Search

Three-dimensional echocardiography (3DE) is currently the preferred method for monitoring left ventricular ejection fraction (LVEF) in cancer patients receiving potentially cardiotoxic anti-neoplastic therapy. In Denmark, however, the traditional standard for LVEF monitoring has been rooted in nuclear medicine departments utilizing equilibrium radionuclide angiography (ERNA). Although ERNA remains a principal modality, there is an emerging trend towards the adoption of echocardiography for this purpose. Given this context, assessing the reproducibility of 3DE among non-specialized medical personnel is crucial for its clinical adoption in such departments. To assess the feasibility of 3DE for LVEF measurements by technologists, we evaluated the repeatability and reproducibility of two moderately experienced technologists. They performed 3DE on 12 volunteers over two sessions, with a collaborative review of the results from the first session before the second session. Two-way intraclass correlation values increased from 0.03 to 0.77 across the sessions. This increase in agreement was mainly due to the recognition of false low measurements. Our findings underscore the importance of incorporating reproducibility exercises in the context of 3DE, especially when operated by technologists. Additionally, routine control of the acquisitions by physicians is deemed necessary. Ensuring these hurdles are adequately managed enables the adoption of 3DE for LVEF measurements by technologists.

Background and Purpose: Soft tissue defects after total knee arthroplasties (TKA) represent a major orthopedic challenge with amputation as a feared outcome. Microvascular free flap coverage (FFC) can increase limb salvage rates, but complications related to the procedure are yet to be explored further. We aimed to review a single-center experience with FFC for soft tissue defects related to revision total knee arthroplasty., Methods: Through a retrospective chart review from 2006 to 2021, we identified all patients who had FFC of a knee with an existing TKA. Typically, patients underwent 2-stage revision arthroplasty. To identify areas of intervention, we divided the entire regimen into 2 phases divided by the free flap surgery (pre- and post-free flap)., Results: We identified 18 patients with a median age at free flap surgery of 69 years (range 39-85), who were followed for a median of 5.1 years (range 2 months to 10.6 years). The median duration from primary TKA to their final operation was 17.5 months (range 19 days to 7 years). Patients underwent a mean of 7.6 surgical procedures on their knee with 3.6 orthopedic revisions prior to the FFC and 0.6 after. Soft tissue coverage was achieved in all patients and no patients underwent amputation. One-third of patients experienced early complications at recipient site after free flap surgery. There were no donor site complications., Conclusion: Microvascular FFC of complex soft tissue defects after revision total knee arthroplasty proved achievable in all patients with successful limb salvage in all patients.

Multiple sclerosis (MS) is a neuro-inflammatory and neurodegenerative disease that is most prevalent in Northern Europe. Although it is known that inherited risk for MS is located within or in close proximity to immune-related genes, it is unknown when, where and how this genetic risk originated 1 . Here, by using a large ancient genome dataset from the Mesolithic period to the Bronze Age 2 , along with new Medieval and post-Medieval genomes, we show that the genetic risk for MS rose among pastoralists from the Pontic steppe and was brought into Europe by the Yamnaya-related migration approximately 5,000 years ago. We further show that these MS-associated immunogenetic variants underwent positive selection both within the steppe population and later in Europe, probably driven by pathogenic challenges coinciding with changes in diet, lifestyle and population density. This study highlights the critical importance of the Neolithic period and Bronze Age as determinants of modern immune responses and their subsequent effect on the risk of developing MS in a changing environment., (© 2024. The Author(s).)

JAK inhibitors impact multiple cytokine pathways simultaneously, enabling high efficacy in treating complex diseases such as cancers and immune-mediated disorders. However, their broad reach also poses safety concerns, which have fuelled a demand for increasingly selective JAK inhibitors. Deucravacitinib, a first-in-class allosteric TYK2 inhibitor, represents a remarkable advancement in the field. Rather than competing at kinase domain catalytic sites as classical JAK1-3 inhibitors, deucravacitinib targets the regulatory pseudokinase domain of TYK2. It strikingly mirrors the functional effect of an evolutionary conserved naturally occurring TYK2 variant, P1104A, known to protect against multiple autoimmune diseases yet provide sufficient TYK2-mediated cytokine signalling required to prevent immune deficiency. The unprecedentedly high functional selectivity and efficacy-safety profile of deucravacitinib, initially demonstrated in psoriasis, combined with genetic support, and promising outcomes in early SLE clinical trials make this inhibitor ripe for exploration in other autoimmune diseases for which better, safe, and efficacious treatments are urgently needed., Competing Interests: Declaration of interests L.F. and K.E.A. have an unrestricted grant from Bristol Myers Squibb. L.T.J. and M.F. declare no competing interests., (Copyright © 2023 The Author(s). Published by Elsevier B.V. All rights reserved.)

Toxicity resulting from off-target effects, beyond acetylcholine esterase inhibition, for the commonly used organophosphate (OP) insecticides chlorpyrifos (CPS) and malathion (MA) was investigated using Saccharomyces cerevisiae and Caenorhabditis elegans model systems. Mitochondrial damage and dysfunction were observed in yeast following exposure to CPS and MA, suggesting this organelle is a major target. In the C. elegans model, the mitochondrial unfolded protein response pathway showed the most robust induction from CPS and MA treatment among stress responses examined. GABAergic neurodegeneration was observed with CPS and MA exposure. Impaired movement observed in C. elegans exposed to CPS and MA may be the result of motor neuron damage. Our analysis suggests that stress from CPS and MA results in mitochondrial dysfunction, with GABAergic neurons sensitized to these effects. These findings may aid in the understanding of toxicity from CPS and MA from high concentration exposure leading to insecticide poisoning., Competing Interests: Declaration of Competing Interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Laran T. Jensen reports financial support was provided by Thailand Science Research and Innovation. Amornrat Naranuntarat Jensen reports financial support was provided by Thailand Science Research and Innovation. Conflicts of interest The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Introduction: Periprosthetic infection is one of the most severe complications following implant-based breast reconstruction affecting 5%-10% of the women. Currently, many surgeons apply antibiotics locally on the breast implant to reduce the risk of postoperative infection, but no randomised, placebo-controlled trials have tested the treatment's efficacy., Methods and Analysis: The BREAST-AB trial (BREAST-AntiBiotics) is an investigator-initiated, multicentre, randomised, placebo-controlled, double-blind trial of local treatment with gentamicin, vancomycin and cefazolin on breast implants in women undergoing implant-based breast reconstruction. The trial drug consists of 80 mg gentamicin, 1 g vancomycin and 1 g cefazolin dissolved in 500 mL of isotonic saline. The placebo solution consists of 500 mL isotonic saline. The trial drug is used to wash the dissected tissue pocket and the breast implant prior to insertion. The primary outcome is all-cause explantation of the breast implant within 180 days after the breast reconstruction surgery. This excludes cases where the implant is replaced with a new permanent implant, for example, for cosmetic reasons. Key long-term outcomes include capsular contracture and quality of life. The trial started on 26 January 2021 and is currently recruiting., Ethics and Dissemination: The trial was approved by the Regional Ethics Committee of the Capital Region (H-20056592) on 1 January 2021 and the Danish Medicines Agency (2020070016) on 2 August 2020. The main paper will include the primary and secondary outcomes and will be submitted to an international peer-reviewed journal., Trial Registration Number: NCT04731025., Competing Interests: Competing interests: None declared., (© Author(s) (or their employer(s)) 2022. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

