Search

Abstract Background The outcome of hepatocellular carcinoma (HCC) is limited by its complex molecular characteristics and changeable tumor microenvironment (TME). Here we focused on elucidating the functional consequences of Maternal embryonic leucine zipper kinase (MELK) in the tumorigenesis, progression and metastasis of HCC, and exploring the effect of MELK on immune cell regulation in the TME, meanwhile clarifying the corresponding signaling networks. Methods Bioinformatic analysis was used to validate the prognostic value of MELK for HCC. Murine xenograft assays and HCC lung metastasis mouse model confirmed the role of MELK in tumorigenesis and metastasis in HCC. Luciferase assays, RNA sequencing, immunopurification–mass spectrometry (IP-MS) and coimmunoprecipitation (CoIP) were applied to explore the upstream regulators, downstream essential molecules and corresponding mechanisms of MELK in HCC. Results We confirmed MELK to be a reliable prognostic factor of HCC and identified MELK as an effective candidate in facilitating the tumorigenesis, progression, and metastasis of HCC; the effects of MELK depended on the targeted regulation of the upstream factor miR-505-3p and interaction with STAT3, which induced STAT3 phosphorylation and increased the expression of its target gene CCL2 in HCC. In addition, we confirmed that tumor cell-intrinsic MELK inhibition is beneficial in stimulating M1 macrophage polarization, hindering M2 macrophage polarization and inducing CD8 + T-cell recruitment, which are dependent on the alteration of CCL2 expression. Importantly, MELK inhibition amplified RT-related immune effects, thereby synergizing with RT to exert substantial antitumor effects. OTS167, an inhibitor of MELK, was also proven to effectively impair the growth and progression of HCC and exert a superior antitumor effect in combination with radiotherapy (RT). Conclusions Altogether, our findings highlight the functional role of MELK as a promising target in molecular therapy and in the combination of RT therapy to improve antitumor effect for HCC.

Abstract Background The ratio of non-high-density lipoprotein cholesterol (non-HDL-C) to high-density lipoprotein cholesterol (HDL-C) (NHHR) serves as a reliable lipid indicator associated with atherogenic characteristics. Studies have indicated a potential connection between suicidality and lipid metabolism. This research aims to investigate any possible association between the NHHR and the emergence of suicidal ideation within the confines of the study. Methods This study examined the association between NHHR levels and suicidal ideation using data from the National Health and Nutrition Examination Survey (NHANES), conducted in the United States spanning 2005 and 2016. Calculation of the NHHR corresponds to the proportion of HDL-C to Non-HDL-C. The Patient Health Questionnaire-9’s ninth question was implemented for assessing suicidal ideation. Using subgroup analysis, smooth curve fitting, and multivariate logistic regression analysis, the research was conducted. Results Encompassing a cohort of 29,288 participants, the analysis identified that 3.82% of individuals reported suicidal ideation. After using multivariable logistic regression and thorough adjustments, elevated NHHR levels were significantly and positively associated with a heightened likelihood of suicidal ideation, according to the findings (odds ratio [OR] = 1.06; 95% confidence interval [CI]: 1.02–1.11; P = 0.0048). Despite extensive adjustment for various confounding factors, this relationship remained consistent. An inverted U-shaped curve was utilized to illustrate the link between NHHR and suicidal ideation among nonsmokers; the curve’s inflection point was situated at 7.80. Subgroup analysis and interaction tests (all P for interaction > 0.05) demonstrated that there was no significant influence of the following variables on this positive relationship: age, sex, race, body mass index, education level, married status, hypertension, diabetes, and smoking status. Conclusion Significantly higher NHHR levels were associated with an elevated likelihood of suicidal ideation. Based on these results, it is probable that NHHR may serve as a predictive indicator of suicidal ideation, emphasizing its potential utility in risk assessment and preventive strategies.

Summary: For a long time, myeloid-derived suppressor cells (MDSCs) dilated in circulation system of colorectal cancer (CRC) patients have been puzzling clinicians. Various evidence shows that MDSCs constitute the bulk of immunosuppression in CRC, which is related to tumor growth, adhesion, invasion, metastasis, and immune escape. However, the mechanisms underlying these cells formation remain incompletely understood. In this study, we reported that CRC cell-derived LC3-dependent extracellular vesicles (LDEVs)-mediated M-MDSCs formation via TLR2-MYD88 pathway. Furthermore Hsp60 was the LDEVs surface ligand that triggered these MDSCs induction. In clinical studies, we reported that accumulation of circulating M-MDSCs as well as IL-10 and arginase1 secretion were reliant upon the levels of tumor cell-derived LDEVs in CRC patients. These findings indicated how local tumor cell-derived extracellular vesicles influence distal hematopoiesis and provided novel justification for therapeutic targeting of LDEVs in patients with CRC.

Abstract Background SMYD3, a member of the SET and MYND domain-containing (SMYD) family, is a histone methyltransferase (HMT) and transcription factor that plays an important role in transcriptional regulation in human carcinogenesis. Results Using affinity purification and mass spectrometry assays to identify SMYD3-associated proteins in hepatocellular carcinoma (HCC) cells, we found several previously undiscovered SMYD3-interacting proteins, including the NuRD (MTA1/2) complex, the METTL family, and the CRL4B complex. Transcriptomic analysis of the consequences of knocking down SMYD3, MTA1, or MTA2 in HCC cells showed that SMYD3/NuRD complex targets a cohort of genes, some of which are critically involved in cell growth and migration. qChIP analyses showed that SMYD3 knockdown led to a significant reduction in the binding of MTA1 or MTA2 to the promoters of IGFBP4 and led to a significant decrease in H4K20me3 and a marked increase in H4Ac at the IGFBP4 promoter. In addition, we demonstrated that SMYD3 promotes cell proliferation, invasion, and tumorigenesis in vivo and in vitro and found that its expression is markedly upregulated in human liver cancer. Knockdown of MTA1 or MTA2 had the same effect as knockdown of SMYD3 on proliferation and invasion of hepatocellular carcinoma cells. Catalytic mutant SMYD3 could not rescue the phenotypic effects caused by knockdown of SMYD3. Inhibitors of SMYD3 effectively inhibited the proliferation and invasiveness of HCC cells. Conclusions These findings revealed that SMYD3 could transcriptionally repress a cohort of target genes expression by associating with the NuRD (MTA1/2) complex, thereby promoting the proliferation and invasiveness of HCC cells. Our results support the case for pursuing SMYD3 as a practical prognostic marker or therapeutic target against HCC.

Background: Hypoxia is known to play a critical role in tumor occurrence, progression, prognosis, and therapy resistance. However, few studies have investigated hypoxia markers for diagnosing and predicting prognosis in colon adenocarcinoma (COAD). This study aims to identify a hypoxia genes-based biomarker for predicting COAD patients’ prognosis and response to immunotherapy on an individual basis. Methods: Hypoxia-related genes were extracted from the Molecular Signatures Database. Gene expression, clinical data, and mutation data of COAD were collected retrospectively from the Cancer Genome Atlas, the Gene Expression Omnibus, and the International Cancer Genome Consortium databases. Univariate and multivariate cox regression, and the least absolute shrinkage and selection operator method were used to select the genes most associated with the prognosis of COAD patients. Kaplan–Meier survival analysis, receiver operating characteristic curves, calibration curves, and decision curve analyses were performed to validate the efficacy of the signature in predicting the prognosis of COAD patients. EdU incorporation assays, cell survival assays, western blot assays, and trans-well invasion assays were performed to further confirm the function of the screened genes in tumorigenesis. Results: ENO3 and KDM3A were identified as key genes for constructing prognostic and diagnostic signatures, which were found to be independent risk factors for predicting the prognosis and diagnosis of COAD patients. Using these signatures, COAD patients could be stratified into high-risk and low-risk groups, with the latter exhibiting better overall survival outcomes. Moreover, the high-risk group displayed elevated levels of immune checkpoint genes and tumor mutation burden, indicating that these patients may benefit from immune checkpoint inhibitor therapy. Conclusion: The signature developed in this study demonstrates excellent efficacy in prognosticating the outcomes of COAD patients. Moreover, it can serve as a valuable tool for clinicians to identify COAD patients who are suitable for ICI therapy.

