74 results on '"Maltseva T"'
Search Results
2. Electrocatalytic and Corrosion Properties of CoWRe Alloys Electrodeposited from a Citrate-Pyrophosphate Electrolyte.
- Author
-
Yapontseva, Yu. S., Maltseva, T. V., and Kublanovsky, V. S.
- Subjects
ELECTROLYTE solutions ,TERNARY alloys ,LEAD alloys ,CORROSION resistance ,ALKALINE solutions - Abstract
This work presents studies of the electrocatalytic properties of ternary CoWRe alloys during the hydrogen-evolution reaction in KOH solution and their corrosion properties in KOH, H
2 SO4 and NaCl solutions. These alloys are electrodeposited from a citrate-pyrophosphate electrolyte with potassium-perrhenate concentrations of 0.01, 0.03, and 0.05 mol⋅l−1 . As shown, the use of such alloys makes it possible to increase the exchange current density by an order of magnitude and reduce the hydrogen overvoltage by 150 mV compared to electrolytic cobalt. An increase in the content of rhenium in the alloy leads to an increase in the overvoltage of hydrogen evolution in alkaline solutions: both in the KOH solution and in the electrolyte for the deposition of the alloy that explains the high current efficiency when obtaining alloys’ coatings. As shown, the highest corrosion resistance of such coatings with the ratio Re:W = 2:4 reaches 8.9 kΩ⋅cm² in NaCl solution, and in KOH solution, it is of 3.1 kΩ⋅cm², and corrosion resistance increases in time. [ABSTRACT FROM AUTHOR]- Published
- 2024
- Full Text
- View/download PDF
3. Composite anion-exchangers modified with nanoparticles of hydrated oxides of multivalent metals
- Author
-
Maltseva, T. V., Kolomiets, E. O., Dzyazko, Yu. S., and Scherbakov, S.
- Published
- 2019
- Full Text
- View/download PDF
4. Investigating trititrigia cultivation in a semiarid zone
- Author
-
Lachuga, Yu. F., primary, Meskhi, B. Ch., additional, Pakhomov, V. I., additional, Semenikhina, Yu. A., additional, Kambulov, S. I., additional, Rudoy, D. V., additional, and Maltseva, T. A., additional
- Published
- 2023
- Full Text
- View/download PDF
5. The Poems 'Horror and Delights of the Grave' by L. G. Kosegarten and 'Cemetery' by N. M. Karamzin: from Religious Didactics to Elegy
- Author
-
Maltseva, T. V. and Shadeko, V. P.
- Subjects
КАРАМЗИН Н. М ,KOSEGARTEN L. G ,РЕЛИГИОЗНО-ДИДАКТИЧЕСКАЯ ПОЭЗИЯ ,TOPOS “GRAVE” ,ЭЛЕГИЯ ,KARAMZIN N. M ,ELEGY ,RELIGIOUS DIDACTIC POETRY ,ТОПОС «МОГИЛА» ,КОЗЕГАРТЕН Л. Г - Abstract
Статья поступила в редакцию 30.11.2021 г. В статье впервые проводится сравнительный анализ стихотворения Н. М. Карамзина «Кладбище» и стихотворения немецкого поэта Л. Г. Козегартена «Ужасы и прелести могилы», которое послужило основой для переложения Карамзина. В ходе исследования отмечены изменения, которые внес Карамзин, определено содержание топоса могилы в каждом стихотворении и установлены жанровые доминанты обоих стихотворений. Делается вывод, что в стихотворении «Кладбище» Н. М. Карамзина уже присутствуют элегические мотивы и его следует рассматривать в контексте развития жанра элегии. The article deals with two poems, “Cemetery” by N. M. Karamzin and “Horror and Delights of the Grave” by L. G. Kosergarten, the latter one served as a basis for the Karamzin’s arrangement. In the article comparative analysis of these two poems is given for the first time. The research deals with changes made by Karamzin, determines topos “the grave” and sets genre features for both poems. It’s shown that in Karamzin’s “Cementery” elegiac motifs can be found and therefore it can be studied in the context of the development of the elegy genre.
- Published
- 2022
6. Investigation of the influence of the properties of the pressed material on the energy consumption and design parameters of the oil press
- Author
-
Maltseva, T, primary and Olshevskaia, A, additional
- Published
- 2021
- Full Text
- View/download PDF
7. DEPRESSION AND COGNITIVE DISORDERS IN POST-STROKE PATIENTS
- Author
-
Petrova, Elena, Nesterenko, E., Bofanova, N., and Maltseva, T.
- Published
- 2021
8. Consolidation of water-saturated viscoelastic subgrade
- Author
-
Maltseva Tatyana, Nabokov Alexander, and Vatin Nikolai
- Subjects
weak soils ,water-saturated foundation ,stresses and deformations ,soil viscoelasticity ,consolidation ,Engineering (General). Civil engineering (General) ,TA1-2040 - Abstract
The stress-strain state of the foundations of buildings and structures made of weak viscoelastic soils is considered. The mechanical characteristics of a viscoelastic water-saturated soil base were determined experimentally. A macro sample of soil in a pipe about 1 m high had a water lock on top to create excess pore pressure in the sample. Excessive pore pressure simulated the depth of the sample from the surface. From the experiment, the universal parameter of the kinematic model was determined, and the foundation was calculated. Theoretical data obtained within the framework of a kinematic model considering the viscoelastic properties of the soil are compared with the known Flamant solution and experimental data for a stabilized state of the soil. The deviation of vertical displacements from experimental data is no more than 4 % (one-dimensional case). The deviation of the theoretical solution of the flat Flamant-type problem (considering residual pore pressures) from the known solution of the Flamant problem is 16 %. The proposed calculation method makes it possible to predict the deformation of foundations made of water-saturated viscoelastic soils more accurately than the solution for elastic and elastoplastic soils without the influence of pore pressure. The technique is novel because it allows one to simultaneously consider the soil's residual pore pressures and the soil's viscoelasticity.
- Published
- 2024
- Full Text
- View/download PDF
9. Possibility of achieving and maintaining asthma control in patients with bronchial cold hyperreactivity
- Author
-
Kolosov, V. P., Pirogov, A. B., Juliy Perelman, Maltseva, T. A., and Prikhodko, A. G.