Objectives: Patients undergoing microvascular reconstruction after head and neck cancer typically have several comorbidities, and the procedures are often followed by complications and prolonged hospitalization. Consequently, the application of enhanced recovery after surgery (ERAS) for these patients undergoing microvascular reconstruction has gained attention in recent years. ERAS is a peri- and postoperative care concept that has repeatedly shown beneficial results for a wide variety of surgical procedures, including microvascular reconstruction. This study presents the results after the introduction of our ERAS protocol for head and neck cancer reconstruction., Methods: We prospectively treated 30 consecutive patients according to our ERAS protocol from June 2019 to December 2020 and compared the results of the treated patients with those of patients treated with our traditional recovery after surgery (TRAS) protocol. We are based on our ERAS protocol on the following core elements of recovery: improved patient information, goal-directed fluid therapy, minimally invasive surgery, opioid-sparing multimodal analgesia, early ambulation, and pre-defined functional discharge criteria., Results: The baseline characteristics of the groups were comparable. The ERAS group had a significantly shorter length of stay (13.1 vs. 20.3 days, p < 0.001), significantly shorter time to ambulation (3.0 days vs. 6.4 days, p < 0.001), shorter time to removal of nasogastric tube (13.3 days vs. 22.7 days, p = 0.05), and fewer tracheostomies performed (10% vs. 90%, p < 0.001). There were no differences in complications, flap survival, or 30-day re-admissions between the two groups., Conclusion: The introduction of ERAS in patients with head and neck cancer undergoing microvascular reconstruction seems safe and results in improved recovery., Level of Evidence: 3., Competing Interests: Nothing to disclose, (© 2022 The Author(s).)

Fetal growth restriction (FGR) affects 5-10% of pregnancies, and can have serious consequences for both mother and child. Prevention and treatment are limited because FGR pathogenesis is poorly understood. Genetic studies implicate KIR and HLA genes in FGR, however, linkage disequilibrium, genetic influence from both parents, and challenges with investigating human pregnancies make the risk alleles and their functional effects difficult to map. Here, we demonstrate that the interaction between the maternal KIR2DL1, expressed on uterine natural killer (NK) cells, and the paternally inherited HLA-C*0501, expressed on fetal trophoblast cells, leads to FGR in a humanized mouse model. We show that the KIR2DL1 and C*0501 interaction leads to pathogenic uterine arterial remodeling and modulation of uterine NK cell function. This initial effect cascades to altered transcriptional expression and intercellular communication at the maternal-fetal interface. These findings provide mechanistic insight into specific FGR risk alleles, and provide avenues of prevention and treatment., (© 2022. The Author(s).)

Background: Disturbances in presynaptic dopamine activity and levels of GABA (gamma-aminobutyric acid) and glutamate plus glutamine collectively may have a role in the pathophysiology of psychosis, although separately they are poor diagnostic markers. We tested whether these neurotransmitters in combination improve the distinction of antipsychotic-naïve patients with first-episode psychosis from healthy control subjects., Methods: We included 23 patients (mean age 22.3 years, 9 male) and 20 control subjects (mean age 22.4 years, 8 male). We determined dopamine metabolism in the nucleus accumbens and striatum from 18 F-fluorodopa ( 18 F-FDOPA) positron emission tomography. We measured GABA levels in the anterior cingulate cortex (ACC) and glutamate plus glutamine levels in the ACC and left thalamus with 3T proton magnetic resonance spectroscopy. We used binominal logistic regression for unimodal prediction when we modeled neurotransmitters individually and for multimodal prediction when we combined the 3 neurotransmitters. We selected the best combination based on Akaike information criterion., Results: Individual neurotransmitters failed to predict group. Three triple neurotransmitter combinations significantly predicted group after Benjamini-Hochberg correction. The best model (Akaike information criterion 48.5) carried 93.5% of the cumulative model weight. It reached a classification accuracy of 83.7% ( p  = .003) and included dopamine synthesis capacity (K i 4p ) in the nucleus accumbens ( p  = .664), GABA levels in the ACC ( p  = .019), glutamate plus glutamine levels in the thalamus ( p  = .678), and the interaction term K i 4p  × GABA ( p  = .016)., Conclusions: Our multimodal approach proved superior classification accuracy, implying that the pathophysiology of patients represents a combination of neurotransmitter disturbances rather than aberrations in a single neurotransmitter. Particularly aberrant interrelations between K i 4p in the nucleus accumbens and GABA values in the ACC appeared to contribute diagnostic information., (© 2022 The Authors.)

Ingested nutrients are proposed to control mammalian behavior by modulating the activity of hypothalamic orexin/hypocretin neurons (HONs). Previous in vitro studies showed that nutrients ubiquitous in mammalian diets, such as non-essential amino acids (AAs) and glucose, modulate HONs in distinct ways. Glucose inhibits HONs, whereas non-essential (but not essential) AAs activate HONs. The latter effect is of particular interest because its purpose is unknown. Here, we show that ingestion of a dietary-relevant mix of non-essential AAs activates HONs and shifts behavior from eating to exploration. These effects persisted despite ablation of a key neural gut → brain communication pathway, the cholecystokinin-sensitive vagal afferents. The behavioral shift induced by the ingested non-essential AAs was recapitulated by targeted HON optostimulation and abolished in mice lacking HONs. Furthermore, lick microstructure analysis indicated that intragastric non-essential AAs and HON optostimulation each reduce the size, but not the frequency, of consumption bouts, thus implicating food palatability modulation as a mechanism for the eating suppression. Collectively, these results suggest that a key purpose of HON activation by ingested, non-essential AAs is to suppress eating and re-initiate food seeking. We propose and discuss possible evolutionary advantages of this, such as optimizing the limited stomach capacity for ingestion of essential nutrients., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2022 Elsevier Inc. All rights reserved.)

Objective: The extent of symptoms due to primary hyperparathyroidism (PHPT) depends on the population being studied. PHPT is mainly discovered incidentally through routine laboratory findings. Less is known about patient-experienced improvement following successful parathyroidectomy. The aim of our study was to assess the changes in the quality of life (QoL) after successful surgery using an SF-36 questionnaire., Design: This is a prospective cohort study based on questionnaires., Methods: Forty consecutive patients diagnosed with PHPT were prospectively administered an SF-36 questionnaire before and 6 months after successful parathyroidectomy. A subgroup of 18 patients answered the questionnaire at 1 and 3 months after surgery. Successful surgery was based on biochemistry and pathology reports as confirmed by an endocrinologist. Results of each SF-36 subcategory were compared to the results at baseline in order to detect changes in patient-reported QoL after successful surgery., Results: There were significant improvements in six of eight SF-36 subcategories: vitality (P = 0.0001), physical functioning (P = 0.04), general health perception (P = 0.004), physical role functioning (P = 0.04), social role functioning (P = 0.004), and mental health perception (P = 0.0001). Changes appeared within a month after surgery with no further significant changes at later time points., Conclusions: Parathyroidectomy significantly improves QoL as measured by a decrease in SF-36 scores as early as 1 month after successful parathyroidectomy. The SF-36 QoL questionnaire is suitable for monitoring changes in patient well-being after successful parathyroidectomy.