Abstract Background Recently, a whole-body 5 T MRI scanner was developed to open the door of abdominal imaging at high-field strength. This prospective study aimed to evaluate the feasibility of renal imaging at 5 T and compare the image quality, potential artifacts, and contrast ratios with 3 T. Methods Forty healthy volunteers underwent MRI examination both at 3 T and 5 T. MRI sequences included T1-weighted gradient-echo (GRE), T2-weighted fast spin echo, diffusion-weighted imaging, and multi-echo GRE T2* mapping. Image quality and presence of artifacts were assessed for all sequences using four-point scales. For anatomical imaging, the signal-to-noise ratio (SNR) and contrast ratio (CR) of abdomen organ tissues were calculated. Besides, for functional imaging, the contrast-to-noise ratio of cortex/medulla was calculated. Wilcoxon signed rank-sum test was used to compare the visual evaluation scores and quantitative measurements between 3 and 5 T images. Results Compared to 3 T examination, T1-weighted sequence at 5 T showed significantly better image quality with higher conspicuity of the renal veins and arteries, and comparable artifacts. Image quality was comparable between both field strengths on T2-weighted images, whereas a significantly higher level of artifacts was observed at 5 T. Besides, 5 T MRI contributed to higher SNR and CR for abdomen organ tissues. For functional imaging, 5 T MRI showed improved corticomedullar discrimination. There was no significant difference between apparent diffusion coefficient of renal at 3 T and 5 T, while 5 T MRI resulted in significantly shorter T2* values in both cortex and medulla. Conclusions 5 T MRI provides anatomical and functional images of the kidney with sufficient image quality.

Abstract Background Ubiquitination is a basic post-translational modification of intracellular proteins and can be reversed enzymatically by DUBs (deubiquitinating enzymes). More than 90 DUBs have been identified. Among them, the deubiquitinating enzyme YOD1, a member of the ovarian tumor domain protease (OTUs) subfamily, is involved in the regulation of endoplasmic reticulum (ER)-related degradation pathways. In fact, it is reported that YOD1 is an important proliferation and metastasis-inducing gene, which can stimulate the characteristics of cancer stem cells and maintain circulating tumor cells (CTC). However, the expression level, prognostic effect and biological functional mechanism of YOD1 in pancreatic cancer are still unclear. Results In the GEO and TCGA databases, YOD1 mRNA expression is significantly up regulated in a variety of human pancreatic cancer tissues. Survival analysis showed that the up regulation of YOD1 can predict poor prognosis of pancreatic cancer. Cox analysis showed that high YOD1 expression is an independent prognostic factor of pancreatic cancer. ROC analysis shows that YOD1 has significant diagnostic value. The immunohistochemistry (IHC) results showed that the protein expression level of YOD1 in pancreatic cancer tissue was higher than that in neighboring non-pancreatic cancer tissues (P

Abstract Colorectal cancer (CRC) is one of the most commonly diagnosed and deadly malignant tumors globally, and its occurrence and progression are closely related to the poor histological features and complex molecular characteristics among patients. It is urgent to identify specific biomarkers for effective treatment of CRC. In this study, we performed comprehensive experiments to validate the role of xCT expression in CRC tumorigenesis and stemness and confirmed xCT knockdown significantly suppressed the proliferation, migration, and stemness of CRC cells in vitro and effectively inhibited CRC tumorigenesis and metastasis in vivo. In addition, bioinformatic analysis and luciferase assays were used to identify E2F1 as a critical upstream transcription factor of SLC7A11 (the gene encoding for xCT) that facilitated CRC progression and cell stemness. Subsequent RNA sequencing, western blotting, rescue assay, and immunofluorescence assays revealed MELK directly co-expressed with xCT in CRC cells, and its upregulation significantly attenuated E2F1/xCT-mediated tumorigenesis and stemness in CRC. Further molecular mechanism exploration confirmed that xCT knockdown may exert an antitumor effect by controlling the activation of MELK-mediated Akt/mTOR signaling. Erastin, a specific inhibitor of xCT, was also proven to effectively inhibit CRC tumorigenesis and cell stemness. Altogether, our study showed that E2F1/xCT is a promising therapeutic target of CRC that promotes tumorigenesis and cell stemness. Erastin is also an effective antitumoral agent for CRC.

Abstract Background Tumor microenvironments are characterized by resistance to chemotherapeutic agents and radiotherapy. Hypoxia plays an important role in the development of tumor resistance, as well as the generation of metastatic potential. YAP also participates in the regulation of hypoxia-mediated chemoresistance, and is negatively regulated by protein tyrosine phosphatase non-receptor type 14 (PTPN14). Methods The PTPN14 expression in hepatocellular carcinoma (HCC) tissues were evaluated by qRT-PCR, western blot and tissue microarrays. The effect of PTPN14 on HCC progression was investigated in vitro and in vivo. Results Here, we report that PTPN14 expression was downregulated in HCC tissues and cell lines. Silencing PTPN14 significantly enhanced proliferation, migration, invasion of HepG2 cells in vitro and tumor growth and metastasis in vivo, whereas overexpression of PTPN14 significantly inhibited these abilities in SK-Hep1 cells. We also found that hypoxia-induced nuclear translocation and accumulation of PTPN14 led to resistance to sorafenib in HCC cells. Further mechanistic studies suggested that NPM1 regulates PTPN14 localization, and that NPM1 regulates YAP by retaining PTPN14 in the nucleus under hypoxic conditions. Conclusions These data suggest that a therapeutic strategy against chemoresistant HCC may involve disruption of NPM1-mediated regulation of YAP by retaining PTPN14 in the nucleus under hypoxic conditions.

Background: Café-au-lait macules (CALMs) are common birthmarks associated with several genetic syndromes, such as neurofibromatosis type 1 (NF1). Isolated CALMs are defined as multiple café-au-lait macules in patients without any other sign of NF1. Typical CALMs can have predictive significance for NF1, and non-invasive techniques can provide more accurate results for judging whether café-au-lait spots are typical.Objectives: The study aimed to investigate gene mutations in six Chinese Han pedigrees of isolated CALMs and summarize the characteristics of CALMs under dermoscopy and reflectance confocal microscopy (RCM).Methods: In this study, we used Sanger sequencing to test for genetic mutations in six families and whole exome sequencing (WES) in two families. We used dermoscopy and RCM to describe the imaging characteristics of CALMs.Results: In this study, we tested six families for genetic mutations, and two mutations were identified as novel mutations. The first family identified [NC_000017.11(NM_001042492.2):c.7355G>A]. The second family identified [NC_000017.11(NM_001042492.2):c.2739_2740del]. According to genotype-phenotype correlation analyses, proband with frameshift mutation tended to have a larger number of CALMs and a higher rate of having atypical CALMs. Dermoscopy showed uniform and consistent tan-pigmented network patches with poorly defined margins with a lighter color around the hair follicles. Under RCM, the appearance of NF1 comprised the increased pigment granules in the basal layer and significantly increased refraction.Conclusion: A new heterozygous mutation and a new frameshift mutation of NF1 were reported. This article can assist in summarizing the properties of dermoscopy and RCM with CALMs.

