC in stem cell harvests from MM patients. The smaller LTC of PBPC harvests supports the role of PBPC as stem cell rescue for MM patients compared to BM cells.

Multiple myeloma (MM) is characterized by the expansion of tumor plasma cells in bone marrow (BM), but neoplastic cells have been consistently detected in peripheral blood (PB). Peripheral blood progenitor cell (PBPC) collections have been widely used to support high-dose therapy for MM patients. A flow cytometric technique has been used to detect plasma cells in PB and PBPC harvests. High CD38 expression identified these cells, and their nature was confirmed by the coexpression of specific antigens, such as CD138 and cytoplasmic immunoglobulins. Malignant plasma cell reinfusion could negatively affect response rate and survival, as demonstrated in other hematological malignancies. To address this issue, the relationship between the number of reinfused plasma cells, response to chemotherapy and event-free survival (EFS) have been analyzed. Sixty-four MM patients were treated with intensified chemotherapy at diagnosis. They were mobilized with cyclophosphamide and G-CSF, and then treated with melphalan 100 mg/m2 (MEL100) followed by PBPC support. A second course was given after 2 months, and a third to patients not in complete remission. There was no correlation between the number of reinfused plasma cells and response rate after this intensified chemotherapy: patients attaining complete remission received 3.6 x 106/kg CD38+ cells, while those with a partial or no response received 5.6 and 2.9 x 106/kg CD38+ cells. Similarly, there was no correlation between the number of reinfused plasma cells and EFS. Patients receiving less than 4.85 x 106/kg CD38+ cells experienced a median EFS of 34.2 months as opposed to 36.4 months for those receiving more than 4.85 x 106/kg CD38+ cells (P = 0.7). Recurrence of the disease is consistently observed in MM: our data suggest that in vivo residual tumor cells, rather than reinfused plasma cells are more likely to be responsible for relapse. Bone Marrow Transplantation (2000) 25, 25-29.

Monoclonal antibodies (MoAbs) specific for the antigens associated with each stage of an inflammatory response were assayed with tonsillar mononuclear cells (TMNG). MoAbs BMA 27 E 10 and BMA 4 D 10 were used as markers for the early stages, BMA RM 3 1 for the intermediate stage, BMA 25 F 9 for the late stage, and BMA G 16 1 for the chronic stage. TMNC were obtained from patients operated for (1) recurrent tonsillitis with hypertrophy caused by common flora (children); (2) an indication for surgery for chronic tonsillitis in adults; (3) patients who were ‘warm’ tonsillectomized for a second peri-tonsillar phlegmon. Our results are presented and discussed in the light of their possible clinical significance. Our findings indicate that clinical chronic tonsillitis in the adult really is such. In the adults studied there was a high expression of antigens which is associated with the chronic stages, while the low expression of antigens is associated with the intermediate stage and an even lower antigen expression indicates the acute stage. In children what is considered to be chronic tonsillitis may perhaps be more correctly regarded as an expression of recurrent inflammation.