Background: Use of 11 C-Choline PET/CT is gaining ground in detecting hyperfunctioning parathyroid glands in primary hyperparathyroidism. The purpose of this study was to evaluate the robustness of 11 C-Choline PET/CT by assessing intra- and inter-observer agreement to determine whether the method was reader sensitive and therefore should only be performed at highly specialised sites with a high number of cases. PET/CT images of 40 patients diagnosed with primary hyperparathyroidism were anonymised and evaluated three times by three readers: an expert reader and two non-experts (non-experts were experienced in PET/CT imaging, but not in 11 C-Choline PET/CT in the setting of primary hyperparathyroidism). Number of hyperfunctioning parathyroid glands, location relative to the thyroid gland and confidence of each assessment (low, moderate or high) were noted, and intra- and inter-observer agreement calculated using Fleiss' kappa method. Sensitivities and specificities of the non-experts were calculated using the expert reader as gold standard., Results: Intra-observer agreement was 'good' to 'near perfect' for all readers. Inter-observer agreement was good between non-experts and the expert, with kappa values ≥ 0.74. Sensitivities between non-experts and the expert were high, > 81%, when assessing which side and 75% when assessing thyroid quadrant. All specificities were > 94%. Reader certainties were 'high' in > 80% of cases for the expert and > 70% and > 65%, respectively for the two non-experts., Conclusion: 11 C-Choline PET/CT is not reader sensitive for the localisation of hyperfunctioning parathyroid glands and may therefore be safely implemented at sites that have a moderate number of cases. Access to a cyclotron laboratory is, however, a necessity for the production of 11 C-Choline. The study was conducted in accordance with the Helsinki 2 declaration and The International Council for Harmonisation Guideline for Good Clinical Practice (ICH&#95;GCP) clinical trial, approved by the Research Ethics Committee of the Capital Region of Denmark (Journal-nr.:H-18012490, date of approval: 18 June 2018) and the Danish Medicines Agency (EudraCT no. 2018-000726-63, date of approval: 6 June 2018). The GCP unit in Eastern Denmark has carried out regular monitoring of the trial according to GCP (ID: 2018-1050).

Raynaud's phenomenon (RP) is characterized by the episodic whitening of the fingers upon exposure to cold. A recently described thermographic algorithm was proposed as a diagnostic replacement of the currently applied finger systolic pressure (FSP) test. The aim of the study was to evaluate the performance of the thermographic algorithm when applied in patients suspected of having RP. Forty-three patients were examined using thermographic imaging after local cooling of the hands in water of 10 °C for 1 min. The thermographic algorithm was applied to predict the probability of RP. The performance of the algorithm was evaluated with different cut-off levels. A new algorithm was proposed based on patients from the target population. The performance of the tested algorithm was noninferior to the FSP test, when a cut-off level of 0.05 was applied, yielding a sensitivity and specificity of 69% and 58%, respectively. The accuracy was 66%. The FSP test had a sensitivity and specificity of 77% and 37%, respectively, and the accuracy was 59%. The thermographic method proved useful for detecting RP and was able to replace the FSP test as a diagnostic test. The alternative algorithm revealed that other thermographic variables were more predictive of the target population, but this should be verified in future patients.

Purpose: To investigate whether patients with normal tension glaucoma (NTG) show an enhanced stress response to reduced oxygen supply compared to age-matched healthy controls, measured by serum adrenaline and endothelin-1 (ET-1) levels and changes in distal finger temperature., Methods: A thorough clinical characterization of patients with NTG and age-matched controls was performed prior to inclusion in the study. Twelve patients with NTG and eleven healthy controls met the inclusion criteria and were enrolled in the study. All subjects underwent a two-day investigation. Participants were randomly exposed to either hypoxia or normoxia during the first visit. Hypoxia or normoxia was induced for two hours through a tightly fitting face mask. In addition, the peripheral circulation was assessed with a thermographic camera. Blood samples were obtained before, during, and after hypoxia or normoxia to evaluate systemic stress molecules such as catecholamines and ET-1 levels., Results: In patients with NTG, reduced oxygen supply induced an increase in peripheral blood adrenaline ( p  < 0.05) and a decrease during recovery ( p  < 0.01). A difference in distal finger temperature was shown in patients with NTG under hypoxia compared to normoxia (exposure: p  < 0.05; recovery: p  < 0.05). Hypoxia induced an increase in peripheral blood ET-1 levels in both groups (NTG: p  < 0.01; controls: p  < 0.05)., Conclusion: Patients with NTG had an enhanced physiological stress response as a consequence of hypoxia compared with age-matched controls. Although more studies are needed, the present study supports the involvement of vascular risk factors in the pathophysiology of NTG., Competing Interests: The authors declare that they have no conflicts of interest., (Copyright © 2021 Line Marie Dalgaard et al.)

Raynaud's phenomenon (RP) is characterized by the episodic whitening of the fingers upon exposure to cold. Verification of the condition is crucial in vibration-exposed patients. The current verification method is outdated, but thermographic imaging seems promising as a diagnostic replacement. By investigating patients diagnosed with RP, the study aimed at developing a simple thermographic procedure that could be applied to future patients where verification of the diagnosis is needed. Twenty-two patients with primary RP and 58 healthy controls were examined using thermographic imaging after local cooling of the hands for 1 min in water of 10°C. A logistic regression model was fitted with the temperature curve characteristics to convey a predicted probability of having RP. The characteristics time to end temperature and baseline temperature were the most appropriate predictors of RP among those examined ( p = 0.004 and p = 0.04, respectively). The area under the curve was 0.91. The cut-off level 0.46 yielded a sensitivity and specificity of 82% and 86%, respectively. The positive and negative predictive values were 69% and 93%, respectively. This newly developed thermographic method was able to distinguish between patients with RP and healthy controls and was easy to operate. Thus, the method showed great promise as a method for verification of RP in future patients. Trial registration: ClinicalTrials.gov NCT03094910.

