Search

Your search keyword '"Li, Yong-Fang"' showing total 138 results
Start Over Author "Li, Yong-Fang" Search Limiters Full Text
138 results on '"Li, Yong-Fang"'

2. Association between hypomagnesemia and severity of primary hyperparathyroidism: a retrospective study

Author

Ding Na, Guo Tao, Liu Shu-Ying, Wang Qin-Yi, Qu Xiao-Li, Li Yong-Fang, Ou Yang-Na, Sheng Zhi-Feng, and Yang Yan-Yi

Subjects
Primary hyperparathyroidism, Hypomagnesemia, Severity, Biochemical, Clinical, Diseases of the endocrine glands. Clinical endocrinology, RC648-665
Abstract

Abstract Background The occurrence of hypomagnesemia in patients with primary hyperparathyroidism (PHPT) has been noted previously; however, the association of hypomagnesemia and severity of primary hyperparathyroidism remains unknown. The present study aimed to evaluate the association of hypomagnesemia with biochemical and clinical manifestations in patients with PHPT. Methods This was a retrospective study conducted at a tertiary hospital. We obtained data from 307 patients with PHPT from January 2010 through August 2020. Data on demographics, history, laboratory findings, bone densitometry findings, and clinical presentation and complications were collected and were compared in normal magnesium group vs hypomagnesemia group. Results Among the 307 patients with PHPT included in our study, 77 patients (33/102 [32.4%] males and 44/205 [21.5%] females) had hypomagnesemia. Mean hemoglobin levels in the hypomagnesemia group were significantly lower than those in the normal magnesium group in both males and females. In contrast, patients with hypomagnesemia had a higher mean serum calcium and parathyroid hormone than individuals with normal magnesium. The typical symptoms of PHPT, such as nephrolithiasis, bone pain/fractures, polyuria, or polydipsia, were more common in the hypomagnesemia group. In addition, patients with hypomagnesemia had a higher prevalence of osteoporosis, anemia, and hypercalcemic crisis. Even after adjusting for potential confounders, including age, sex, body mass index, estimated glomerular filtration rate, and parathyroid hormone levels, these associations remained essentially unchanged. Conclusion Biochemical and clinical evidence indicates that patients with PHPT with hypomagnesemia have more severe hyperparathyroidism than those without hypomagnesemia. In addition, PHPT patients with hypomagnesemia had a higher prevalence of osteoporosis, anemia, and hypercalcemic crisis.

Published
2021
Full Text
View/download PDF

6. Comparative Effectiveness of MRI, 4D-CT and Ultrasonography in Patients with Secondary Hyperparathyroidism

Author

Mi,Jiaoping, Fang,Yijie, Xian,Jianzhong, Wang,Guojie, Guo,Yuanqing, Hong,Haiyu, Chi,Mengshi, Li,Yong-Fang, He,Peng, Gao,Jiebing, Liao,Wei, Mi,Jiaoping, Fang,Yijie, Xian,Jianzhong, Wang,Guojie, Guo,Yuanqing, Hong,Haiyu, Chi,Mengshi, Li,Yong-Fang, He,Peng, Gao,Jiebing, and Liao,Wei

Abstract

Jiaoping Mi,1,2,* Yijie Fang,3,* Jianzhong Xian,4 Guojie Wang,3 Yuanqing Guo,5 Haiyu Hong,2 Mengshi Chi,2 Yong-Fang Li,2 Peng He,2 Jiebing Gao,3 Wei Liao2 1Department of Otolaryngology Head and Neck Surgery, The First Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China; 2Department of Otolaryngology Head and Neck Surgery, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China; 3Department of Radiology, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China; 4Department of Ultrasound, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China; 5Department of Spinal Surgery, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China*These authors contributed equally to this workCorrespondence: Wei Liao, Department of Otolaryngology Head and Neck Surgery, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, 519020, People’s Republic of China, Email liaowei23@mail.sysu.edu.cn Jiebing Gao, Department of Radiology, The Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, Guangdong, People’s Republic of China, Email Gaojb@mail.sysu.edu.cnObjective: Accurate preoperative localization of abnormal parathyroid glands is crucial for successful surgical management of secondary hyperparathyroidism (SHPT). This study was conducted to compare the effectiveness of preoperative MRI, 4D-CT, and ultrasonography (US) in localizing parathyroid lesions in patients with SHPT.Methods: We performed a retrospective review of prospectively collected data from a tertiary-care hospital and identified 52 patients who received preoperative MRI and/or 4D-CT and/or US and/or 99mTc-MIBI and subsequently underwent surgery for SHPT between May 2013 and March 2020. The sensitivity, specificity, positive predictive