- Subjects
wintertime ,bronchial cold hyperreactivity ,pattern of inflammation ,induced sputum ,lcsh:R ,lcsh:Medicine ,asthma ,inhaled corticosteroids ,controllable course - Abstract
AIM: To evaluate the clinical efficiency of tactics to widen the scope of monotherapy with inhaled glucocorticosteroids (IGCS) in asthmatic patients with bronchial cold hyperreactivity (BCHR) during winter to achieve control of the disease in real clinical practice/MATERIAL AND METHODS: An open-label longitudinal study was conducted in a cold period in 106 asthmatics divided into 2 groups: 1) those with BCHR and 2) those with unchanged bronchial reactivity to a cold stimulus. The study involved monitoring the symptoms by the asthma control test, peak expiratory flow rate (PEFR), and spirometry results before and after cold bronchoprovocation testing; assessment of the pattern of bronchial inflammation from the ratios of induced sputum (IS) cell populations; and estimation of the number of asthma exacerbations and emergency care recourses. Group 1 used a stepwise increase of the scope of basic therapy with beclomethasone dipropionate 1000 µg/day until asthma control was achieved, which was followed by the therapy with the stable dose. Group 2 received monotherapy with beclomethasone dipropionate as the stable dosage of ≥500 µg/day/RESULTS: After the first 12 weeks of a follow-up, Group 1 showed the most marked positive changes in the intensity of clinical symptoms, forced expiratory volume in one second, and PEFR that remained within the following 12 weeks during the continued therapy with the stable dose of the drug. A preponderance of the eosinophilic and neutrophilic pattern of inflammation was seen in the patients of this group. By the end of the study, there was a decline in the number of IS inflammatory cells. A discriminant model was developed as a tool to predict asthma control achievement in patients with BCHR/CONCLUSION: A stepwise increase in the scope of IGCS monotherapy in asthmatic patients with BCHR during winter can yield the results of disease control and the incidence of exacerbations, which are similar to those seen in asthmatics with no signs of BCHR (53 and 49%, respectively).
- Published
- 2014
10. Composite anion-exchangers modified with nanoparticles of hydrated oxides of multivalent metals
- Author
-
Maltseva, T. V., primary, Kolomiets, E. O., additional, Dzyazko, Yu. S., additional, and Scherbakov, S., additional
- Published
- 2018
- Full Text
- View/download PDF
11. ADSORPTION OF ARSENIC, CHROMIUM, LEAD, CADMIUM BY ADSORBENTS ON THE BASIS OF Zr(IV), Ti(IV), Sn(IV), Al(III), Fe(III) OXIDES
- Author
-
Kolomiets, Ye. O.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Kudelko, E. О.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Maltseva, T. V.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Vasilyuk, S. L.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Dzyazko, Yu. S.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Kolomiets, Ye. O.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Kudelko, E. О.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Maltseva, T. V.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, Vasilyuk, S. L.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142, and Dzyazko, Yu. S.; Vernadsky Institute of General and Inorganic Chemistry of National Academy of Sciences of Ukraine, Kiev-142
- Abstract
It was studied sorption of As (V), Cr (VI), Cu (II), Cd (II), Pb (II) ions by inorganic and organic-inorganic ionites based on hydrated oxides of Zr (IV), Ti (IV), Sn ( IV), Al (III), Fe (III) from isotherms of sorption and values of the distribution coefficients are calculated. High selectivity of oxides was observed in the presence of singly charged competing ions. It was found that in the case of the use of Zr (IV), Ti (IV), Sn (IV) oxyhydrates as a hybrid ionite in the composition, regeneration of 0.1 M with NaOH results in a 70-80% reduction in the absorptivity. The use of Fe (III) oxide as adsorbent leads to formation of intraspheric complexes. In this case, regeneration of ion-exchange adsorbents is difficult and requires higher concentrations of regenerating reagents and/or energy inputs., Изучена адсорбция ионов As(V), Cr(VI), Cu(II), Cd(II), Pb(II) неорганическими и органо-неорганическими адсорбентами на основе гидратированных оксидов Zr(IV), Ti(IV), Sn(IV), Al(III), Fe(III) и рассчитаны величины коэффициента распределения. Обнаружена высокая избирательность оксидов и органо-неорганических адсорбентов в присутствии однозарядных конкурирующих ионов. Найдено, что в случае применения в составе органо-неорганических адсорбентов оксидов Zr(IV), Ti(IV), Sn(IV) адсорбат образует с поверхностью внешнесферные комплексы. Применение в качестве неорганической компоненты адсорбента оксида Fe(III) приводит к образованию внутрисферных комплексов. В этом случае регенерация ионообменных адсорбентов затруднена и для нее требуются более высокие концентрации регенерирующих реагентов и/или энергозатраты., Вивчено адсорбцію іонів As (V), Cr (VI), Cu (II), Cd (II), Pb (II) неорганічними та органо-неорганічними адсорбентами на основі гідратованих оксидів Zr (IV), Ti (IV), Sn (IV), Al (III), Fe (III) і розраховані величини коефіцієнтів розподілу. Введення індивідуальних та подвійних оксигідратів Zr (IV), Ti (IV), Sn (IV), Fe (III) у органічні іоніти призводить до збільшення сорбційної здатності відносно Pb2+, CrO4-, HAsO42- іони та зменшення відносно іонів Cu2+. Виявлена висока селективність оксидів і органо-неорганічних адсорбентів у присутності однозарядних конкуруючих іонів. Показана можливість позитивного впливу на величину сорбційної ємності органічних аніонообмінників щодо HAsO42- в умовах присутності конкуруючих нітрат-іонів шляхом додавання селективного полівалентного оксигідрату металу. Результати досліджень в двокомпонентних модельних розчинах підтверджують відсутність селективності в органічних іонітах та досить високу селективність неорганічних сорбентів та органо-неорганічних іонообмінників. Здатність до регенерації органо-неорганічних сорбентів порівнянна і навіть вища, ніж у органічних смол. При відносно невеликій кількості введеного неорганічного компонента відбувається відновлення до 70-80% ємності, що дозволяє прогнозувати їх ефективне використання в режимах багатоступеневої експлуатації. Регенеруємість органо-неорганічних сорбентів, що містять лише оксид заліза в аналогічних умовах, близька до нуля. У цьому випадку регенерація іонообмінних адсорбентів є складною і вимагає більшої концентрації регенеруючих реагентів (під час хімічної регенерації) та / або споживання енергії (з термічною або електрохімічною регенерацією). Знайдено, що в разі застосування в складі органо-неорганічних адсорбентів гідратованих оксидів Zr (IV), Ti (IV), Sn (IV) адсорбат утворює з поверхнею зовнішньосферні комплекси. Застосування в якості неорганічного компоненту адсорбенту оксиду Fe (III) призводить до утворення внутрішньосферних комплексів. У цьому випадку регенерація іоноо
- Published
- 2018
12. Bearing capacity of frame-gantry pile foundations
- Author
-
Maltseva Tatyana, Bai Vladimir, Erenchinov Sergey, Esipov Andrey, and Chumanova Natalya
- Subjects
experimental flume ,clay soil ,of wedge-shaped piles ,frame-gantry piles ,the benchmarks using a special template ,the deflectometers for measuring settlement ,bases ,foundations ,Engineering (General). Civil engineering (General) ,TA1-2040 - Abstract
The object of the study is frame-gantry pile foundations embedded in the soil base. To improve the strength of weak soil base, various methods of reinforcement are used, including the foundation constructions in the form of wedge-shaped piles. The paper deals with laboratory studies of the soil base during the installation of small-scale wedge-shaped piles at different angle. The process of soil shearing under the influence of the loads is registered by deformation control benchmarks arranged in the form of a square grid. The interaction between the soil and the frame-gantry foundations appears in a change of the physical and mechanical characteristics in the near pile area. The tests revealed that when piles are installed at the angle of 30° the bearing capacity of the foundation increased. The average density in the fixed active zone of the soil area increased by 12 %, and the average porosity coefficient decreased by 20 %. The deformation modulus changed by 1.8–2.3 times. The angle of internal friction remained virtually unchanged.