Infantile pustular psoriasis (IPP) is an extremely rare skin disease associated with genetic factors. Gene mutations of IL36RN (interleukin-36 receptor antagonist), CARD14 (caspase recruitment family member 14), and AP1S1 (the σ1C subunit of the adaptor protein complex 1) had been identified to be involved in the pathogenesis of IPP. IPP usually develops with no preceding psoriasis vulgaris (PV) or familial history. Here, we report a case of a 6-month-old infant and make the diagnosis of IPP by a series of examinations; subsequently, by detecting coexistent mutations of IL36RN and CARD14, the diagnosis is intensified from a genetic point of view. We treated the child with traditional oral and topical drugs regardless of the commonly used acitretin considering its potential side effects, such as skeletal toxicity, and the lesions got conspicuous improvement with much reduction of inflammation. Owing to the genetic mutation of IL-36, there had been reported cases focusing on anti-IL36 biological agents in the treatment of IPP, and it could be a new weapon to treat and improve such IL-36RN-deficient skin diseases.

Introduction: The development and prognosis of HCC involve complex molecular mechanisms, which affect the effectiveness of its treatment strategies. Tumor mutational burden (TMB) is related to the efficacy of immunotherapy, but the prognostic role of TMB-related genes in HCC has not yet been determined clearly. Objectives: In this study, we identified TMB-specific genes with good prognostic value to build diagnostic and prognostic models and provide guidance for the treatment of HCC patients. Methods: Weighted gene co-expression network analysis (WGCNA) was applied to identify the TMB-specific genes. And LASSO method and Cox regression were used in establishing the prognostic model. Results: The prognostic model based on SMG5 and MRPL9 showed patients with higher prognostic risk had a remarkedly poorer survival probability than their counterparts with lower prognostic risk in both a TCGA cohort (P

The recent interest in precision medicine among interventionists has led to the establishment of the concept of precision interventional radiology (PIR). This concept focuses not only on the accuracy of interventional operations using traditional image-guided techniques, but also on the comprehensive evaluation of diseases. The invisible features extracted from CT, MRI, or US improve the accuracy and specificity of diagnosis. The integration of multi-omics and molecule imaging provides more information for interventional operations. The development and application of drugs, embolic materials, and devices broaden the concept of PIR. Integrating medicine and engineering brings new image-guided techniques that increase the efficacy of interventional operations while reducing the complications of interventional treatment. In all, PIR, an important part of precision medicine, emphasizing the whole disease management process, including precision diagnosis, comprehensive evaluation, and interventional therapy, maximizes the benefits of patients with limited damage.

To explore early alterations and underlying associations of dopamine levels and microstructure in Parkinson’s Disease (PD), Shang et al use a hybrid positron emission tomography (PET)-magnetic resonance imaging (MRI) approach in early stage patients and age-matched controls. Their data implies that molecular degeneration mediates the effects of microstructural disorganization on motor dysfunction in the early stages of PD.

Necrotic enteritis (NE) is a great threat to the intestinal health of broilers, resulting in decreased growth performance and significant economic losses. Lactobacillus fermentum (LF) and Lactobacillus paracasei (LP) exert beneficial effects on intestinal health. The aim of the present study was to investigate the effects of dietary LF and LP on the intestinal health and growth performance of broilers challenged with coccidia and Clostridium perfringens (CCP). The animal trial was carried out using 336 broilers (Ross 308) for 35 days with a completely randomized design. The broilers were divided into 4 groups based on treatment as follows: the control (CTR) group was fed the basal diet and without CCP challenge and the CCP group was fed the basal diet and with CCP challenge. The broilers in the CCP+LF and CCP+LP groups were challenged by CCP, and meanwhile, LF (1 × 109 CFU/g) and LP (1 × 109 CFU/g) were supplemented into the basal diets, respectively. The results showed that the growth performance and the intestinal morphology were negatively affected by the CCP challenge. In addition, the number of coccidia in the intestinal digesta and the relative abundance of Escherichia coli in the cecal digesta were increased. Besides, the mRNA level of IgA in the jejunum was downregulated, and the transcript level of IL-8 was upregulated by the CCP challenge. Dietary LF and LP failed to improve the growth performance of broilers with the CCP challenge. However, they were beneficial for intestinal barrier function. In addition, dietary LF was able to alleviate the downregulation of TGF-β mRNA level in the spleen with CCP challenge and decreased the lesion scores compared with the CCP group. Furthermore, dietary LP alleviated the upregulation of the IL-8 mRNA level in the jejunum with CCP challenge and reduced the number of coccidia in the ileal digesta. In conclusion, dietary LF and LP failed to mitigate the negative effects of CCP infection on growth performance; however, they were able to improve the intestinal health of broilers challenged with CCP by strengthening the intestinal barrier and alleviating inflammation.

IntroductionAcute pancreatitis (AP) is an inflammatory disease with very poor outcomes. However, the order of induction and coordinated interactions of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) and the potential mechanisms in AP are still unclear.MethodsAn integrative analysis was performed based on transcripts of blood from patients with different severity levels of AP (GSE194331), as well as impaired lung (GSE151572), liver (GSE151927) and pancreas (GSE65146) samples from an AP experimental model to identify inflammatory signals and immune response-associated susceptibility genes. An AP animal model was established in wild-type (WT) mice and Tlr2-deficient mice by repeated intraperitoneal injection of cerulein. Serum lipase and amylase, pancreas impairment and neutrophil infiltration were evaluated to assess the effects of Tlr2 in vivo.ResultsThe numbers of anti-inflammatory response-related cells, such as M2 macrophages (P = 3.2 × 10–3), were increased with worsening AP progression, while the numbers of pro-inflammatory response-related cells, such as neutrophils (P = 3.0 × 10–8), also increased. Then, 10 immune-related AP susceptibility genes (SOSC3, ITGAM, CAMP, FPR1, IL1R1, TLR2, S100A8/9, HK3 and MMP9) were identified. Finally, compared with WT mice, Tlr2-deficient mice exhibited not only significantly reduced serum lipase and amylase levels after cerulein induction but also alleviated pancreatic inflammation and neutrophil accumulation.DiscussionIn summary, we discovered SIRS and CARS were stimulated in parallel, not activated consecutively. In addition, among the novel susceptibility genes, TLR2might be a novel therapeutic target that mediates dysregulation of inflammatory responses during AP progression.

A total of 480 one-day-old AA broiler chicks were randomly allocated to one of four treatments in a 2 × 2 factorial to investigate the effects of tannic acid (TA) on growth performance, relative organ weight, antioxidant capacity, and intestinal health in broilers dietary exposed to aflatoxin B1 (AFB1). Treatments were as follows: (1) CON, control diet; (2) TA, CON + 250 mg/kg TA; (3) AFB1, CON + 500 μg/kg AFB1; and (4) TA+AFB1, CON + 250 mg/kg TA + 500 μg/kg AFB1. There were 10 replicate pens with 12 broilers per replicate. Dietary AFB1 challenge increased the feed conversion ratio during days 1 to 21 (P < 0.05). The TA in the diet did not show significant effects on the growth performance of broilers during the whole experiment period (P > 0.05). The liver and kidney relative weight was increased in the AF challenge groups compared with the CON (P < 0.05). The addition of TA could alleviate the relative weight increase of liver and kidney caused by AFB1 (P < 0.05). Broilers fed the AFB1 diets had lower activity of glutathione peroxidase, catalase, total superoxide dismutase, S-transferase, and total antioxidant capacity in plasma, liver and jejunum, and greater malondialdehyde content (P < 0.05). Dietary supplemented with 250 mg/kg TA increased the activities of antioxidative enzymes, and decreased malondialdehyde content (P < 0.05). In addition, AFB1 significantly reduced the villus height and crypt depth ratio in the ileum on day 42 (P < 0.05). In conclusion, supplementation with 250 mg/kg TA could partially protect the antioxidant capacity and prevent the enlargement of liver in broilers dietary challenged with 500 μg/kg AFB1.