Published
2023

10. Development of a Nomogram for Predicting Very Low Bone Mineral Density (T-Scores <−3) in the Chinese Population

Author

Li,Yong-Fang, Wang,Qin-Yi, Xu,Lu-Lu, Yue,Chun, Hu,Li, Ding,Na, Yang,Yan Yi, Qu,Xiao-Li, and Sheng,Zhi-Feng

Subjects
International Journal of General Medicine
Abstract

Yong-Fang Li,1,&ast; Qin-Yi Wang,1,&ast; Lu-Lu Xu,2 Chun Yue,2 Li Hu,2 Na Ding,1 Yan-Yi Yang,2 Xiao-Li Qu,1 Zhi-Feng Sheng1,2 1National Clinical Research Center for Metabolic Diseases, Hunan Provincial Key Laboratory of Metabolic Bone Diseases, Department of Metabolism and Endocrinology, Health Management Center, The Second Xiangya Hospital of Central South University, Changsha, Hunan, People’s Republic of China; 2Health Management Center, The Second Xiangya Hospital of Central South University, Changsha, Hunan, People’s Republic of China&ast;These authors contributed equally to this workCorrespondence: Zhi-Feng Sheng, Tel +86-13574806523, Email shengzhifeng@csu.edu.cnPurpose: Fragility fractures, the most serious complication of osteoporosis, affect life quality and increase medical expenses and economic burden. Strategies to identify populations with very low bone mineral density (T-scores

Published
2022

11. Additional file 2 of Deciphering the genome of Simplicillium aogashimaense to understand its mechanisms against the wheat powdery mildew fungus Blumeria graminis f. sp. tritici

Author

Zhu, Mo, Duan, Xiao, Cai, Pengkun, Li, Yong-fang, and Qiu, Zongbo

Abstract

Additional file 2: Figure S1. Alignment (a) and phylogenetic analysis (b) of Sao008714 and its homologs from Trichoderma spp. and Pseudozyma flocculosa were performed using DNAMAN and MEGA, respectively. The evolutionary tree was constructed using the maximum likelihood method with the options of 1000 bootstrap replicates, Tamura-Nei model and 50% site coverage cut off (Zhu et al. 2022). Figure S2. Alignment (a) and phylogenetic analysis (b) of Sao006491 and its homologs from Trichoderma spp. and Pseudozyma flocculosa were performed using DNAMAN and MEGA, respectively. The evolutionary tree was constructed according to Maximum likelihood method with the options of 1000 bootstrap replicates, Tamura-Nei model and 50% site coverage cut-off. Figure S3. The expression levels of Sao008714 (a) and Sao006491 (b) during mycoparasitic interaction of S. aogashimaense with Blumeria graminis f. sp. tritici (Bgt). The spore suspension of S. aogashimaense was sprayed onto wheat leaves with Bgt colonies. The whole leaves were harvested at 3, 6 and 9 dpi for RNA extraction. The elongation factor 1 alpha-encoding gene of S. aogashimaense was used as the reference gene. The following primers were used for amplification: Sao006491, GGATATGAGTCGCGCTTCCA (forward) and AAACTGAGCGGCGTTTGTTCF (reverse); Sao008714, ACAATCCATCGGCCACAGAG (forward) and CCAACTCCGCCATGAGATGT (reverse). The expression levels of Sao008714 and Sao006491 were calculated using the 2−ΔΔCt method. Data are expressed as mean ± standard deviation from three independent biological experiments. The means were compared using one-way analysis of variance, followed by Tukey’s post hoc test. Different letters indicate significant differences (P < 0.05).

Published
2022
Full Text
View/download PDF

15. mRNA N6‐methyladenosine is critical for cold tolerance in Arabidopsis.