- Published
- 2023
- Full Text
- View/download PDF
13. Metalinguistic operators as markers of harmonization of verbal communication
- Author
-
Maltseva, T. V., Вепрева, И. Т., Vepreva, I. T., УрФУ. Институт гуманитарных наук и искусств, and Кафедра риторики и стилистики русского языка
- Subjects
МЕТАЯЗЫКОВОЕ ВЫСКАЗЫВАНИЕ ,ДИСФЕМИЗМ ,МЕТАЯЗЫКОВАЯ РЕФЛЕКСИЯ ,ГАРМОНИЗАЦИЯ РЕЧЕВОГО ОБЩЕНИЯ ,EUPHEMISM ,HARMONIZATION OF VERBAL COMMUNICATION ,МАГИСТЕРСКАЯ ДИССЕРТАЦИЯ ,MASTER'S THESIS ,DYSPHEMISM ,METALINGUISTIC REFLECTION ,METALINGUISTIC UTTERANCES ,ЭВФЕМИЗМ - Abstract
Магистерская диссертация посвящена изучению гармонизации речевого общения. При возникновении сложностей в речевом общении, когда взаимодействие адресата и адресанта переходит в зону конфликтной коммуникации, функцию гармонизации речи нередко выполняет метаязыковая рефлексия. Цель диссертации – выявление метаязыковых операторов, гармонизирующих общение, указывающих на единицы, которые способствуют либо смягчению, либо огрублению информации. Master thesis is devoted to the study of harmonization of verbal communication. If you experience difficulties in speech communication, when the interaction of the addressee and the addresser transferred to the zone of conflict communication, the function of harmonization of speech often performs metalinguistic reflection. The purpose of the thesis is to identify metalinguistic statements that harmonize the communication and indicate units, which contribute to either mitigation, or hard information.
- Published
- 2017
14. THE TECHNOLOGY OF OBTAINING HIGH-STRENGTH BILLET OF LARGE CROSS SECTIONS FOR ELASTIC ELEMENTS OF METASTABLE AUSTENITIC STEEL
- Author
-
Levina, A. V., Vakhonina, K. D., Ozerets, N. N., Maltseva, T. V., and Maltseva, L. A.
- Subjects
ЛЕГИРОВАНИЕ ,THERMAL ANALYSIS ,АУСТЕНИТ ,МЕХАНИЧЕСКИЕ СВОЙСТВА ,AUSTENITE ,HIGH STRENGTH ,ВЫСОКАЯ ПРОЧНОСТЬ ,ALLOYING ,УПРОЧНЕНИЕ ,HARDENING ,MECHANICAL PROPERTIES - Abstract
В работе изучено влияние комбинированной деформационной обработки, сочетающей в себе равноканальное угловое прессование с последующим формоизменением (волочением) до нужного типоразмера, на эволюцию структуры и механические свойства метастабильной аустенитной стали. The authors studied the effect of combined deformation processing, which combines equal channel angular pressing with subsequent forming (drawing) to the desired size, structure evolution and mechanical properties of metastable austenitic steel. Работа выполнена при финансовой поддержке постановления № 211 Правительства Российской Федерации, контракт № 02.A03.21.0006 и НИР № 2014/236 на выполнение Госработ в сфере научной деятельности в рамках базовой части Госзадания № 2480 Минобрнауки РФ.
- Published
- 2016
15. Метаязыковые операторы как маркеры гармонизации речевого общения : магистерская диссертация
- Author
-
Вепрева, И. Т., Vepreva, I. T., УрФУ. Институт гуманитарных наук и искусств, Кафедра риторики и стилистики русского языка, Мальцева, Т. В., Maltseva, T. V., Вепрева, И. Т., Vepreva, I. T., УрФУ. Институт гуманитарных наук и искусств, Кафедра риторики и стилистики русского языка, Мальцева, Т. В., and Maltseva, T. V.
- Abstract
Магистерская диссертация посвящена изучению гармонизации речевого общения. При возникновении сложностей в речевом общении, когда взаимодействие адресата и адресанта переходит в зону конфликтной коммуникации, функцию гармонизации речи нередко выполняет метаязыковая рефлексия. Цель диссертации – выявление метаязыковых операторов, гармонизирующих общение, указывающих на единицы, которые способствуют либо смягчению, либо огрублению информации., Master thesis is devoted to the study of harmonization of verbal communication. If you experience difficulties in speech communication, when the interaction of the addressee and the addresser transferred to the zone of conflict communication, the function of harmonization of speech often performs metalinguistic reflection. The purpose of the thesis is to identify metalinguistic statements that harmonize the communication and indicate units, which contribute to either mitigation, or hard information.
- Published
- 2017
16. Технология получения высокопрочной заготовки больших сечений для упругих элементов из метастабильной аустенитной стали
- Author
-
Левина, А. В., Вахонина, К. Д., Озерец, Н. Н., Мальцева, Т. В., Мальцева, Л. А., Levina, A. V., Vakhonina, K. D., Ozerets, N. N., Maltseva, T. V., Maltseva, L. A., Левина, А. В., Вахонина, К. Д., Озерец, Н. Н., Мальцева, Т. В., Мальцева, Л. А., Levina, A. V., Vakhonina, K. D., Ozerets, N. N., Maltseva, T. V., and Maltseva, L. A.