Porcine epidemic diarrhea virus (PEDV) has become a challenging problem in pig industry all over the world, causing significant profit losses. Tannins and organic zinc have been shown to exert protective effects on the intestinal dysfunction caused by endotoxins. However, there is little information on tannic acid-chelated zinc (TAZ) supplementation in the diet of newborn piglets. This study was conducted to determine the effects of TAZ on the intestinal function of piglets infected with PEDV. Thirty-two 7-day-old piglets were randomly allocated to 1 of 4 treatments in a 2 × 2 factorial design consisting of 2 diets (0 or 50 mg/kg BW TAZ) and challenge (saline or PEDV). On day 9 of the trial, 8 pigs per treatment received either sterile saline or PEDV solution at 106 TCID50 (50% tissue culture infectious dose) per pig. Pigs infected with PEDV had greater diarrhea rate and lower average daily gain (ADG) (P < 0.05). PEDV infection decreased plasma D-xylose concentration, most antioxidative enzyme activities in plasma and intestine, as well as the small intestinal villus height (P < 0.05). Plasma diamine oxidase and blood parameters were also affected by PEDV infection. Dietary supplementation with TAZ could ameliorate the PEDV-induced changes in all measured variables (P < 0.05). Moreover, TAZ decreased the concentration of malondialdehyde in plasma, duodenum, jejunum, and colon (P < 0.05). Collectively, our results indicated that dietary TAZ could alleviate PEDV induced damage on intestinal mucosa and antioxidative capacity, and improve the absorptive function and growth in piglets. Therefore, our novel findings also suggest that TAZ, as a new feed additive for neonatal and weaning piglets, has the potential to be an alternative to ZnO.

Abstract Background Cholangiocarcinoma represents the second most common primary liver malignancy. The incidence rate has constantly increased over the last decades. Cholangiocarcinoma silent nature limits early diagnosis and prevents efficient treatment. Methods Immunoblotting and immunohistochemistry were used to assess the expression profiling of USP9X and EGLN3 in cholangiocarcinoma patients. ShRNA was used to silence gene expression. Cell apoptosis, cell cycle, CCK8, clone formation, shRNA interference and xenograft mouse model were used to explore biological function of USP9X and EGLN3. The underlying molecular mechanism of USP9X in cholangiocarcinoma was determined by immunoblotting, co-immunoprecipitation and quantitative real time PCR (qPCR). Results Here we demonstrated that USP9X is downregulated in cholangiocarcinoma which contributes to tumorigenesis. The expression of USP9X in cholangiocarcinoma inhibited cell proliferation and colony formation in vitro as well as xenograft tumorigenicity in vivo. Clinical data demonstrated that expression levels of USP9X were positively correlated with favorable clinical outcomes. Mechanistic investigations further indicated that USP9X was involved in the deubiquitination of EGLN3, a member of 2-oxoglutarate and iron-dependent dioxygenases. USP9X elicited tumor suppressor role by preventing degradation of EGLN3. Importantly, knockdown of EGLN3 impaired USP9X-mediated suppression of proliferation. USP9X positively regulated the expression level of apoptosis pathway genes de through EGLN3 thus involved in apoptosis of cholangiocarcinoma. Conclusion These findings help to understand that USP9X alleviates the malignant potential of cholangiocarcinoma through upregulation of EGLN3. Consequently, we provide novel insight into that USP9X is a potential biomarker or serves as a therapeutic or diagnostic target for cholangiocarcinoma.

ObjectiveThe objective of the study is to investigate the feasibility of using the fractional order calculus (FROC) model to reflect tumor subtypes and histological grades of cervical carcinoma.MethodsSixty patients with untreated cervical carcinoma underwent multi-b-value diffusion-weighted imaging (DWI) at 3.0T magnetic resonance imaging (MRI). The mono-exponential and the FROC models were fitted. The differences in the histological subtypes and grades were evaluated by the Mann–Whitney U test. Receiver operating characteristic (ROC) analyses were performed to assess the diagnostic performance and to determine the best predictor for both univariate analysis and multivariate analysis. Differences between ROC curves were tested using the Hanley and McNeil test, while the sensitivity, specificity, and accuracy were compared using the McNemar test. P-value

Abstract Background In this study, we comprehensively analyzed genes related to ferroptosis and iron metabolism to construct diagnostic and prognostic models and explore the relationship with the immune microenvironment in HCC. Methods Integrated analysis, cox regression and the least absolute shrinkage and selection operator (LASSO) method of 104 ferroptosis- and iron metabolism-related genes and HCC-related RNA sequencing were performed to identify HCC-related ferroptosis and iron metabolism genes. Results Four genes (ABCB6, FLVCR1, SLC48A1 and SLC7A11) were identified to construct prognostic and diagnostic models. Poorer overall survival (OS) was exhibited in the high-risk group than that in the low-risk group in both the training cohort (P

Abstract Background Cancer cells primarily utilize aerobic glycolysis for energy production, a phenomenon known as the Warburg effect. Increased aerobic glycolysis supports cancer cell survival and rapid proliferation and predicts a poor prognosis in cancer patients. Methods Molecular profiles from The Cancer Genome Atlas (TCGA) cohort were used to analyze the prognostic value of glycolysis gene signature in human cancers. Gain- and loss-of-function studies were performed to key drivers implicated in hepatocellular carcinoma (HCC) glycolysis. The molecular mechanisms underlying Osteopontin (OPN)-mediated glycolysis were investigated by real-time qPCR, western blotting, immunohistochemistry, luciferase reporter assay, and xenograft and diethyl-nitrosamine (DEN)-induced HCC mouse models. Results Increased glycolysis predicts adverse clinical outcome in many types of human cancers, especially HCC. Then, we identified a handful of differentially expressed genes related to HCC glycolysis. Gain- and loss-of-function studies showed that OPN promotes, while SPP2, LECT2, SLC10A1, CYP3A4, HSD17B13, and IYD inhibit HCC cell glycolysis as revealed by glucose utilization, lactate production, and extracellular acidification ratio. These glycolysis-related genes exhibited significant tumor-promoting or tumor suppressive effect on HCC cells and these effects were glycolysis-dependent. Mechanistically, OPN enhanced HCC glycolysis by activating the αvβ3-NF-κB signaling. Genetic or pharmacological blockade of OPN-αvβ3 axis suppressed HCC glycolysis in xenograft tumor model and hepatocarcinogenesis induced by DEN. Conclusions Our findings reveal crucial determinants for controlling the Warburg metabolism in HCC cells and provide a new insight into the oncogenic roles of OPN in HCC. Video Abstract

Sorafenib, a multikinase inhibitor, is the first-line agent for advanced liver cancer. Sorafenib strongly inhibits both cell proliferation and tumour angiogenesis. However, the development of drug resistance hampers its anticancer efficacy. To improve the antitumour activity of sorafenib, we demonstrate that piperlongumine (PL), an alkaloid isolated from the fruits and roots of Piper longum L., enhances the cytotoxicity of sorafenib in HCCLM3 and SMMC7721 cells using the cell counting kit-8 test. Flow cytometry analysis indicated that PL and sorafenib cotreatment induced robust reactive oxygen species (ROS) generation and mitochondrial dysfunction, thereby increasing the number of apoptotic cells and the ratio of G2/M phase cells in both HCCLM3 and SMMC7721 cells. Furthermore, AMP-protein kinase (AMPK) signalling was activated by excess ROS accumulation and mediated growth inhibition in response to PL and sorafenib cotreatment. RNA-sequencing analysis indicated that PL treatment disrupted RNA processing in HCCLM3 cells. In particular, PL treatment decreased the expression of cleavage and polyadenylation specificity factor 7 (CPSF7), a subunit of cleavage factor I, in a time- and concentration-dependent manner in HCCLM3 and SMMC7721 cells. CPSF7 knockdown using a gene interference strategy promoted growth inhibition of PL or sorafenib monotherapy, whereas CPSF7 overexpression alleviated the cytotoxicity of sorafenib in cultured liver cancer cells. Finally, PL and sorafenib coadministration significantly reduced the weight and volume of HCCLM3 cell xenografts in vivo. Taken together, our data indicate that PL displays potential synergistic antitumour activity in combination with sorafenib in liver cancer.