Author

Govindan, Ganesan, Sharma, Bishwas, Li, Yong‐Fang, Armstrong, Christopher D., Merum, Pandrangaiah, Rohila, Jai S., Gregory, Brian D., and Sunkar, Ramanjulu

Subjects
ALTERNATIVE RNA splicing, RNA regulation, MESSENGER RNA, PLANT adaptation, REACTIVE oxygen species
Abstract

SUMMARY: Plants respond to low temperatures by altering the mRNA abundance of thousands of genes contributing to numerous physiological and metabolic processes that allow them to adapt. At the post‐transcriptional level, these cold stress‐responsive transcripts undergo alternative splicing, microRNA‐mediated regulation and alternative polyadenylation, amongst others. Recently, m6A, m5C and other mRNA modifications that can affect the regulation and stability of RNA were discovered, thus revealing another layer of post‐transcriptional regulation that plays an important role in modulating gene expression. The importance of m6A in plant growth and development has been appreciated, although its significance under stress conditions is still underexplored. To assess the role of m6A modifications during cold stress responses, methylated RNA immunoprecipitation sequencing was performed in Arabidopsis seedlings esposed to low temperature stress (4°C) for 24 h. This transcriptome‐wide m6A analysis revealed large‐scale shifts in this modification in response to low temperature stress. Because m6A is known to affect transcript stability/degradation and translation, we investigated these possibilities. Interestingly, we found that cold‐enriched m6A‐containing transcripts demonstrated the largest increases in transcript abundance coupled with increased ribosome occupancy under cold stress. The significance of the m6A epitranscriptome on plant cold tolerance was further assessed using the mta mutant in which the major m6A methyltransferase gene was mutated. Compared to the wild‐type, along with the differences in CBFs and COR gene expression levels, the mta mutant exhibited hypersensitivity to cold treatment as determined by primary root growth, biomass, and reactive oxygen species accumulation. Furthermore, and most importantly, both non‐acclimated and cold‐acclimated mta mutant demonstrated hypersensitivity to freezing tolerance. Taken together, these findings suggest a critical role for the epitranscriptome in cold tolerance of Arabidopsis. Significance Statement: The importance of m6A in plant growth and development has been acknowledged, although its significance in plant adaptation to stress conditions is still underexplored. Our transcriptome‐wide m6A analysis coupled with the mta mutant phenotypic and physiological assays suggested a critical role for the epitranscriptome in the cold tolerance of Arabidopsis [ABSTRACT FROM AUTHOR]

Published
2022
Full Text
View/download PDF

24. Complete nucleotide sequence of plasmid Rts1: implications for evolution of large plasmid genomes

Author

Murata, Takahiro, Ohnishi, Makoto, Ara, Takeshi, Kaneko, Jun, Han, Chang-Gyun, Li, Yong Fang, Takashima, Takeyoshi, Nojima, HideakiNakayama, Keisuke, Kaji, Akira, Kamio, Yoshiyuki, Miki, Takeyoshi, Mori, Hirotada, Ohtsubo, Eiichi, Terawaki, Yoshiro, and Hayashi, Tetsuya

Subjects
Plasmids -- Genetic aspects, Nucleotide sequence -- Analysis, Genomes -- Genetic aspects, Biological sciences
Abstract

Results point out that the genome organization of the large conjugative plasmid, Rts1, consists of four large modules, suggesting modular gene repertoire evolution of large plasmids. The plasmid is 217,182 basepairs in length containing 300 open reading frames and tus-like genes involved in replication termination.

Published
2002

30. Additional file 2 of Phased secondary small interfering RNAs in Panaxnotoginseng

Author

Chen, Kun, Liu, Li, Xiaotuo Zhang, Yuanyuan Yuan, Shuchao Ren, Junqiang Guo, Qingyi Wang, Peiran Liao, Shipeng Li, Xiuming Cui, Li, Yong-Fang, and Zheng, Yun

Subjects
InformationSystems_INFORMATIONSTORAGEANDRETRIEVAL, ComputingMilieux_COMPUTERSANDEDUCATION, Data_FILES, ComputingMethodologies_DOCUMENTANDTEXTPROCESSING, ComputerApplications_COMPUTERSINOTHERSYSTEMS
Abstract

Supplementary Figures. This is a pdf file. This file includes 2 supplementary figures. (PDF 1148 kb)

Published
2018
Full Text
View/download PDF

32. L‐glutamine protects mouse brain from ischemic injury via up‐regulating heat shock protein 70

Author

Luo, Long‐Long, primary, Li, Yong‐Fang, additional, Shan, Hui‐Min, additional, Wang, Li‐Ping, additional, Yuan, Fang, additional, Ma, Yuan‐Yuan, additional, Li, Wan‐Lu, additional, He, Ting‐Ting, additional, Wang, Yu‐Yang, additional, Qu, Mei‐Jie, additional, Liang, Huai‐Bin, additional, Zhang, Zhi‐Jun, additional, Yang, Guo‐Yuan, additional, Tang, Yao‐Hui, additional, and Wang, Yong‐Ting, additional