- Abstract
В работе изучено влияние комбинированной деформационной обработки, сочетающей в себе равноканальное угловое прессование с последующим формоизменением (волочением) до нужного типоразмера, на эволюцию структуры и механические свойства метастабильной аустенитной стали., The authors studied the effect of combined deformation processing, which combines equal channel angular pressing with subsequent forming (drawing) to the desired size, structure evolution and mechanical properties of metastable austenitic steel.
- Published
- 2016
17. Изучение структуры и свойств металлических композиционных материалов
- Author
-
Левина, А. В., Мальцева, Л. А., Мальцева, Т. В., Озерец, Н. Н., Демидов, С. А., Ягудин, Г. А., Шишкин, П. Н., Levina, A. V., Maltseva, L. A., Maltseva, T. V., Ozerets, N. N., Demidov, S. A., Yagudin, G. A., Shishkin, P. N., Левина, А. В., Мальцева, Л. А., Мальцева, Т. В., Озерец, Н. Н., Демидов, С. А., Ягудин, Г. А., Шишкин, П. Н., Levina, A. V., Maltseva, L. A., Maltseva, T. V., Ozerets, N. N., Demidov, S. A., Yagudin, G. A., and Shishkin, P. N.
- Abstract
В работе исследована структура, морфология, микротвердость многослойных металлических композиционных материалов, механические свойства получаемых композитов и фрактограммы изломов. Показана возможность получения композиций из разных материалов методом сварки взрывом. Проанализированы возможные механизмы сцепления слоев., Structure, morphology, microhardness multilayer metal composite material, the mechanical properties of the resulting composites and fraktogrammy fractures studied in this work. The ability to obtain compositions of different materials by explosion welding is shown. Possible mechanisms of adhesion layers are analyzed.
- Published
- 2016
18. High Strength Corrosion-Resistant Steels with Metastable Austenite for Elastic Elements and Springs for Demanding Applications
- Author
-
Maltseva, L. A., Sharapova, V. A., Maltseva, T. V, Zadvorkin, S. M., Levina, A. V, Ozerets, N. N., Maltseva, L. A., Sharapova, V. A., Maltseva, T. V, Zadvorkin, S. M., Levina, A. V, and Ozerets, N. N.
- Published
- 2016
19. PRODUCTION OF HIGH-STRENGTH CORROSION RESISTANT AUSTENITIC STEEL
- Author
-
Grachev, S. V., Maltseva, L. A., Maltseva, T. V., and Jurin, S. V.
- Subjects
ПАТЕНТ ,PATENT ,ИЗОБРЕТЕНИЕ ,INVENTION - Abstract
FIELD: metallurgy; production of high-strength corrosion-resistant austenitic steel.SUBSTANCE: the invention is pertaining to the field of metallurgy, in particular, to a production of high-strength corrosion-resistant austenitic steel used for production of elastic elements. The corrosion-resistant austenitic steel contains components in the following ratio (in mass %): carbon - up to 0.03; chromium - up to 8-25; nickel - up to 5-18; cobalt - up to 1.5 - 10; molybdenum - up to 0.8 - 6.0; titanium - up to 0.5 - 1.02; aluminum - up to 0.4 - 6.02; lanthanum or calcium - up to 0.005 - 0.15; iron - the rest. The technical effect of the invention is an increase of the tensile strength of the high-strength corrosion-resistant austenitic steel up to 2600 MPa.EFFECT: the invention ensures an increase of the tensile strength of the high-strength corrosion-resistant austenitic steel up to 2600 Mpa.1 ex. Изобретение относится к металлургии, в частности к получению высокопрочной теплостойкой проволоки из коррозионно-стойкой аустенитной стали для изготовления упругих элементов. Коррозионно-стойкая аустенитная сталь содержит компоненты в следующем соотношении в мас.%: углерод до 0,03; хром 8-25; никель 5-18; кобальт 1,5-10; молибден 0,8-6,0; титан 0,5-1,02; алюминий 0,4-6,02; лантан или кальций 0,005-0,15; железо - остальное. Техническим результатом изобретения является повышение прочности на разрыв до 2600 МПа.
- Published
- 2005
20. Effect of the state of stress on the strain-induced martensite formation in 03Kh14N11K5M2YuT steel
- Author
-
Maltseva, L. A., Loginov, Yu. N., Maltseva, T. V., Sharapova, V. A., Логинов, Ю. Н., Мальцева, Л. А., Мальцева, Т. В., Шарапова, В. А., Maltseva, L. A., Loginov, Yu. N., Maltseva, T. V., Sharapova, V. A., Логинов, Ю. Н., Мальцева, Л. А., Мальцева, Т. В., and Шарапова, В. А.
- Abstract
The structural changes that occur in a metastable austenitic Fe-Cr-Ni-based steel during cold plastic deformation by drawing and tension are analyzed. A relation between the structure of the steel and its mechanical and magnetic properties is established. It is concluded that the stress state scheme considerably affects the rate of martensite formation. © 2013 Pleiades Publishing, Ltd.
- Published
- 2013
21. Effect of alloying and thermoplastic treatment on the phase composition and properties of corrosion-resistant steels with metastable austenite
- Author
-
Maltseva, L. A., Sharapova, V. A., Maltseva, T. V., Gladkovskii, S. V., Levina, A. V., Maltseva, L. A., Sharapova, V. A., Maltseva, T. V., Gladkovskii, S. V., and Levina, A. V.
- Published
- 2012
22. Impact assessment of national grower trout mixed fodders on the condition of rainbow trout (Oncorhynchus mykiss Walbaum, 1792) during its farming in cages
- Author
-
Kagan Il'ya, Kuzov Anton, Firsova Angelina, Grigoriev Vadim, and Maltseva Tatiana
- Subjects
Environmental sciences ,GE1-350 - Abstract
The paper presents the study results of the various recipes of production trout mixed fodders produced by LLC "RybProm" on the condition of rainbow trout (Oncorhynchus mykiss Walbaum, 1792) during its cultivation in cages in comparison with the feed produced by Coppens. The physiological condition of the studied fish was evaluated, haematological, biochemical studies and pathological and anatomical autopsy were carried out. It was shown that the feed coefficient in the control group was 1.2, and in the experimental feeds from 1.3 to 1.5. Of the three studied feeds, the feed "Recipe #3" is practically not inferior in feed coefficient and growth rate to the control group. The conducted researches at the cage trout farm showed that the feeds of domestic production correspond to imported analogues. All studied feed recipes are safe for the health of rainbow trout and are sufficiently balanced for its cultivation in cages.