Colorectal cancer is a common cancer worldwide and reduced expression of the DNA repair endonuclease XPF (xeroderma pigmentosum complementation group F) is associated with colorectal cancer. Bacopa monnieri extracts were previously found to exhibit chemical-genetic synthetic lethal effects in a Saccharomyces cerevisiae model of colorectal cancer lacking Rad1p, a structural and functional homologue of human XPF. However, the mechanisms for B. monnieri extracts to limit proliferation and promote an apoptosis-like event in RAD1 deleted yeast was not elucidated. Our current analysis has revealed that B. monnieri extracts have the capacity to promote mutations in rad1 ∆ cells. In addition, the effects of B. monnieri extracts on rad1 ∆ yeast is linked to disruption of the vacuole, similar to the mammalian lysosome. The absence of RAD1 in yeast sensitizes cells to the effects of vacuole disruption and the release of proteases. The combined effect of increased DNA mutations and release of vacuolar contents appears to induce an apoptosis-like event that is dependent on the meta-caspase Yca1p. The toxicity of B. monnieri extracts is linked to sterol content, suggesting saponins may be involved in limiting the proliferation of yeast cells. Analysis of major constituents from B. monnieri identified a chemical-genetic interaction between bacopasaponin C and rad1 ∆ yeast. Bacopasaponin C may have potential as a drug candidate or serve as a model for the development of analogs for the treatment of colorectal cancer.

Purpose: Chemotherapy-induced peripheral neuropathy (CIPN) is a recognized adverse effect of standard (neo)adjuvant chemotherapy in breast cancer (BC) treatment. However, there is no consensus on a validated method for assessing CIPN. Heart rate variability (HRV) and vibration perception threshold (VPT) could be used as objective measures to describe CIPN. The aim of this pilot study was to investigate whether subjectively reported CIPN was associated with altered HRV and VPT in BC patients., Methods: We performed a cross-sectional pilot study evaluating 30 BCE patients previously treated with chemotherapy, 26 BCE patients who did not receive chemotherapy, and 22 controls without breast cancer. Self-reported CIPN was registered for the BC patients. All participants were subjected to multi-frequency vibration analyses to determine VPT along with short ECG measurements to determine HRV measures., Results: Self-reported CIPN was registered in 14 (46.6%) BC patients treated with chemotherapy. The VPT at 64 Hz (P = 0.022) and mean HR (P = 0.022) were significantly higher and the HRV measures SDNN (P = 0.023), RMSSD (P = 0.007), LF (P = 0.050) and HF (P = 0.045) were significantly lower in BC patients reporting CIPN compared to controls when adjusted for age. VPT at 64 Hz and 125 Hz were significantly higher in BC patients not reporting CIPN compared to controls when adjusted for age., Conclusion: We found elevated VPT and mean HR along with decreased HRV parameters in 14 BCE patients reporting CIPN. These findings support the need for further investigation into whether HRV and vibration analysis could contribute to an objective assessment of CIPN., (Copyright © 2021 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Background: It is well known that breast cancer (BC) patients often suffer from chemotherapy-induced peripheral neuropathy (CIPN). However, it is not always recognized that they have higher risk of falling, dizziness and other signs of dysfunctional autonomous nervous system. We performed a systematic review of the literature on vibration perception threshold (VPT) and heart rate variability (HRV) as methods to objectively assess (CIPN) in BC-patients. Could VPT and HRV describe coexisting sensory and autonomic nerve damage?, Materials and Methods: PubMed was searched in September 2019. The included studies had to address HRV and/or VPT in BC-patients who received chemotherapy., Results: Seven studies assessed VPT and six studies assessed HRV in BC-patients. Studies showed lowered perception of vibrations after chemotherapy reflected in higher VPT and no changes in HRV after taxane-based chemotherapy. No studies evaluated VPT and HRV at the same time., Conclusion: The results were limited by short follow-up, small sample sizes, and different chemotherapy regimens which makes generalizability problematic. A standard assessment method of CIPN is still missing and further research is needed to evaluate if VPT and HRV could contribute to an objective assessment of CIPN. With higher survival rates for BC-patients autonomous and sensory nerve damage will be an increasing task. However, our literature review showed that no one have focused on the combination of autonomous and sensory affection measured by the simple methods VPT and HRV. Therefore, we encourage the development of international guidelines for the objective measure of nerve damage in BC-patients., (Copyright © 2020 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30 ∗ ), c.207&#95;8 delCG (p.Cys71Hisfs ∗ 62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs ∗ 42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155&#95;1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs ∗ 117). All pathogenic variants were de novo . The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10 -related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2020 Thongpradit, Jinawath, Javed, Jensen, Chunsuwan, Rojnueangnit, Tim-Aroon, Lertsukprasert, Shiao, Sirachainan and Wattanasirichaigoon.)

Background: In patients with primary hyperparathyroidism (PHPT) locating hyperfunctioning glands (HPGs) is crucial when planning minimally invasive surgery. Dual-isotope subtraction scintigraphy with 99m Tc-MIBI/ 123 Iodide using SPECT/CT and planar pinhole imaging (Method A) has previously shown a sensitivity >93%. However, the method is costly and time consuming and entails a high radiation dose. 11 C-Choline PET/CT (Method B) is an appealing candidate method unencumbered by these disadvantages., Methods: Sixty patients with newly diagnosed PHPT participated and were scanned using both methods prior to parathyroidectomy. We investigated whether sensitivities of Method A and Method B are similar in a method-to-method comparison when using surgical findings as the true location., Results: At the patient level, sensitivities were (A) 0.98 (95% CI: 0.90-1.00) and (B) 1.00 (95% CI: 0.93-1.00). At the gland level, sensitivities were (A) 0.88 (95% CI: 0.78-0.94) and (B) 0.87 (95% CI: 0.76-0.92). With a non-inferiority margin of ∆ = -0.1, we found a 1-sided p -value < 0.001., Conclusion: Our methods comparison study found that sensitivity of Method B was not inferior to Method A. We suggest that 11 C-Choline PET/CT is a clinically relevant first-choice candidate for preoperative imaging of PHPT and that Method B can likely replace Method A in the near future.

CNS autoantigens conjugated to oxidized mannan (OM) induce antigen-specific T cell tolerance and protect mice against autoimmune encephalomyelitis (EAE). To investigate whether OM-peptides treat EAE initiated by human MHC class II molecules, we administered OM-conjugated murine myelin oligodendrocyte glycoprotein peptide 35-55 (OM-MOG) to humanized HLA-DR2b transgenic mice (DR2b.Ab°), which are susceptible to MOG-EAE. OM-MOG protected DR2b.Ab° mice against MOG-EAE by both prophylactic and therapeutic applications. OM-MOG reversed clinical symptoms, reduced spinal cord inflammation, demyelination, and neuronal damage in DR2b.Ab° mice, while preserving axons within lesions and inducing the expression of genes associated with myelin ( Mbp ) and neuron ( Snap25 ) recovery in B6 mice. OM-MOG-induced tolerance was peptide-specific, not affecting PLP178-191-induced EAE or polyclonal T cell proliferation responses. OM-MOG-induced immune tolerance involved rapid induction of PD-L1- and IL-10-producing myeloid cells, increased expression of Chi3l3 (Ym1) in secondary lymphoid organs and characteristics of anergy in MOG-specific CD4 + T cells. The results show that OM-MOG treats MOG-EAE in a peptide-specific manner, across mouse/human MHC class II barriers, through induction of a peripheral type 2 myeloid cell response and T cell anergy, and suggest that OM-peptides might be useful for suppressing antigen-specific CD4 + T cell responses in the context of human autoimmune CNS demyelination., (Copyright © 2020 Dagkonaki, Avloniti, Evangelidou, Papazian, Kanistras, Tseveleki, Lampros, Tselios, Jensen, Möbius, Ruhwedel, Androutsou, Matsoukas, Anagnostouli, Lassmann and Probert.)