Background: Amyloidosis cutis dyschromica (ACD) is a rare type of primary localized cutaneous amyloidosis. Non-invasive techniques can provide important clues for early diagnosis.Objectives: To highlight the characteristic imaging changes of ACD under dermoscopy and reflectance confocal microscopy (RCM), investigate gene mutations in a Chinese Han pedigree of ACD, and analyze the genotype–phenotype correlation.Methods: Dermoscopy and RCM examinations were completed together for the pedigree, and the imaging characteristics were described. The diagnosis of ACD was confirmed by pathological examination. Sequencing was performed followed by bioinformatics and genotype–phenotype correlation. ACD-related articles published on PubMed between January 1970 and March 2021 were reviewed and summarized.Results: In ACD, dermoscopy showed patchy white hypopigmentation and brownish spots, stripes, or hyperpigmented blotches and patches. RCM showed a highly refractive substance with clumpy, dotted, and linear structures inside the papillary dermis. Sequencing identified glycoprotein non-metastatic melanoma protein B (GPNMB) missense mutations [c.393T>G (p.Y131X; NM_001005340.2)] and a frameshift deletion mutation [c.719_720delTG (p.V240fs; NM_001005340.2)]. The ANNOtate VARiation (ANNOVAR) software predicted that c.393T>G is a pathogenic mutation. The literature review found 14 mutations, namely, 5 (35.7%) frameshift mutations, 4 (28.6%) non-sense mutations, 4 (28.6%) missense mutations, and 1 (7.1%) splice site mutation. Blisters and epidermolysis were observed in several cases, but there was no significant association between clinical manifestations and mutations in ACD.Conclusions: This study was the first to combine dermoscopy and RCM to describe ACD. Two GPNMB gene mutations were reported in a Chinese ACD pedigree. The genotype–phenotype correlation was analyzed for the first time; however, there was no significant correlation.

ObjectivesTo develop and validate a radiomic feature-based nomogram for preoperative discriminating the epidermal growth factor receptor (EGFR) activating mutation from wild-type EGFR in non-small cell lung cancer (NSCLC) patients.MaterialA group of 301 NSCLC patients were retrospectively reviewed. The EGFR mutation status was determined by ARMS PCR analysis. All patients underwent nonenhanced CT before surgery. Radiomic features were extracted (GE healthcare). The maximum relevance minimum redundancy (mRMR) and LASSO, were used to select features. We incorporated the independent clinical features into the radiomic feature model and formed a joint model (i.e., the radiomic feature-based nomogram). The performance of the joint model was compared with that of the other two models.ResultsIn total, 396 radiomic features were extracted. A radiomic signature model comprising 9 selected features was established for discriminating patients with EGFR-activating mutations from wild-type EGFR. The radiomic score (Radscore) in the two groups was significantly different between patients with wild-type EGFR and EGFR-activating mutations (training cohort: P

Objective: The study aims to establish an magnetic resonance imaging radiomics signature-based nomogram for predicting the progression-free survival of intermediate and advanced hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) plus radiofrequency ablationMaterials and Methods: A total of 113 intermediate and advanced HCC patients treated with TACE and RFA were eligible for this study. Patients were classified into a training cohort (n = 78 cases) and a validation cohort (n = 35 cases). Radiomics features were extracted from contrast-enhanced T1W images by analysis kit software. Dimension reduction was conducted to select optimal features using the least absolute shrinkage and selection operator (LASSO). A rad-score was calculated and used to classify the patients into high-risk and low-risk groups and further integrated into multivariate Cox analysis. Two prediction models based on radiomics signature combined with or without clinical factors and a clinical model based on clinical factors were developed. A nomogram comcined radiomics signature and clinical factors were established and the concordance index (C-index) was used for measuring discrimination ability of the model, calibration curve was used for measuring calibration ability, and decision curve and clinical impact curve are used for measuring clinical utility.Results: Eight radiomics features were selected by LASSO, and the cut-off of the Rad-score was 1.62. The C-index of the radiomics signature for PFS was 0.646 (95%: 0.582–0.71) in the training cohort and 0.669 (95% CI:0.572–0.766) in validation cohort. The median PFS of the low-risk group [30.4 (95% CI: 19.41–41.38)] months was higher than that of the high-risk group [8.1 (95% CI: 4.41–11.79)] months in the training cohort (log rank test, z = 16.58, p < 0.001) and was verified in the validation cohort. Multivariate Cox analysis showed that BCLC stage [hazard ratio (HR): 2.52, 95% CI: 1.42–4.47, p = 0.002], AFP level (HR: 2.01, 95% CI: 1.01–3.99 p = 0.046), time interval (HR: 0.48, 95% CI: 0.26–0.87, p = 0.016) and radiomics signature (HR 2.98, 95% CI: 1.60–5.51, p = 0.001) were independent prognostic factors of PFS in the training cohort. The C-index of the combined model in the training cohort was higher than that of clinical model for PFS prediction [0.722 (95% CI: 0.657–0.786) vs. 0.669 (95% CI: 0.657–0.786), p＜0.001]. Similarly, The C-index of the combined model in the validation cohort, was higher than that of clinical model [0.821 (95% CI: 0.726–0.915) vs. 0.76 (95% CI: 0.667–0.851), p = 0.004]. The calibration curve, decision curve and clinical impact curve showed that the nomogram can be used to accurately predict the PFS of patients.Conclusion: The radiomics signature was a prognostic risk factor, and a nomogram combined radiomics and clinical factors acts as a new strategy for predicted the PFS of intermediate and advanced HCC treated with TACE plus RFA.