- Published
- 2023
- Full Text
- View/download PDF
23. Review of studies on the use of synbiotic feed additives in compound feeds
- Author
-
Rudoy Dmitry, Pakhomov Victor, Maltseva Tatyana, Olshevskaya Anastasiya, Sarkisian Dzhuletta, Saakian Sirun, and Tatarova Anastasia
- Subjects
Environmental sciences ,GE1-350 - Abstract
The article discusses feed additives with probiotic activity, the composition and methods of their preparation, an assessment of the situation of the use of synbiotic additives in compound feeds. Generalised literature data on the use of synbiotics in animal husbandry and aquaculture are presented, their advantages and disadvantages are revealed. A review of studies on the use of feed with probiotic activity in the diet of animals, birds and fish proves the high effectiveness of their use: there is an increase in survival, a decrease in feed conversion, an improvement in the microbiota and the general condition of the animal. Based on the review, a new substrate for growing bacterial strains based on a grain heap of wheat in the early stages of ripeness is proposed.
- Published
- 2023
- Full Text
- View/download PDF
24. Review and analysis of extrusion technology in the production of feed additives based on probiotic microorganisms
- Author
-
Rudoy Dmitry, Pakhomov Victor, Babajanyan Arkady, Maltseva Tatiana, Rumyantseva Evgenia, and Tatarova Anastasia
- Subjects
Environmental sciences ,GE1-350 - Abstract
Ensuring a well-organised and sustainable feed base is the main condition for the development of animal husbandry, increasing its productivity and product quality. To ensure active growth and high productivity, probiotic feed additives are added to the feed, which increase the immune response of the host organism to pathogenic microorganisms, increases the conversion of feed and live weight gain. One of the main processes of feed production is extrusion, which can be cold, warm and hot. The hot extrusion process takes place at a temperature above 130℃ and cannot be used in the production of compound feeds with probiotics that withstand temperatures up to 85℃. During cold extrusion, the temperature reaches no higher than 70℃, which allows the extrusion of mixed feed mass, which contains probiotic feed additives.
- Published
- 2023
- Full Text
- View/download PDF
25. Mathematical modeling of the process of extracting fat from insects by a screw press in the technology of obtaining feed additives
- Author
-
Rudoy Dmitry, Pakhomov Victor, Maltseva Tatiana, Ghukasyan Lusine, and Odabashyan Mary
- Subjects
feed additive ,fat extraction ,alternative protein sources ,hermetia illucens ,black soldier fly ,mathematical model of extraction ,darcy’s law ,navier-stokes equation ,fat viscosity ,filtration rate ,screw press ,Environmental sciences ,GE1-350 - Abstract
The use of insects as raw materials for the production of feed additives is becoming an increasingly relevant and promising area of research. Nevertheless, this area requires numerous studies, including theoretical ones. The article presents the results of research on mathematical modeling of the process of obtaining feed additives in the form of fat and protein from the larva of the Black soldier fly (Hermetia illucens) in a screw press. Mathematical models have been obtained that allow theoretically determining the productivity of a screw press and its energy intensity in the processing of insect biomass. The models are based on the Navier–Stokes equation and Darcy’s law and take into account the design and kinematic parameters of the screw press and the rheological properties of the biomass of the face and the resulting fat.
- Published
- 2023
- Full Text
- View/download PDF
26. A study of the possibility of using animal feed additives and probiotic feed additives in the diet of fish
- Author
-
Rudoy Dmitry, Ponomareva Elena, Pakhomov Victor, Maltseva Tatiana, Mazanko Mariya, Olshevskaya Anastasiya, and Rumyantseva Evgenia
- Subjects
compound feed ,aquaculture ,feed additives ,probiotic ,probiotic supplement ,alternative protein sources ,insect fat ,animal protein ,insects ,black soldier ,hermetia illucens ,Environmental sciences ,GE1-350 - Abstract
The shortage of fish meal and fish oil provokes the search for alternative sources of these feed components. Insects that are part of the diet of animals, birds and fish, rich in protein and fat, can serve as such an alternative. The article presents the results of testing of compound feed for fish containing the fat of the larvae of the black soldier fly (Hermetia illucens) and a feed additive with probiotic activity. The use of the fat of the larva of the black soldier fly (Hermetia illucens) and a probiotic feed additive allows increasing the survival rate of fish from 90 to 95%, increase the conversion of feed and the average daily increase. The calculation of the economic efficiency from the use of compound feed, which includes feed additives of animal origin and additives with probiotic activity, showed an increase in profit when replacing compound feed made according to a standard recipe with compound feed with new feed additives. The economic effect of using compound feed with new feed additives amounted to more than 650 thousand rubles per year on small and medium-sized trout farms up to 20 tons per year.
- Published
- 2023
- Full Text
- View/download PDF
27. The results of the study of the amino acid composition of compound feeds during the extrusion of wheat grain with the addition of Black Soldier Fly Larvae (Hermetia illucens L.)
- Author
-
Babajanyan Arkady, Pakhomov Viktor, Rudoy Dmitry, Braginets Sergey, and Maltseva Tatyana
- Subjects
Environmental sciences ,GE1-350 - Abstract
The production of quality and inexpensive feed based on agricultural raw materials is the main way to increase the profitability and competitiveness of livestock production, ensuring its import substitution and high quality. It is known that in the structure of the cost of livestock products, 50-70% of all costs are accounted for by feed. Three variants of a mixture of crushed wheat grain and biomass of the black soldier fly larvae (Hermetia illucens) were extruded with the content of the latter 10, 15, and 20% by weight at different temperatures. The content of amino acids in raw materials and finished extrudate was determined. It was found that the feed mixture of crushed grain and black soldier fly larvae can be successfully extruded at a temperature of 121-135 °C. With an increase in the extrusion temperature in the range of 115-140 °C, the amino acid content in the finished extrudate decreases. The change in the content of insect larvae in the feed mixture does not affect the nature of the dependence of the amino acid content in the extrudate on the extrusion temperature and the course of the process. It was found that the content of amino acids in the extruded feed decreases with increasing speed with increasing temperature, regardless of the content of insect biomass. The rational range of the extrusion temperature of the feed mixture from wheat grain and insect larvae was determined – 121-127 °C, which ensures a reduction in the content of essential amino acids in the extrudate by no more than 30%. The extruded feed, which includes 15% of the biomass of insect larvae, contains 9.6 ± 0.13% amino acids, including 4.38 ± 2.01% of essential amino acids. The extrusion of insect larvae in a mixture with seeds of grain crops is a promising direction for improving the production of feed for fish and farm animals.