Introduction: Microvascular reconstructions after head and neck cancer are among the most complicated procedures in plastic surgery. Postoperative complications are common, which often leads to prolonged hospital stay. Enhanced recovery after surgery (ERAS) is a peri- and postoperative care concept with the aim of achieving pain- and risk-free surgery. It has been previously established as superior to conventional care for a wide variety of procedures, including microsurgical procedures such as reconstructions of the breast. Several ERAS protocols for microvascular head and neck cancer reconstructions have been proposed, although most of these are based on extrapolated evidence from different surgical specialties. Results from the implementation of ERAS for these procedures are inconsistent., Methods: The current study investigates our clinical experience of head and neck cancer reconstruction for the period of 2014-2016 with the aim of establishing a list of functional discharge criteria. By combining these with the current published knowledge on the subject, we developed an ERAS protocol., Results: We performed 89 microvascular procedures in the study period, of which 58 were in the oral cavity/sinuses and 31 were laryngopharyngeal. Most cases were squamous cell carcinoma (89%). The average LOS was 20.3 days in both groups. Postoperative complications included infection (37%), 30-days re-operations (19%), and re-admissions (17%). Furthermore, we identified the following discharge criteria: adequate pain relief, ambulation, sufficient nutritional intake, normal infection-related blood parameter results and absence of fever, bowel function, and closure of tracheostomy., Conclusion: Based on our retrospective analysis and identified discharge criteria, we present an approach to develop an ERAS protocol for microvascular reconstruction after head and neck cancer., Competing Interests: None, (© 2020 The Authors.)

Background: Shwachman-Diamond syndrome (SDS) is a congenital disease that affects the bone marrow, skeletal system, and pancreas. The majority of patients with SDS have mutations in the SBDS gene, involved in ribosome biogenesis as well as other processes. A Saccharomyces cerevisiae model of SDS, lacking Sdo1p the yeast orthologue of SBDS, was utilized to better understand the molecular pathogenesis in the development of this disease., Results: Deletion of SDO1 resulted in a three-fold over-accumulation of intracellular iron. Phenotypes associated with impaired iron-sulfur (ISC) assembly, up-regulation of the high affinity iron uptake pathway, and reduced activities of ISC containing enzymes aconitase and succinate dehydrogenase, were observed in sdo1 ∆ yeast. In cells lacking Sdo1p, elevated levels of reactive oxygen species (ROS) and protein oxidation were reduced with iron chelation, using a cell impermeable iron chelator. In addition, the low activity of manganese superoxide dismutase (Sod2p) seen in sdo1 ∆ cells was improved with iron chelation, consistent with the presence of reactive iron from the ISC assembly pathway. In yeast lacking Sdo1p, the mitochondrial voltage-dependent anion channel (VDAC) Por1p is over-expressed and its deletion limits iron accumulation and increases activity of aconitase and succinate dehydrogenase., Conclusions: We propose that oxidative stress from POR1 over-expression, resulting in impaired activity of ISC containing proteins and disruptions in iron homeostasis, may play a role in disease pathogenesis in SDS patients., Competing Interests: Competing interestsThe authors declare no conflict of interest., (© The Author(s) 2020.)

Osteomalacia is a bone-demineralizing disease of adulthood, often caused by hypovitaminosis D. Current animal models of the disease mimic osteomalacia as a consequence of gastric bypass or toxic exposure to metals, but a relevant model of diet-induced osteomalacia is lacking. For that purpose, 7-month-old female Sprague Dawley rats were randomly assigned into 2 weight-stratified groups and maintained for 4 months on synthetic diets containing negligible or normal levels of vitamin D. The dietary regimen resulted in vitamin D deficiency as measured by 25-hydroxyvitamin D serum levels; however, hypovitaminosis D per se did not affect biomarkers of calcium metabolism and bone turnover, nor did it result in increased osteoid. Thus, vitamin D depletion through the diet was found to be insufficient to induce an osteomalacia-like phenotype in the adult rat. After 4 months, the phosphate content of the vitamin D-depleted diet had decreased to 0.16% (calcium:phosphorus ratio of 5.85), resulting in an osteomalacic-like condition (trabecular osteoid surface/bone surface constituted 33%; CI, 26-40). The diet change also affected both metabolic and bone turnover biomarkers, including significantly suppressing serum fibroblast growth factor 23. Furthermore, decreased dietary phosphate in a vitamin D-depleted diet led to microarchitectural changes of trabecular and cortical bone, lower bone mass density, lower bone mass content and decreased bone strength, all indicating reduced bone quality. Taken together, our results show that osteomalacia can be induced in the adult female rat by depleting vitamin D and lowering phosphate content in the diet., (© Endocrine Society 2020. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

MITF is a known gene underlying autosomal dominant hearing loss, Waardenburg syndrome (WS). Biallelic MITF mutations have been found associated with a rare hearing loss syndrome consisting eye abnormalities and albinism; and a more severe type of WS whose heterozygous parents were affected with classic WS in both cases. The aims of this study were to identify a new candidate gene causing autosomal recessive nonsyndromic hearing loss (ARNSHL) and confirm its causation by finding additional families affected with the candidate gene and supporting evidences from functional analyses. By using whole exome sequencing, we identified a homozygous c.1022G>A: p.Arg341His variant of MITF, which co-segregated with the hearing loss in five affected children of a consanguineous hearing couple. Targeted exome sequencing in a cohort of 130 NSHL individuals, using our in-house gene panel revealed a second family with c.1021C>T: p.Arg341Cys MITF variant. Functional studies confirmed that the Arg341His and Arg341Cys alleles yielded a normal sized MITF protein, with aberrant cytosolic localization as supported by the molecular model and the reporter assay. In conclusion, we demonstrate MITF as a new cause of ARNSHL, with heterozygous individuals free of symptoms. MITF should be included in clinical testing for NSHL, though it is rare.