Published
2019
Full Text
View/download PDF

34. Comparative transcriptome and translatome analysis in contrasting rice genotypes reveals differential mRNA translation in salt-tolerant Pokkali under salt stress

Author

Li, Yong-Fang, primary, Zheng, Yun, additional, Vemireddy, Lakshminarayana R., additional, Panda, Sanjib Kumar, additional, Jose, Smitha, additional, Ranjan, Alok, additional, Panda, Piyalee, additional, Govindan, Ganesan, additional, Cui, Junxia, additional, Wei, Kangning, additional, Yaish, Mahmoud W., additional, Naidoo, Gnanambal Charmaine, additional, and Sunkar, Ramanjulu, additional

Published
2018
Full Text
View/download PDF

35. Phased secondary small interfering RNAs in Panaxnotoginseng

Author

Chen, Kun, primary, Liu, Li, additional, Zhang, Xiaotuo, additional, Yuan, Yuanyuan, additional, Ren, Shuchao, additional, Guo, Junqiang, additional, Wang, Qingyi, additional, Liao, Peiran, additional, Li, Shipeng, additional, Cui, Xiuming, additional, Li, Yong-Fang, additional, and Zheng, Yun, additional

Published
2018
Full Text
View/download PDF

40. Recent advances in planar heterojunction organic-inorganic hybrid perovskite solar cells

Author

Tan Zhan’ao, LI Yong-Fang, Wang Fuzhi, and Dai Song-Yuan

Subjects
Materials science, business.industry, Exciton, Photovoltaic system, Energy conversion efficiency, General Physics and Astronomy, Nanotechnology, Heterojunction, Hybrid solar cell, Polymer solar cell, Planar, Optoelectronics, business, Perovskite (structure)
Abstract

The development of highly efficient and low-cost solar cells is the key to large-scale application of solar photovoltaic technology. In recent years, the solution-processed organic-inorganic perovskite solar cells attracted considerable attention because of their advantages of high energy conversion efficiency, low cost, and ease of processing. The ambipolar semiconducting characteristic of perovskite enables the construction of planar heterojunction architecture to be possible in perovskite-based solar cells. This kind of architecture avoids the use of mesoporous metal oxide film, which simplifies the processing route and makes it easier to fabricate flexible and tandem perovskite-based solar cells. Planar heterojunction perovskite solar cells can be divided into n-i-p type and p-i-n type according to the charge flow direction. Two interfaces are formed between perovskite film and hole/electron transport layer, where efficient charge separation can be realized. Hole and electron transport layers can form separated continuous paths for the transport of holes and electrons, thus beneficial to improving exciton separation, charge transportation, and collection efficiency. In addition, this planar architecture avoids the use of high temperature sintered mesoporous metal oxide framework; this is beneficial to expanding the choice of the charge transport materials. In this paper, we review the recent progress on the planar heterojunction perovskite solar cells. First, we introduce the material properties of perovskite, the evolution of device architecture, and the working principle of p-i-n type and n-i-p type planar heterojunction perovskite solar cells. Then, we review the recent progress and optimization of planar heterojunction perovskite solar cells from every aspect of perovskite preparation and the selection of electron/hole transport materials. Finally, we would like to give a perspective view on and address the concerns about perovskite solar cells.

Published
2015

50. Measurement of quantum states with incoherent light

Author

Ma Rui-Qiong, Shi Jian, and Li Yong-Fang

Subjects
Physics, Autler–Townes effect, Quantum state, Quantum mechanics, Quantum limit, Process (computing), General Physics and Astronomy, Quantum imaging, Space (mathematics), Signal, Evolution rule
Abstract

A novel and high resolution method for measuring quantum states with incoherent light in the time-domain is presented. Taking Autler-Townes effect as an example, the physical process and the evolution rule during measurement are discussed by an explicit analytical formulation in detail; and the influence of measuring process on the quantum state is disclosed. With this method, very small splitting of the energy-level and large energy-level space can be measured readily at the same time, while the transverse relaxation rate of the system can be obtained directly by checking the decay time of the signal. Compared with the characteristics of the measuring methods between the time-domain and frequency-domain, we found that the measuring quantum states with incoherent light in the time-domain is robust and valid for disclosing information of the quantum state completely.

Published
2008

Catalog

Books, media, physical & digital resources
See catalog results