PurposeThe goal of current study was to introduce noninvasive and reproducible MRI methods for in vivo functional assessment of lung adenocarcinoma (LUAD).MethodsForty-four patients with pathologically confirmed LUAD were included in this study. All the lesions were classified as adenocarcinoma in situ (AIS), minimally invasive adenocarcinoma (MIA), or invasive adenocarcinoma (IA). The IA lesions were further divided into five subtype patterns, including acinar, lepidic, papillary, micropapillary and solid. Tumors were grouped depending on predominant subtype: low grade (AIS, MIA or lepidic predominant), intermediate grade (papillary or acinar predominant) and high grade (micropapillary, or solid predominant). Spirometry was performed according to American Thoracic Society guidelines. For each patient, Intravoxel incoherent motion diffusion weighted imaging (IVIM-DWI) analysis and oxygen-enhanced MRI (OE-MRI) analysis were performed. Spearman’s test was used to assess the relationship between a) whole lung mean percent signal enhancement (PSE) and pulmonary function tests (PFTs) parameters; b) IVIM-derived parameters and PFTs parameters; c) tumor mean PSE and IVIM-derived parameters. Kruskal -Wallis tests were applied to test the difference of tumor mean PSE and IVIM-derived parameters between different histological tumor grades. Receiver operating characteristics (ROC) analysis was used to evaluate the diagnostic performance.ResultsWhole lung mean PSE was significantly positively correlated with PFTs parameters (r = 0.40 ~ 0.44, P < 0.05). f value derived from IVIM-DWI was significantly negatively correlated with PFTs parameters (r = -0.38 ~ -0.47, P < 0.05). Both tumor mean PSE (P = 0.030 < 0.05) and f (P = 0.022 < 0.05) could differentiate different histological grades. f was negatively correlated with tumor mean PSE (r = -0.61, P < 0.001). For the diagnostic performance, the combination of tumor mean PSE and f outperformed than using tumor mean PSE or f alone in both sensitivity and area under the ROC curve.ConclusionsThe combined measurement of OE-MRI and IVIM-DWI may serve as a promising method for the noninvasive and non-radiation evaluation of pulmonary function. Quantitative analyses achieved by OE-MRI and IVIM-DWI offer an approach of the classification of LUAD subtypes.

An amendment to this paper has been published and can be accessed via the original article.

Abstract Immunotherapy has become an emerging strategy for the treatment of cancer. Immunotherapeutic drugs have been increasing for clinical treatment. Despite significant advances in immunotherapy, the clinical application of immunotherapy for cancer patients has some challenges associated with safety and efficacy, including autoimmune reactions, cytokine release syndrome, and vascular leak syndrome. Novel strategies, particularly improved delivery strategies, including nanoparticles, scaffolds, and hydrogels, are able to effectively target tumors and/or immune cells of interest, increase the accumulation of immunotherapies within the lesion, and reduce off-target effects. Here, we briefly describe five major types of cancer immunotherapy, including their clinical status, strengths, and weaknesses. Then, we introduce novel delivery strategies, such as nanoparticle-based delivery of immunotherapy, implantable scaffolds, injectable biomaterials for immunotherapy, and matrix-binding molecular conjugates, which can improve the efficacy and safety of immunotherapies. Also, the limitations of novel delivery strategies and challenges of clinical translation are discussed.

BackgroundAn increasing number of patients with advanced non-small cell lung cancer (NSCLC) have a poor prognosis and develop progressive disease after receiving conventional treatments. In recent years, several novel therapies have been approved for later lines of therapy of previously treated NSCLC. Erlotinib, an EGFR tyrosine kinase inhibitor, was recommended as the second-line therapy for pre-treated patients. However, the use of erlotinib has been reported to represent different clinical effects and adverse effects. ObjectivesThe current study was aim to investigate the efficacy and safety of erlotinib versus chemotherapy in pre-treated patients with advanced NSCLC. MethodsElectronic databases were searched for eligible literatures updated on June 2018. Randomized-controlled trials assessing the efficacy and safety of erlotinib in pre-treated NSCLC were included, of which the main outcomes were ORR (objective response rate), PFS (progression-free survival), OS (overall survival) and AEs (adverse events). All the data were pooled with the corresponding 95% confidence interval using RevMan software. Sensitivity analyses and heterogeneity were quantitatively evaluated. ResultsA total of 11 randomized controlled trials were included in this analysis. The group of erlotinib did not achieved benefit in progression-free survival (OR = 0.61, 95%CI = 0.33–1.12, P = 0.11), overall survival (OR = 0.98, 95%CI = 0.84–1.15, P = 0.81) as well with the objective response rate (OR = 0.77, 95%CI = 0.36–1.63, P = 0.49), respectively. In the results of subgroup analysis among the patients with EGFR wild-type, there is also no significant differences in overall survival with erlotinib (OR = 0.90, 95%CI = 0.78–1.04, P = 0.15) and progression-free survival (OR = 0.33, 95%CI = 0.09–1.18, P = 0.09). The most common treatment-related adverse events in the erlotinib group is rash (OR = 5.79, 95%CI = 2.12–15.77, P = 0.0006), and neutropenia (OR = 0.02, 95%CI = 0.01–0.10, P ≤ 0.00001) is more found in the control group. In addition, fatigue (P = 0.09) and diarrhea (P = 0.52), the difference between the two groups had no statistical significance. ConclusionsThere was no significant difference noted with regard to efficacy and safety between erlotinib vs. chemotherapy as the later-line therapy for previously treated patients with NSCLC, even with subgroup patients who have wild-type EGFR tumors. While, erlotinib might increase the risk of rash, and decrease the risk of neutropenia, compared with the chemotherapy. Further research is needed to develop a database of all EGFR mutations and their individual impact on the differing treatments.

Colorectal cancer (CRC) is one of the most common malignancies, giving rise to serious financial burden globally. This study was designed to explore the potential mechanisms implicated with CRC and identify some key biomarkers. CRC-associated gene expression dataset (GSE32323) was downloaded from GEO database. The differentially expressed genes (DEGs) were selected out based on the GEO2R tool. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were employed to search the enriched pathways of these DEGs. Additionally, a protein-protein interaction (PPI) network was also constructed to visualize interactions between these DEGs. Quantitative Real-time PCR (qPCR) was further performed to valid the top5 up-regulated and top5 down-regulated genes in patients with CRC. Finally, the survival analysis of the top5 up-regulated and top5 down-regulated genes was conducted using GEPIA, aiming to clarify their potential effects on CRC. In this study, a total of 451 DEGs were captured (306 down-regulated genes and 145 up-regulated genes). Among these DEGs, the top5 up-regulated genes were DPEP1, KRT23, CLDN1, LGR5 and FOXQ1 while the top5 down-regulated genes were CLCA4, ZG16, SLC4A4, ADH1B and GCG. GO analysis revealed that these DEGs were mainly enriched in cell adhesion, cell proliferation, RNA polymerase Ⅱ promoter and chemokine activity. KEGG analysis disclosed that the enriched pathway included mineral absorption, chemokine signaling pathway, transcriptional misregulation in cancer, pathways in cancer and PPAR signaling pathway. Survival analysis showed that the expression level of ZG16 may correlate with the prognosis of CRC patients. Furthermore, according to the connectivity degree of these DEGs, we selected out the top15 hub genes, namely MYC, CXCR1, TOP2A, CXCL12, SST, TIMP1, SPP1, PPBP, CDK1, THBS1, CXCL1, PYY, LPAR1, BMP2 and MMP3, which were expected to be promising therapeutic target in CRC. Collectively, our analysis unveiled potential biomarkers and candidate targets in CRC, which could be helpful to the diagnosis and treatment of CRC.

Cholangiocarcinomas (CCA) are biliary tract tumors that are often challenging to diagnosis and treatment. Accumulated evidence reveals that circular RNAs (circRNAs) are involved in multiple cancer progression. However, the function of circRNAs in cholangiocarcinoma remains largely unclear. In this study, we found that circ_0021205 expression was up-regulated in CCA and positively correlated with tumor size and TNM stage. To further explore the role of circ_0021205 in CCA, cell functional assays were performed. The results showed that circ_0021205 promoted the proliferation, migration, and invasion of CCA cells. In vivo experiments showed that circ_0021205 inhibition reduced tumorigenesis in mice. In addition, mechanisms investigation demonstrated that circ_0021205 exerts its oncogenic function by sponging miR-204-5p to regulate the expression of RAB22A. Overall, this study revealed that circ_0021205 might serve as a potential diagnostic biomarker or therapeutic target for CCA.