Patients with chronic schizophrenia often display enlarged striatal volumes, and antipsychotic drugs may contribute via the dopamine D 2/3 receptor (D 2/3 R) blockade. Separating the effects of disease from medication is challenging due to the lack of a proper placebo-group. To address this, we conducted a longitudinal study of antipsychotic-naïve, first-episode schizophrenia patients to test the hypothesis that selective blockade of D 2/3 R would induce a dose-dependent striatal volume increase. Twenty-one patients underwent structural magnetic resonance imaging (sMRI), single-photon emission computed tomography (SPECT), and symptom severity ratings before and after six weeks of amisulpride treatment. Twenty-three matched healthy controls underwent sMRI and baseline SPECT. Data were analyzed using repeated measures and multiple regression analyses. Correlations between symptom severity decrease, volume changes, dose and receptor occupancy were explored. Striatal volumes did not differ between patients and controls at baseline or follow-up, but a significant group-by-time interaction was found ( p = 0.01). This interaction was explained by a significant striatal volume increase of 2.1% in patients (Cohens d = 0.45). Striatal increase was predicted by amisulpride dose, but not by either D 2/3 R occupancy or baseline symptom severity. A significant reduction in symptom severity was observed at a mean dose of 233.3 (SD = 109.9) mg, corresponding to D 2/3 R occupancy of 44.65%. Reduction in positive symptoms correlated significantly with striatal volume increase, driven by reductions in hallucinations. Our data demonstrate a clear link between antipsychotic treatment and striatal volume increase in antipsychotic-naïve schizophrenia patients. Moreover, the treatment-induced striatal volume increase appears clinically relevant by correlating to reductions in core symptoms of schizophrenia., (Copyright © 2020 Andersen, Raghava, Svarer, Wulff, Johansen, Antonsen, Nielsen, Rostrup, Vernon, Jensen, Pinborg, Glenthøj and Ebdrup.)

Mixed lineage kinase domain-like (MLKL) is the main executor of necroptosis, an inflammatory form of programmed cell death. Necroptosis is implicated in combating infections, but also in contributing to numerous other clinical conditions, including cardiovascular diseases and neurodegenerative disorders. Inhibition of necroptosis is therefore of therapeutic interest. Here we report two siblings both of whom over the course of 35 years developed a similar progressive, neurodegenerative spectrum disorder characterized by paresis, ataxia and dysarthria. Magnetic resonance imaging of their central nervous system (CNS) revealed severe global cerebral volume loss and atrophy of the cerebellum and brainstem. These brothers are homozygous for a rare haplotype identified by whole genome sequencing carrying a frameshift variant in MLKL, as well as an in-frame deletion of one amino acid in the adjacent fatty acid 2-hydroxylase (FA2H) gene. Functional studies of patient-derived primary cells demonstrated that the variant in MLKL leads to a deficiency of MLKL protein resulting in impairment of necroptosis. Conversely, shotgun lipidomic analysis of the variant in FA2H shows no impact on either the abundance or the enzymatic activity of the encoded hydroxylase. To our knowledge, this is the first report of complete necroptosis deficiency in humans. The findings may suggest that impaired necroptosis is a novel mechanism of neurodegeneration, promoting a disorder that shares some clinical features with primary progressive multiple sclerosis (PPMS) and other neurodegenerative diseases. Importantly, the necroptotic deficiency does not cause symptoms outside the nervous system, nor does it confer susceptibility to infections. Given the current interest in pharmacological inhibition of necroptosis by targeting MLKL and its associated pathways, this strategy should be developed with caution, with careful consideration of the possible development of adverse neurological effects.

Autoimmune diseases are a result of the immune system being misdirected toward its host and have major and increasing unmet clinical needs. In general, present therapies are broadly acting and non-disease specific; consequently, they are associated with numerous side effects. Precise and early intervention strategies are urgently needed. We highlight the challenges, progress, and prospects in achieving these goals., Competing Interests: Declaration of Interests J.R. has received funds to work on autoimmune diseases from Janssen Research & Development, LLC., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Citrin is a liver-specific mitochondrial aspartate-glutamate carrier encoded by SLC25A13 . Citrin deficiency caused by SLC25A13 mutation results in carbohydrate toxicity, citrullinemia type II, and fatty liver diseases, the mechanisms of some of which remain unknown. Citrin shows a functional homolog in yeast aspartate-glutamate carrier (Agc1p) and agc1 Δ yeasts are used as a model organism of citrin deficiency. Here, we found that agc1 Δ yeasts decreased fat utilization, impaired NADH balance in peroxisomes, and decreased chronological lifespan. The activation of GPD1 -mediated NAD + regeneration in peroxisomes by GPD1 over-expression or activation of the malate-oxaloacetate NADH peroxisomal shuttle, by increasing flux in this NADH shuttle and over-expression of MDH3 , resulted in lifespan extension of agc1 Δ yeasts. In addition, over-expression of PEX34 restored longevity of agc1 Δ yeasts as well as wild-type cells. The effect of PEX34 -mediated longevity required the presence of the GPD1 -mediated NADH peroxisomal shuttle, which was independent of the presence of the peroxisomal malate-oxaloacetate NADH shuttle and PEX34 -induced peroxisome proliferation. These data confirm that impaired NAD + regeneration in peroxisomes is a key defect in the yeast model of citrin deficiency, and enhancing peroxisome function or inducing NAD + regeneration in peroxisomes is suggested for further study in patients' hepatocytes.

PEX34, encoding a peroxisomal protein implicated in regulating peroxisome numbers, was identified as a high copy suppressor, capable of bypassing impaired acetate utilization of agc1∆ yeast. However, improved growth of agc1∆ yeast on acetate is not mediated through peroxisome proliferation. Instead, stress to the endoplasmic reticulum and mitochondria from PEX34 overexpression appears to contribute to enhanced acetate utilization of agc1∆ yeast. The citrate/2-oxoglutarate carrier Yhm2p is required for PEX34 stimulated growth of agc1∆ yeast on acetate medium, suggesting that the suppressor effect is mediated through increased activity of a redox shuttle involving mitochondrial citrate export. Metabolomic analysis also revealed redirection of acetyl-coenzyme A (CoA) from synthetic reactions for amino acids in PEX34 overexpressing yeast. We propose a model in which increased formation of products from the glyoxylate shunt, together with enhanced utilization of acetyl-CoA, promotes the activity of an alternative mitochondrial redox shuttle, partially substituting for loss of yeast AGC1., (© FEMS 2019.)

Artemisinins are widely used to treat Plasmodium infections due to their high clinical efficacy; however, the antimalarial mechanism of artemisinin remains unresolved. Mutations in P. falciparum ATPase6 (PfATP6), a sarcoplasmic endoplasmic reticulum Ca 2+ -transporting ATPase, are associated with increased tolerance to artemisinin. We utilized Saccharomyces cerevisiae as a model to examine the involvement of Pmr1p, a functional homolog of PfATP6, on the toxicity of artemisinin. Our analysis demonstrated that cells lacking Pmr1p are less susceptible to growth inhibition from artemisinin and its derivatives. No association between sensitivity to artemisinin and altered trafficking of the drug efflux pump Pdr5p, calcium homeostasis, or protein glycosylation was found in pmr1 ∆ yeast. Basal ROS levels are elevated in pmr1 ∆ yeast and artemisinin exposure does not enhance ROS accumulation. This is in contrast to WT cells that exhibit a significant increase in ROS production following treatment with artemisinin. Yeast deleted for PMR1 are known to accumulate excess manganese ions that can function as ROS-scavenging molecules, but no correlation between manganese content and artemisinin resistance was observed. We propose that loss of function mutations in Pmr1p in yeast cells and PfATP6 in P. falciparum are protective against artemisinin toxicity due to reduced intracellular oxidative damage.