- Published
- 2023
- Full Text
- View/download PDF
28. MEDI 236-Synthesis and anti-HCV activity of 4'-substituted nucleosides
- Author
-
Smith, M., Martin, J., Smith, D., Maag, H., Naiera, I., Jiang, W. R., Klumpp, K., Leveque, V., Cammack, N., Johansson, N. G., Kalayanov, G., Belfrage, A. K., Benkestock, K., Farnell, K., Hiscock, S., Lindborg, B., Maltseva, T., Morisson, V., Pinho, P., Sund, C., Tozer, M., Winquist, A., Zhou, X. X., Smith, M., Martin, J., Smith, D., Maag, H., Naiera, I., Jiang, W. R., Klumpp, K., Leveque, V., Cammack, N., Johansson, N. G., Kalayanov, G., Belfrage, A. K., Benkestock, K., Farnell, K., Hiscock, S., Lindborg, B., Maltseva, T., Morisson, V., Pinho, P., Sund, C., Tozer, M., Winquist, A., and Zhou, X. X.
- Abstract
V15db 236-MEDI Times Cited:0 Cited References Count:0
- Published
- 2006
29. Высокопрочная коррозионностойкая аустенитная сталь
- Author
-
Грачев, С. В., Мальцева, Л. А., Мальцева, Т. В., Юрин, С. В., Grachev, S. V., Maltseva, L. A., Maltseva, T. V., Jurin, S. V., Грачев, С. В., Мальцева, Л. А., Мальцева, Т. В., Юрин, С. В., Grachev, S. V., Maltseva, L. A., Maltseva, T. V., and Jurin, S. V.
- Abstract
FIELD: metallurgy; production of high-strength corrosion-resistant austenitic steel.SUBSTANCE: the invention is pertaining to the field of metallurgy, in particular, to a production of high-strength corrosion-resistant austenitic steel used for production of elastic elements. The corrosion-resistant austenitic steel contains components in the following ratio (in mass %): carbon - up to 0.03; chromium - up to 8-25; nickel - up to 5-18; cobalt - up to 1.5 - 10; molybdenum - up to 0.8 - 6.0; titanium - up to 0.5 - 1.02; aluminum - up to 0.4 - 6.02; lanthanum or calcium - up to 0.005 - 0.15; iron - the rest. The technical effect of the invention is an increase of the tensile strength of the high-strength corrosion-resistant austenitic steel up to 2600 MPa.EFFECT: the invention ensures an increase of the tensile strength of the high-strength corrosion-resistant austenitic steel up to 2600 Mpa.1 ex., Изобретение относится к металлургии, в частности к получению высокопрочной теплостойкой проволоки из коррозионно-стойкой аустенитной стали для изготовления упругих элементов. Коррозионно-стойкая аустенитная сталь содержит компоненты в следующем соотношении в мас.%: углерод до 0,03; хром 8-25; никель 5-18; кобальт 1,5-10; молибден 0,8-6,0; титан 0,5-1,02; алюминий 0,4-6,02; лантан или кальций 0,005-0,15; железо - остальное. Техническим результатом изобретения является повышение прочности на разрыв до 2600 МПа.
- Published
- 2005
30. The NMR conformation study of the complexes of deoxycytidine kinase (dCK) and 2 '-deoxycytidine/2 '-deoxyadenosine
- Author
-
Maltseva, T, Usova, E, Eriksson, S, Milecki, J, Foldesi, A, Chattopadhayaya, J, Maltseva, T, Usova, E, Eriksson, S, Milecki, J, Foldesi, A, and Chattopadhayaya, J
- Abstract
The structures of the bound C-13/H-2 double-labelled 2'(R/S), 5'(R/S)-H-2(2)-1',2',3',4',5'- C-13(5)-2'-deoxyadenosine and the corresponding 2'-deoxycytidine moieties in the complexes with human deoxycytidine kinase (dCK) have been characterized for the f, Addresses: Eriksson S, Swedish Univ Agr Sci, Ctr Biomed, Dept Vet Med Chem, Box 575, S-75123 Uppsala, Sweden Swedish Univ Agr Sci, Ctr Biomed, Dept Vet Med Chem, S-75123 Uppsala, Sweden Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, S-75123 Uppsala, Sweden
- Published
- 2001
31. Do the 16 mer, 5 '-GUGGUCUGAUGAGGCC-3 ' and the 25 mer, 5 '-GGCCGAAACUCGUAAGAGUCACCAC-3 ', form a hammerhead ribozyme structure in physiological conditions? An NMR and UV thermodynamic study
- Author
-
Zamaratski, E, Trifonova, A, Acharya, P, Isaksson, J, Maltseva, T, Chatttopadhayaya, J, Zamaratski, E, Trifonova, A, Acharya, P, Isaksson, J, Maltseva, T, and Chatttopadhayaya, J
- Abstract
In a wide range of salt concentrations, 10-30 mM phosphate buffer containing up to 0.5 M Li2SO4 and 300 mM NaCl, 7.5 mM Mg2+, pH 5.5-7.5, a mixture of the 16 mer and the 25 mer RNA strands does not form a hammerhead in any amount detectable by NMR at 600, Addresses: Chatttopadhayaya J, Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, Box 581, S-75123 Uppsala, Sweden. Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, S-75123 Uppsala, Sweden.