In view of the unsatisfactory treatment outcome of liver cancer under current treatment, where the mortality rate is high and the survival rate is poor, in this study we aimed to use RNA sequencing data to explore potential molecular markers that can be more effective in predicting diagnosis and prognosis of hepatocellular carcinoma. RNA sequencing data and corresponding clinical information were obtained from multiple databases. After matching with the apoptotic genes from the Deathbase database, 14 differentially expressed human apoptosis genes were obtained. Using univariate and multivariate Cox regression analyses, two apoptosis genes (BAK1 and CSE1L) were determined to be closely associated with overall survival (OS) in HCC patients. And subsequently experiments also validated that knockdown of BAK1 and CSE1L significantly inhibited cell proliferation and promoted apoptosis in the HCC. Then the two genes were used to construct a prognostic signature and diagnostic models. The high-risk group showed lower OS time compared to low-risk group in the TCGA cohort (P < 0.001, HR = 2.11), GSE14520 cohort (P = 0.003, HR = 1.85), and ICGC cohort (P < 0.001, HR = 4). And the advanced HCC patients showed higher risk score and worse prognosis compared to early-stage HCC patients. Moreover, the prognostic signature was validated to be an independent prognostic factor. The diagnostic models accurately predicted HCC from normal tissues and dysplastic nodules in the training and validation cohort. These results indicated that the two apoptosis-related signature effectively predicted diagnosis and prognosis of HCC and may serve as a potential biomarker and therapeutic target for HCC.

Purpose: The study aims to retrospectively investigate the efficacy and safety of sorafenib combined with transarterial chemoembolization (TACE) (TACE+Sor) vs. TACE combined with sorafenib plus immune checkpoint inhibitors (TACE+Sor+ICIs) in treating intermediate and advanced TACE-refractory hepatocellular carcinoma (HCC).Materials and Methods: This study was approved by the ethics committee of Lisui Hospital, Zhejiang University, China. From January 2016 to June 2020, 51 eligible patients with intermediate or advanced TACE-refractory HCC received TACE+Sor (n = 29) or TACE+Sor+ICIs (n = 22). The differences in tumor response, adverse events (AEs), progression-free survival (PFS), and overall survival (OS) were compared between the two groups. Factors affecting PFS and OS were determined by Cox regression.Results: The disease control rate was higher in the TACE+Sor+ICIs group than in the TACE+Sor group (81.82 vs. 55.17%, P = 0.046). Compared with the TACE+Sor group, PFS and OS were prolonged in the TACE+Sor+ICIs group (median PFS: 16.26 vs. 7.30 months, P < 0.001; median OS: 23.3 vs. 13.8 months, P = 0.012). Multivariate analysis showed that BCLC stage, alpha-fetoprotein and treatment were independent factors of PFS; BCLC, Child-Pugh class, ablation after disease progression and treatment were independent predictive factors of OS. Four patients in the TACE+Sor+ICIs group and three patients in the TACE+Sor group suffered from dose reduction or interruption (18.18 vs. 10.34%, P = 0.421). The incidence of ICI-related AEs in the TACE+Sor+ICIs group was well-controlled.Conclusion: The therapeutic schedule of TACE+Sor+ICIs demonstrated efficacy and safety in intermediate and advanced TACE-refractory HCC.

The dermoscopy and reflectance confocal microscopy (RCM) can provide new insights for diagnosis disease as non-invasive and easy-to-use tool. We described the dermoscopy and RCM characteristics of two patients with primary cutaneous amyloidosis (PCA) respectively. The dermoscopy characteristics were as follows: brownish macules with brown or white centers surrounded by hyperpigmented blotches, and a whitish scar-like center encircled by irregular brownish hyperpigmented spots or patches. The RCM features were increased melanin deposition in the basal layer, highly refractive structures with various shapes in the enlarged papillary dermis, and the increased pleomorphic structure of the dermal papillary ring. This is the first report the dermoscopy and RCM characteristics of PCA. We hope the characteristic dermoscopy and RCM appearances would provide a basis for doctors to diagnose and intervene earlier.

LncRNAs can act crucial roles in multiple tumors including cholangiocarcinoma (CCA). M2 polarization of macrophages is crucial for their biological roles in immunologic tolerance, which is able to induce tumorigenesis. Given that increasing evidence have suggested that lncRNAs could participate in modulating immune cell differentiation and function. Our current study was aimed to identify the underlying mechanism of lncRNA prostate cancer-associated transcript 6 (PCAT6) in CCA progression via regulating M2 macrophage polarization. PCAT6 has been reported as an oncogene in many cancers. In our work, we observed increased expression of PCAT6 in CCA patients. PCAT6 expression in various types of immune cells derived from CCA patients was tested by quantitative real-time PCR (qRT-PCR). It was revealed that PCAT6 was highly expressed in macrophages, which indicated that PCAT6 might regulate the function of macrophages to promote CCA progression. Then, via establishing CCA xenograft mouse model, we found loss of PCAT6 obviously triggered the immune response and reduced the in vivo tumor growth. In addition, overexpression of PCAT6 led to the M2 polarization of THP-1-differentiated macrophages. Moreover, miR-326 was predicted and proved as a target for PCAT6. In addition, down-regulation of PCAT6 repressed M2 polarization of macrophages, which was reversed by miR-326 inhibitors. The increase of PCAT6 induced the accumulation of ROS, mitochondrial and metabolic dysfunction in macrophages and mimics of miR-326 exhibited an opposite process. RohA has been recognized as a significant regulator of immune cell function. In our current work, we observed that RohA function as a downstream target for miR-326. In conclusion, our study highlighted a significant role of PCAT6/miR-326/RohA in immune response of macrophages in CCA and indicated PCAT6 as a potential target of immunotherapy in CCA.

Anodization is performed on the Ti-30Zr-5Al-3V (TZ30) alloy to improve its surface performance. X-ray diffractometer (XRD), scanning electron microscopy (SEM), and Olympus microscope are used to determine the phase constitution, morphology, and thickness of the anodization film (AOF). Tribological tests and electrochemical corrosion experiments are carried out to measure, respectively, the wear behavior and corrosion resistance of AOFs in simulated body fluid (SBF) solution. The microstructure characteristic of the AOF anodized at low voltage (20 V) is composed of compact and loose regions. As the applied voltage increases to 60 V, the compact regions transform progressively into loose regions, and then grow into nanotube regions. Besides, an increase in thickness of the AOF from 8.6 ± 4.61 μm to 20.7 ± 2.18 μm, and a gradual increase in surface microhardness from 364.6 ± 14.4 HV to 818.4 ± 19.3 HV, are also exhibited as the applied voltage increases from 20 V to 60 V. Specimens anodized at 40 V and 60 V have a low friction coefficient (~0.15) and wear rate (~2.2 mg/N/m) in the SBF solution. The enhanced wearability originates from the high hardness and various wear mechanisms. Potentiodynamic polarization curves suggest that the corrosion resistance in the SBF solution of all anodized specimens is greatly improved, thanks to the protection from the anodized TiO2 film.

Inflammatory bowel disease (IBD), which includes ulcerative colitis (UC) and Crohn’s disease (CD), is a group of chronic and incurable inflammatory diseases involving the gastrointestinal tract. In this study, we investigated the anti-inflammatory effects of triptolide in a dextran sulfate sodium (DSS)-induced mouse colitis model and LPS-activated macrophages and explored the specific molecular mechanism(s). In mice, triptolide treatment showed significant relief and protection against colitis, and it markedly reduced the inflammatory responses of human monocytes and mouse macrophages. Pharmacological analysis and weighted gene co-expression network analysis (WGCNA) suggested that PDE4B may be an important potential targeting molecule for IBD. Exploration of the specific mechanism of action indicated that triptolide reduced the production of ROS, inhibited macrophage infiltration and M1-type polarization by activating the NRF2/HO-1 signaling pathway, and inhibited the PDE4B/AKT/NF-κB signaling cascade, which may help weaken the intestinal inflammatory response. Our findings laid a theoretical foundation for triptolide as a treatment for IBD and revealed PDE4B as a target molecule, thus providing new ideas for the treatment of IBD.