Background: The performance of elite breath hold divers (BHD) includes static breath hold for more than 11 minutes, swimming as far as 300 m, or going below 250 m in depth, all on a single breath of air. Diving mammals are adapted to sustain oxidative metabolism in hypoxic conditions through several metabolic adaptations, including improved capacity for oxygen transport and mitochondrial oxidative phosphorylation in skeletal muscle. It was hypothesized that similar adaptations characterized human BHD. Hence, the purpose of this study was to examine the capacity for oxidative metabolism in skeletal muscle of BHD compared to matched controls., Methods: Biopsies were obtained from the lateral vastus of the femoral muscle from 8 Danish BHD and 8 non-diving controls (Judo athletes) matched for morphometry and whole body VO2max. High resolution respirometry was used to determine mitochondrial respiratory capacity and leak respiration with simultaneous measurement of mitochondrial H2O2 emission. Maximal citrate synthase (CS) and 3-hydroxyacyl CoA dehydrogenase (HAD) activity were measured in muscle tissue homogenates. Western Blotting was used to determine protein contents of respiratory complex I-V subunits and myoglobin in muscle tissue lysates., Results: Muscle biopsies of BHD revealed lower mitochondrial leak respiration and electron transfer system (ETS) capacity and higher H2O2 emission during leak respiration than controls, with no differences in enzyme activities (CS and HAD) or protein content of mitochondrial complex subunits myoglobin, myosin heavy chain isoforms, markers of glucose metabolism and antioxidant enzymes., Conclusion: We demonstrated for the first time in humans, that the skeletal muscles of BHD are characterized by lower mitochondrial oxygen consumption both during low leak and high (ETS) respiration than matched controls. This supports previous observations of diving mammals demonstrating a lower aerobic mitochondrial capacity of the skeletal muscles as an oxygen conserving adaptation during prolonged dives., Competing Interests: The authors have declared that no competing interests exist.

The level of circulating vitamin D is known to be associated with the ejection fraction in heart failure patients and studies in rats have shown that vitamin D depletion leads to increased levels of circulating norepinephrine and decreased atrial contractility. We elucidated the effects of vitamin D supplementation on the autonomous nervous system in healthy youngsters. Thirty healthy subjects aged 18-25 years were recruited based on their serum 25-hydroxyvitamin D (25[OH]D): 15 vitamin D insufficient (25[OH]D < 50 nmol/L) and 15 vitamin D sufficient (25[OH]D > 80 nmol/L) subjects. Both groups had vitamin D supplementation (30 microg/day) and were tested at baseline and after 30, 90, and 180 days. At each visit the serum 25-hydroxyvitamin D was measured and the head-up tilt test performed. Serum 25[OH]D remained stable in the vitamin D sufficient group, while the insufficient group had a significant increase (32.0-64.5 nmol/L), P < 0.0001. Despite the increase, the insufficient group did not reach the level of the vitamin D sufficient group within the 6 months observational period (96.1 vs 64.5 nmol/L), P < 0.01. Serum norepinephrine at baseline was higher in the insufficient group (mean = 1.61 nmol/L) than in the vitamin D sufficient group (mean = 0.94 nmol/L), P < 0.01, whereas the response to tilt was lower in the insufficient group (mean = 0.69 nmol/L) compared to the sufficient group (mean = 1.17 nmol/L), P < 0.01. The heart rate at rest was higher in the insufficient group (mean = 67.7 bpm) than in the vitamin D sufficient group (mean = 56.6 bpm), P < 0.01, for the three first visits. At the last visit no difference was found. The systolic and diastolic blood pressure differed between the groups after a month, with higher pressures in the insufficient group than in the sufficient group. Vitamin D supplementation modulates the sympathetic nervous system in healthy youngsters with low serum vitamin D. The observation might lead to a greater focus on possible prevention of cardiac disease later on in life by vitamin D supplementation early in life., (© 2018 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.)

Expression of HLA-C varies widely across individuals in an allele-specific manner. This variation in expression can influence efficacy of the immune response, as shown for infectious and autoimmune diseases. MicroRNA binding partially influences differential HLA-C expression, but the additional contributing factors have remained undetermined. Here we use functional and structural analyses to demonstrate that HLA-C expression is modulated not just at the RNA level, but also at the protein level. Specifically, we show that variation in exons 2 and 3, which encode the α1/α2 domains, drives differential expression of HLA-C allomorphs at the cell surface by influencing the structure of the peptide-binding cleft and the diversity of peptides bound by the HLA-C molecules. Together with a phylogenetic analysis, these results highlight the diversity and long-term balancing selection of regulatory factors that modulate HLA-C expression.

Aim: To investigate antifungal potential of Xylaria sp. BIOTEC culture collection (BCC) 1067 extract against the model yeast Saccharomyces cerevisiae., Materials & Methods: Antifungal property of extract, reactive oxygen species levels and cell survival were determined, using selected deletion strains., Results: Extract showed promising antifungal effect with minimal inhibitory concentration 100 and minimal fungicidal concentration of 500 and 1000 mg/l, respectively. Strong synergy was observed with fractional inhibitory concentration index value of 0.185 for the combination of 60.0 and 0.5 mg/l of extract and ketoconazole, respectively. Extract-induced intracellular reactive oxygen species levels in some oxidant-prone strains and mediated plasma membrane rupture. Antioxidant regulator Yap1, efflux transporter Pdr5 and ascorbate were pivotal to protect S. cerevisiae from extract cytotoxicity., Conclusion: Xylaria sp. BCC 1067 extract is a potentially valuable source of novel antifungals.

In humans and rodents, loss of brain orexin/hypocretin (OH) neurons causes pathological sleepiness [1-4], whereas OH hyperactivity is associated with stress and anxiety [5-10]. OH cell control is thus of considerable interest. OH cells are activated by fasting [11, 12] and proposed to stimulate eating [13]. However, OH cells are also activated by diverse feeding-unrelated stressors [14-17] and stimulate locomotion and "fight-or-flight" responses [18-20]. Such OH-mediated behaviors presumably preclude concurrent eating, and loss of OH cells produces obesity, suggesting that OH cells facilitate net energy expenditure rather than energy intake [2, 21-23]. The relationship between OH cells and eating, therefore, remains unclear. Here we investigated this issue at the level of natural physiological activity of OH cells. First, we monitored eating-associated dynamics of OH cells using fiber photometry in free-feeding mice. OH cell activity decreased within milliseconds after eating onset, and remained in a down state during eating. This OH inactivation occurred with foods of diverse tastes and textures, as well as with calorie-free "food," in both fed and fasted mice, suggesting that it is driven by the act of eating itself. Second, we probed the implications of natural OH cell signals for eating and weight in a new conditional OH cell-knockout model. Complete OH cell inactivation in adult brain induced a hitherto unrecognized overeating phenotype and caused overweight that was preventable by mild dieting. These results support an inhibitory interplay between OH signals and eating, and demonstrate that OH cell activity is rapidly controllable, across nutritional states, by voluntary action., (Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.)