- Published
- 2001
32. An NMR conformational study of the complexes of C-13/H-2 double-labelled 2 '-deoxynucleosides and deoxycytidine kinase (dCK)
- Author
-
Maltseva, T, Usova, E, Eriksson, A, Milecki, J, Foldesi, A, Chattopadhayaya, J, Maltseva, T, Usova, E, Eriksson, A, Milecki, J, Foldesi, A, and Chattopadhayaya, J
- Abstract
The structures of the bound C-13/H-2 double-labelled [(2' R/S,5' R/S)-H-2(2)-1',2',3',4',5'-C-13(5)]-2'-deoxyadenosine (dAdo) and the corresponding 2'-deoxycytidine (dCyd) moieties in the complexes with human recombinant deoxycytidine kinase (dCK) have be, Addresses: Chattopadhayaya J, Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, Box 581, S-75123 Uppsala, Sweden Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, S-75123 Uppsala, Sweden Swedish Univ Agr Sci, Dept Vet Med Chem, S-75123 Uppsala, Sweden Adam Mickie
- Published
- 2000
33. The identification of the A-type RNA helices in a 55mer RNA by selective incorporation of deuterium-labelled nucleotide residues (Uppsala NMR-window concept)
- Author
-
Maltseva, T, Foldesi, A, Chattopadhyaya, J, Maltseva, T, Foldesi, A, and Chattopadhyaya, J
- Abstract
The 55-nt long RNA, modelling a three-way junction, with non-uniformly incorporated deuterated nucleotides has been synthesised in a pure form. The NMR-window part in this partially deuterated 55mer RNA consists of natural non-enriched nucleotide blocks a, Addresses: Chattopadhyaya J, Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, Box 581, S-75123 Uppsala, Sweden. Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, S-75123 Uppsala, Sweden.
- Published
- 2000
34. A single carbocyclic nucleotide substitution in a 12mer DNA gives a Hoogsteen basepaired duplex (till 38 degrees C) and a hairpin (till 65 degrees C). A 600 MHZ NMR spectroscopic study.
- Author
-
Isaksson, J, Maltseva, T, Agback, P, Luo, X, Kumar, A, Zamaratski, E, Chattopadhyaya, J, Isaksson, J, Maltseva, T, Agback, P, Luo, X, Kumar, A, Zamaratski, E, and Chattopadhyaya, J
- Abstract
The impact of intramolecular stereoelectronic effects has been examined by comparison of the solution structures of natural oligo-DNA duplex, 5'((1)C(2)G(3)C(4)G(5)A(6)A(7)T(8)T(9)C(10)G(11)C(12)G)(2)(3'), and its carbocyclic-nucleotide analogues in which, Addresses: Chattopadhyaya J, Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, Box 581, S-75123 Uppsala, Sweden. Univ Uppsala, Ctr Biomed, Dept Bioorgan Chem, S-75123 Uppsala, Sweden.
- Published
- 1999
35. Determination of the solution conformation of a non-uniformly deuterium labelled (Uppsala 'NMR-window') 21mer RNA hairpin by NMR spectroscopy and computational methods.
- Author
-
Sandstrom, A, Maltseva, T, Chattopadhyaya, J, Sandstrom, A, Maltseva, T, and Chattopadhyaya, J
- Abstract
The conformation of a 21mer RNA hairpin, 5'-r(AGCCCGCCUAAUGAGCGGGCU)-3, was determined by NMR spectroscopy and computer calculations. The 'Uppsala NMR-window' approach was used to overcome the problem of spectral overlap., Addresses: UNIV UPPSALA, CTR BIOMED, DEPT BIOORGAN CHEM, S-75123 UPPSALA, SWEDEN.
- Published
- 1997
36. The NMR structure of 31-mer RNA domain of E. coli RNase P RNA using its non-uniformly deuterium labelled counterpart (the 'NMR-window' concept)
- Author
-
Glemarec, C, Kufel, J, Földesi, A, Maltseva, T, Sandström, A, Kirsebom, Leif A, Chattopadhyaya, J, Glemarec, C, Kufel, J, Földesi, A, Maltseva, T, Sandström, A, Kirsebom, Leif A, and Chattopadhyaya, J
- Abstract
The NMR structure of a 31mer RNA constituting a functionally important domain of the catalytic RNase P RNA from Escherichia coli is reported. Severe spectral overlaps of the proton resonances in the natural 31mer RNA (1) were successfully tackled by unique spectral simplifications found in the partially-deuterated 31 mer RNA analogue (2) incorporating deuterated cytidines [C5 (>95 atom % 2H), C2' (>97 atom % 2H), C3' (>97 atom % 2H), C4' (>65 atom % 2H) and C5' (>97 atom % 2H)] [for the 'NMR-window' concept see: Földesi,A. et al. (1992) Tetrahedron, 48, 9033; Foldesi,A. et al. (1993) J. Biochem. Biophys. Methods, 26, 1; Yamakage,S.-I. et al. (1993) Nucleic Acids Res., 21, 5005; Agback,P. et al. (1994) Nucleic Acids Res., 22, 1404; Földesi,A. et al. (1995) Tetrahedron, 51, 10065; Földesi,A. et al. (1996) Nucleic Acids Res., 24, 1187-1194]. 175 resonances have been assigned out of total of 235 non-exchangeable proton resonances in (1) in an unprecedented manner in the absence of 13C and 15N labelling. 41 out of 175 assigned resonances could be accomplished with the help of the deuterated analogue (2). The two stems in 31mer RNA adopt an A-type RNA conformation and the base-stacking continues from stem I into the beginning of the loop I. Long distance cross-strand NOEs showed a structured conformation at the junction between stem I and loop I. The loop I-stem II junction is less ordered and shows structural perturbation at and around the G11 -C22 base pair.
- Published
- 1996
- Full Text
- View/download PDF
37. POOR HYDRATION ENHANCES THE ACTIVATION-ENERGY OF THE EXCHANGE-RATE OF THE BASE-PAIRED IMINO PROTONS WITH WATER AT THE CORE PART OF THE DNA DUPLEX
- Author
-
MALTSEVA, T, CHATTOPADHYAYA, J, MALTSEVA, T, and CHATTOPADHYAYA, J
- Abstract
Here we report the exchange rates (k(ex)) of imino protons of d[5(5')p(T(1)G(2)T(3)T(4)T(5)G(6)G(7)C(8))(3')]: d[(3')(A(15)C(14)A(13)A(12)A(11)C(10)C-9)p(5')] (duplex I) with water at different pH and temperature to give the life-times (tau(o)) of the clo, Addresses: UNIV UPPSALA, CTR BIOMED, DEPT BIOORGAN CHEM, S-75123 UPPSALA, SWEDEN.