The introduction of nonmyeloablative/reduced intensity conditionings has increased the eligible age for allografting up to 65–70 years. The thymic function is fundamental for the generation of T-cell diversity following allografting even though it is generally considered to decline with age. Until recently, thymic function could not be monitored as a consequence of the absence of adequate technology to differentiate true recent thymic emigrants from naive T cells. The generation of TCR diversity occurs in the thymus through the recombination of gene segments encoding the variable parts of the TCR alpha and beta chains. During this process, by-products of the rearrangements are generated in the form of signal joint T-cell receptor excision circles (sjTRECs). As sjTRECs are stable extrachromosomal DNA fragments, they are not replicated during mitosis and thus diluted with each round of cell division. They are therefore more frequent in T cells that have recently left the thymus. Thymic output was assessed in 52 patients, median age 50 (range 26–67) years, conditioned with low dose TBI (200 cGy), with/without fludarabine (90 mg/m2 total), or cyclophosphamide-thiotepa followed by G-CSF mobilised peripheral blood stem cell infusion from HLA identical siblings or volunteer donors. Diagnoses included: multiple myeloma (no=36), acute myeloid leukemia (no=2), myelodisplastic syndrome (no=4), chronic myeloid leukemia (no=1), Hodgkin disease (no=3), and chronic lymphocytic leukemia (no=6). Genomic DNA was purified from highly enriched CD3–CD4 pos and CD3–CD8 pos T cells by cell sorting (median purity: 97%) at 3, 6, 12, 18 and 24 months post-transplant. Real Time PCR analysis was performed with sjTREC specific primers: forward 5′-TGGTTTTTGTAAAGGTGCCCAC-3′ (50nM), reverse 5′-GTGCCAGCTGCAGGGTTT-3′ (50nM) and the oligo 5′(FAM) CATAGGCACCTGCACCCCGTGC(TAMBRA)p-3′ (250nM) as a detection probe. The GAPDH gene was amplified to standardize DNA content. Amplification reactions (25μl) contained 100ng of genomic DNA, TaqMan universal PCR master mix (Perkin Elmer Applied Biosystems, Foster City, CA, USA), and the appropriate primers and probes. All reactions were performed in the Model 7900 Sequence Detector using standard parameters and analysed using the GeneAmp software (Perkin Elmer Apllied Biosystems). All samples were measured in duplicate PCR reactions. Median sjTRECs values/100 ng DNA from CD3–CD4 pos T cells were as follows: 5.47; 7.09; 11.05; 15.42; 30.45 at 3, 6, 12, 18 and 24 months respectively, while sjTRECs values/100 ng DNA from CD3–CD8 pos T cells were as follows: 2.95; 2.33; 6.64; 10.49; 12.65 at 3, 6, 12, 18 and 24 months respectively. Healthy donors had significantly higher sjTRECs values at the time of donation compared to recipients. Importantly, sjTRECs were not detected in a 60-year-old leukemic patient thymectomized 10 years before allografting for a thymoma. CDR3 spectratyping analysis, evaluated on cDNA samples from the same T cell populations showed an oligoclonal pattern of the TCR repertoire during the first 6 months post-transplant that gradually expanded. The recovery of naive CD4+CD62L+CD45RA+bright T cells and of memory CD4+CD62L+CD45R0+bright T cells, evaluated by flow cytometry, was also gradual over the two-year period. A significant correlation between the levels of sjTRECs and the number of very naive CD62L + T cells was observed (p Correlation between the thymic activity and clinical variables such as graft-vs-host disease, graft-vs-tumor effects and infections are being evaluated and will be presented at the meeting. Overall, our findings provide evidence that adult thymus activity contributes to a slow T cell immune reconstitution during the first two years post-transplant. To enhance the thymus activity, future therapeutic interventions with agents such as recombinant human keratinocyte growth factor-1 or IL-7 may be investigated in clinical phase I trials.

The feasibility and efficacy of a novel immunomagnetic ex vivo negative purging method was evaluated on peripheral blood progenitor cells (PBPC) from 13 non-Hodgkin's lymphoma patients (eight follicular, FL; three mantle cell, MCL; two FL with histologic transformation). A peculiar feature of the study was the collection of PBPC after prolonged tumor debulking. Our method included a stem cell enrichment phase followed by cell incubation with anti-B cell MoAbs (anti-CD19, CD20, CD22, CD23), addition of immunobeads, and then positive cell removal by passage on a Max-Sep (Baxter Immunotherapy) cell separator. Engraftment was rapid and stable. Hematological values were assessed 1 and 2 years after the autograft. Purging efficacy was molecularly assessed in a panel of 11 patients who showed persistence of PCR-detectable lymphoma cells on PBPC harvests despite intensified chemotherapeutic debulking. PCR-negativity was obtained in vitro and persisted in vivo after autograft in three FL patients; five more FL patients, whose purged PBPC were PCR+, converted to stable (3 patients) or fluctuating (two patients) PCR negativity after autograft. MCL patients never reached PCR negativity. Thus, ex vivo purging may have a role for FL patients harvesting PCR-positive PBPC after intensified chemotherapy. In contrast, the addition of ex vivo purging seems to be of little if any benefit for MCL patients.