A major cause of the paucity of new starting points for drug discovery is the lack of interaction between academia and industry. Much of the global resource in biology is present in universities, whereas the focus of medicinal chemistry is still largely within industry. Open source drug discovery, with sharing of information, is clearly a first step towards overcoming this gap. But the interface could especially be bridged through a scale-up of open sharing of physical compounds, which would accelerate the finding of new starting points for drug discovery. The Medicines for Malaria Venture Malaria Box is a collection of over 400 compounds representing families of structures identified in phenotypic screens of pharmaceutical and academic libraries against the Plasmodium falciparum malaria parasite. The set has now been distributed to almost 200 research groups globally in the last two years, with the only stipulation that information from the screens is deposited in the public domain. This paper reports for the first time on 236 screens that have been carried out against the Malaria Box and compares these results with 55 assays that were previously published, in a format that allows a meta-analysis of the combined dataset. The combined biochemical and cellular assays presented here suggest mechanisms of action for 135 (34%) of the compounds active in killing multiple life-cycle stages of the malaria parasite, including asexual blood, liver, gametocyte, gametes and insect ookinete stages. In addition, many compounds demonstrated activity against other pathogens, showing hits in assays with 16 protozoa, 7 helminths, 9 bacterial and mycobacterial species, the dengue fever mosquito vector, and the NCI60 human cancer cell line panel of 60 human tumor cell lines. Toxicological, pharmacokinetic and metabolic properties were collected on all the compounds, assisting in the selection of the most promising candidates for murine proof-of-concept experiments and medicinal chemistry programs. The data for all of these assays are presented and analyzed to show how outstanding leads for many indications can be selected. These results reveal the immense potential for translating the dispersed expertise in biological assays involving human pathogens into drug discovery starting points, by providing open access to new families of molecules, and emphasize how a small additional investment made to help acquire and distribute compounds, and sharing the data, can catalyze drug discovery for dozens of different indications. Another lesson is that when multiple screens from different groups are run on the same library, results can be integrated quickly to select the most valuable starting points for subsequent medicinal chemistry efforts.

Background: Very few studies have investigated the determinants of circulating 25-hydroxyvitamin D (25[OH]D) in young adults (18-25 years old) using a set of variables that include lifestyle, sociodemographic, and anthropometric data. Our aim was to investigate the association between these variables and vitamin D status in a sample of untreated young adults., Methods: A total of 738 young adults were enrolled in a (June cross-sectional study 2012 to May 2014) and were recruited from educational institutions in the Copenhagen area. For multivariate logistic regression subjects was categorized based on 25[OH]D in serum into; vitamin D sufficiency (S-25[OH]D > 50 nmol/L), vitamin D insufficiency (25 nmol/L ≤ S-25[OH]D ≤ 50 nmol/L), vitamin D deficiency (S-25[OH]D < 25 nmol/L). Information on lifestyle factors and education was obtained by self-reported questionnaires., Results: 700 subjects with a valid measurement of S-25[OH]D and a completed questionnaire was analysed. 238 had vitamin D insufficiency, 135 had vitamin D deficiency of which 13 had severe vitamin D deficiency (S-25[OH]D < 12.5 nmol/L). The relative risk (RR) for vitamin D deficiency was highest for men 2.09 (1.52, 2.87); obese subjects 2.00 (1.27, 3.15); smokers 1.33 (1.02, 1.73); subjects who exercised 0-½ hours a week 1.88 (1.21, 2.94); and subjects who consumed fast food once a week 1.59 (1.05, 2.43). The relative risk was significantly lower for subjects who were studying for a Bachelor's degree (0.40 (0.23, 0.68). For vitamin D insufficiency, the highest RR was again for men 1.31 (1.06, 1.61); obese subjects 1.57 (1.17, 2.11); and subjects who exercised 0-½ hours a week 1.51 (1.11, 2.06)., Conclusion: In this study of young adults, vitamin D deficiency was highly prevalent. Modifiable factors such as smoking, maintenance of normal BMI, and physical activity are all potential targets for interventional trials to determine the causal order; such knowledge would be useful in improving S-25[OH]D in young adults. The small group with severe vitamin D deficiency warrants increased attention.

One of best validated findings in schizophrenia research is the association between blockade of dopamine D2 receptors and the effects of antipsychotics on positive psychotic symptoms. The aim of the present study was to examine correlations between baseline striatal D(2/3) receptor binding potential (BP(p)) values and treatment outcome in a cohort of antipsychotic-naïve first-episode schizophrenia patients. Additionally, we wished to investigate associations between striatal dopamine D(2/3) receptor blockade and alterations of negative symptoms as well as functioning and subjective well-being. Twenty-eight antipsychotic-naïve schizophrenia patients and 26 controls were included in the study. Single-photon emission computed tomography (SPECT) with [(123)I]iodobenzamide ([(123)I]-IBZM) was used to examine striatal D(2/3) receptor BP(p). Patients were examined before and after 6 weeks of treatment with the D(2/3) receptor antagonist amisulpride. There was a significant negative correlation between striatal D(2/3) receptor BP(p) at baseline and improvement of positive symptoms in the total group of patients. Comparing patients responding to treatment to nonresponders further showed significantly lower baseline BP(p) in the responders. At follow-up, the patients demonstrated a negative correlation between the blockade and functioning, whereas no associations between blockade and negative symptoms or subjective well-being were observed. The results show an association between striatal BP(p) of dopamine D(2/3) receptors in antipsychotic-naïve first-episode patients with schizophrenia and treatment response. Patients with a low BP(p) have a better treatment response than patients with a high BP(p). The results further suggest that functioning may decline at high levels of dopamine receptor blockade., (© The Author 2015. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center.)

The ability to rapidly respond to nutrient changes is a fundamental requirement for cell survival. Here, we show that the zinc cluster regulator Znf1 responds to altered nutrient signals following glucose starvation through the direct control of genes involved in non-fermentative metabolism, including those belonged to the central pathways of gluconeogenesis (PCK1, FBP1 and MDH2), glyoxylate shunt (MLS1 and ICL1) and the tricarboxylic acid cycle (ACO1), which is demonstrated by Znf1-binding enrichment at these promoters during the glucose-ethanol shift. Additionally, reduced Pck1 and Fbp1 enzymatic activities correlate well with the data obtained from gene transcription analysis. Cells deleted for ZNF1 also display defective mitochondrial morphology with unclear structures of the inner membrane cristae when grown in ethanol, in agreement with the substantial reduction in the ATP content, suggesting for roles of Znf1 in maintaining mitochondrial morphology and function. Furthermore, Znf1 also plays a role in tolerance to pH and osmotic stress, especially during the oxidative metabolism. Taken together, our results clearly suggest that Znf1 is a critical transcriptional regulator for stress adaptation during non-fermentative growth with some partial overlapping targets with previously reported regulators in Saccharomyces cerevisiae., (© FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.)