The modification level of the transcript N6-methyladenosine (m6A), dynamically regulated by methyltransferases, binding proteins and demethylases, is closely related to the occurrence, and progression of tumors. Here, 13 differentially expressed m6A methylation regulators were confirmed in 374 hepatocellular carcinoma (HCC) patients, among which RBM15, YTHDC1, YTHDF1, and YTHDF2 were significantly variant in different stages and grades. Further consensus clustering analysis identified two HCC subtypes (cluster1/2) in this cohort, finding an active role of the m6A methylation regulators in the malignant progression of HCC. Furthermore, GESA enrichment analysis showed that PPAR signaling pathway, and the pathways involved in retinol metabolism and peroxisome were related to tumor progression. Additionally, a 4-gene risk model (ROC = 0.729) that can be used as a prognostic marker and a predictor for clinicopathological characteristics of HCC was constructed via univariate and multivariate Cox regression analyses. Analysis on overall survival and disease-free survival demonstrated that METTL3 and YTHDF1 out of the four genes in the model could serve as independent prognostic factors for HCC. Overall, this study systematically investigated the effect of m6A methylation regulators on the malignant progression of HCC and proposed a 4-gene risk prediction model, laying a theoretical foundation for the further research on HCC prognosis.

BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

Epidermolytic palmoplantar keratoderma (EPPK, OMIM 144200) is an autosomal dominant inherited disease, clinically characterized by diffuse yellowish thickening of the skin on the palms and soles, usually with erythematous borders developing during the first weeks or months after birth. Pathogenesis of EPPK is determined by mutations in the keratin gene (KRT9). Thirty three mutations in the KRT9 gene from 100 EPPK families have been identified. Among these, 23 mutations are located in the 1A region (a mutation hot spot region), 7 are located in the 2B region, and the remaining 3 are synonymous mutations. In this study, three heterozygous mutations (p.N161S, p.R163W, and p.R163Q), located in regions of the gene encoding the conserved central a-helix rod domain, were detected in the KRT9 gene of the three large Chinese families. This study confirms that codon 163 (48 of 100 cases) is a hot spot mutation site for KRT9. Additional findings identified p.N161S (4%) and p.R163W (4%) as potential hot spot mutations for EPPK associated with knuckle pads, and p.R163Q (15 of 100 cases) as the hot spot mutation of EPPK not occurring in combination with knuckle pads. In conjunction with future studies, this research may help lay the foundation for genetics counseling, prenatal diagnosis and clinical treatment of EPPK.

Objective: To identify and compare the bacterial community profile of mucosal tissues from a gastric antrum ulcer and a duodenal ulcer in Helicobacter pylori (Hp) positive dyspeptic patients.Methods: Genomic DNA was extracted from the mucosal tissues obtained from 18 patients diagnosed with gastric antrum or duodenal ulcers. A library was constructed using 16S rRNA gene amplification, and Miseq high-throughput sequencing was used to analyse the amplified products. Bioinformatics methods, including operational taxonomic units (OTUs), hierarchical clustering, and a diversity analysis, were performed to investigate and characterize the community composition.Results: The proportion of Helicobacter in the mucosa of patients with a gastric antrum ulcer was significantly higher than that of patients with a duodenal ulcer. However, the diversity of the bacterial community in the gastric antrum ulcer mucosa was significantly lower compared with the mucosa of the duodenal ulcer. There were significant differences in microbial community structure between the gastric antrum ulcer and the duodenal ulcer. Notably, Helicobacter, Prevotella, Neisseria, and Streptococcus were also predominant genera in the bacterial community of the duodenal ulcer mucosa, and they outnumbered those species in gastric antrum ulcer mucosa.Conclusion: The bacterial community composition and the corresponding abundance differ between the mucosal tissues of Hp positive gastric antrum ulcer and duodenal ulcer patients. Additionally, the bacterial community diversity in the mucosal tissues from gastric duodenal ulcer patients is higher than that from gastric antrum ulcer patients, and Helicobacter is not the absolutely predominant genus.

Abstract.: A novel codrug, α-DDB-FNCG, was synthesized through coupling of α-biphenyl dimethyl dicarboxylate (α-DDB) and the nucleoside analogue FNCG, via an ester bond. The anti-HBV activity and hepatoprotective effects of this compound were investigated both in vitro and in vivo. In HBV-transfected HepG2.2.15 cell line, the secretion of HBsAg and HBeAg as well as the levels of extracellular and intracellular viral DNA were determined by ELISA and real-time fluorescent quantitative Polymerase Chain Reaction (FQ-PCR), respectively. In DHBV-infected ducks, the viral DNA levels in serum and liver were determined by FQ-PCR. In addition, the levels of alanine transaminase (ALT) and aspartate aminotransferase (AST) in both serum and liver were also examined. The improvement of ducks’ livers was evaluated by histopathological analysis. It has been demonstrated that α-DDB-FNCG could suppress the levels of HBV antigens and viral DNA in a time- and dose-dependent manner in the HepG2.2.15 cell line. Furthermore, this codrug could also significantly inhibit the viral DNA replication and reduce the ALT and AST levels in both serum and liver of DHBV-infected ducks, with improved hepatocellular architecture in drug-treated ducks. In short, these results suggest that α-DDB-FNCG could be a promising candidate for further development of new anti-HBV agents with hepatoprotective effects. Keywords:: α-DDB-FNCG, hepatitis B virus, duck hepatitis B virus, hepatoprotective effect

BACKGROUND:Thoracic computed tomography (CT) scans are widely performed in clinical practice, often leading to detection of airway or parenchymal abnormalities in asymptomatic or minimally symptomatic individuals. However, clinical relevance of CT abnormalities is uncertain in the general population. METHODS:We evaluated data from 1361 participants aged ≥40 years from a Canadian prospective cohort comprising 408 healthy never-smokers, 502 healthy ever-smokers, and 451 individuals with spirometric evidence of chronic obstructive pulmonary disease (COPD) who had thoracic CT scans. CT images of subjects were visually scored for respiratory bronchiolitis(RB), emphysema(E), bronchial-wall thickening(BWT), expiratory air-trapping(AT), and bronchiectasis(B). Multivariable logistic regression models were used to assess associations of CT features with respiratory symptoms, dyspnea, health status as determined by COPD assessment test, and risk of clinically significant exacerbations during 12 months follow-up. RESULTS:About 11% of life-time never-smokers demonstrated emphysema on CT scans. Prevalence increased to 30% among smokers with normal lung function and 36%, 50%, and 57% among individuals with mild, moderate or severe/very severe COPD, respectively. Presence of emphysema on CT was associated with chronic cough (OR,2.11; 95%CI,1.4-3.18); chronic phlegm production (OR,1.87; 95% CI,1.27-2.76); wheeze (OR,1.61; 95% CI,1.05-2.48); dyspnoea (OR,2.90; 95% CI,1.41-5.98); CAT score≥10(OR,2.17; 95%CI,1.42-3.30) and risk of ≥2 exacerbations over 12 months (OR,2.17; 95% CI, 1.42-3.0). CONCLUSIONS:Burden of thoracic CT abnormalities is high among Canadians ≥40 years of age, including never-smokers and smokers with normal lung function. Detection of emphysema on CT scans is associated with pulmonary symptoms and increased risk of exacerbations, independent of smoking or lung function.