- Published
- 1995
38. The Use of Non-Uniform Deuterium Labelling ['NMR-Window'] To Study the NMR Structure of a 21mer RNA Hairpin
- Author
-
Foldesi, A., primary, Yamakage, S.- I., additional, Nilsson, F. P. R., additional, Maltseva, T. V., additional, and Chattopadhyaya, J., additional
- Published
- 1996
- Full Text
- View/download PDF
39. Personal and professional development of the individual in the civil service of the Russian Federation
- Author
-
Sepiashvili Ekaterina Nikolaevna, Maltseva Tatyana Vyacheslavna, Sumina Ekaterina Anatolyevna, Bashlueva Natalya Nikolaevna, and Bashlueva Mariya Andreevna
- Subjects
personal development ,professional psychology ,job satisfaction ,Social Sciences - Abstract
The presence of professional highly qualified personnel in the civil service, together with modern information technologies, is possible thanks to the existence of a democratic state governed by the rule of law. The professional activity of civil servants acts as a subsystem within the civil service system. The study of the peculiarities of personal and professional development of the individual in the civil service will contribute to the disclosure of the psychological mechanisms of this process, the resolution of a number of pressing questions about the methods and possibilities of optimizing professional and personal development, which in turn will contribute to improving labour efficiency. To study the features of personal and professional development of the individual in the Russian Federation Civil Service. Survey among civil servants and comparative analysis of the results obtained in all study groups; statistical processing of the results. 120 respondents took part in the study: federal-state civil servants (40 people) and civil servants of other types (80 people). The main problems and features of personal and professional development of the individual in the civil service of the Russian Federation are identified and the main directions of optimization of the studied process are determined. The process of personal and professional development of civil servants, as will be shown in this study, is an overall result of the professional education and additional professional education, including retraining, advanced training, and internships. The main directions of optimization of the studied process are the following: improving scientific, methodological, and organizational support; increasing the motivation for professional activity and career advancement; improving the efficiency of additional professional education; developing a program for personal and professional self-development; introducing additional forms and technologies for improving professional skills of state civil servants.
- Published
- 2021
- Full Text
- View/download PDF
40. Basic model of resocialization of convicts
- Author
-
Maltseva Tatiana Vyacheslavna, Malyshev Konstantin Borisovich, Sobolev Nikolay Gurgenovich, Kirillova Ekaterina Pavlovna, and Mikhailov Alexey Nikolaevich
- Subjects
personality ,administration of justice ,enforcement of the law ,prisoners ,crime prevention ,education in correctional institutions ,Social Sciences - Abstract
Purpose of the study: development of directions and basic model of resocialization of convicts. This study uses a three-factor dichotomous baseline model of convict resocialization with a single “external-internal” dichotomy. This model defines the “vectors of development” of a convict and shows the common factors of this process, which correctional officers need to consider when organizing re-socialization work with this category of people. The research resulted in conclusions from the analysis of three factor-categories of pedagogy: “education”, “training” and “education”, determining the objective (external) position of the individual, and “self-learning” and “self-education”, determining the subjective (internal) position of the individual. While using the principle of “semantic proximity”, a three-factor basic-dichotomous “superimposition” of these factors-categories of pedagogy on such concepts as “values”, “activity”, “intellect” has been performed. This “superposition” results in three combined basic psycho-pedagogical factors (“value education”, “active learning”, “intellectual education”). From this model, it becomes clear what direction correctional officers should work in terms of “developing the consciousness” of the convict, given the factors in question. The novelty of the study is that the work shows specific examples of activities performed by the staff with convicts, which are associated with the implementation of these factors and the impact on the process of resocialization.
- Published
- 2021
- Full Text
- View/download PDF
41. Study of personality accentuations based on a three-factor dichotomic typological approach
- Author
-
Malyshev Konstantin Borisovich, Sobolev Nikolay Gurgenovich, Chirkov Aleksey Modestovich, Ershova Nina Nikolaevna, and Maltseva Tatyana Vyacheslavovna
- Subjects
personality ,psychometry ,typology ,temperament ,Social Sciences - Abstract
A significant problem for practical psychologists is development of own methods necessary for particular and special cases of character research. This requires technologies for creating psychological diagnostic tools that might help to extend, streamline and show a complete picture of the personality, as well as a reliable system for validating the designed instrumentation. Practical psychology needs set forth a social mandate for the development of a classification technology highlighting psychological characteristics of individuals. Purpose of the research: creation of a new methodology for obtaining and measuring information concerning personality accentuations. Methods: a three-factor integrated dichotomic basic approach is used in modelling personality accentuations types and varieties of temperament. The respondents were represented by 187 students of Vologda State University. The research was carried out using the MMPI (Minnesota Multiphasic Personality Inventory) test and Holland’s Professional Test Guide. The correlation analysis was used as well in data processing. The validation of the new methodology for measuring personality accentuations was made in terms of constructive validity. The research results extend the scientific concept defining the role and significance of the processes structuring the personality-specific psychological information, based on the use of a dichotomic three-factor basic approach which in turn will contribute to the development of theoretical psychologist’s creative thinking. In addition, the results are aimed at obtaining complete and ordered measurement information on personality accentuations based on the application of the integrated-dichotomic three-factor basic typological approach that is of particular importance for the formation of practical psychologist’s theoretical reasoning. The research results can be used for the purpose of extension of the psychodiagnostic training content.
- Published
- 2021
- Full Text
- View/download PDF
42. Features of emotional burnout syndrome in government employees
- Author
-
Maltseva Tatyana Vyacheslavna, Sumina Ekaterina Anatolyevna, Gorach Nikolai Nikolaevich, Khmelev Sergey Alexandrovich, and Kovrova Vera Gennadievna
- Subjects
emotions ,mental stress ,occupational psychology ,job satisfaction ,Social Sciences - Abstract
The problem of the onset, formation, and development of the phenomenon of emotional burnout is relevant in the study of any profession and is an important component for the professional activity of government employees in the Russian Federation. To explore the features of emotional burnout syndrome development in government employees and develop psychological recommendations for its prevention. Psychological testing of government employees and comparative analysis of the obtained results by groups; statistical processing of the obtained results. The study uses the method for diagnosing the emotional burnout level by V.V. Boyko. The experimental groups in the study are formed by 35 government employees who used to hold managerial positions (over 10 years of experience in civil service). The results of the study broaden the understanding of the place of emotional burnout syndrome in the professional activity of government employees. The features and mechanisms lying at the basis of the emergence and development of emotional burnout syndrome in civil servants are described. Ensuring government employees’ effectiveness in their duties calls for conducting a set of measures to reduce emotional burnout: optimization of the organization of activities, a favorable social and psychological climate in the team, and organized work of the psychological service. In the process of selection and training of government employees, it appears reasonable to pay attention to the individual characteristics preventing professional deformation and promote the development of the personal ability to withstand stressors (self-efficacy, confidence in the level of one’s professionalism, developed success goals; tolerance for difficulties and unpredictable situations; self-respect, an adequate level of self-esteem; resilience, the ability to manage professional affairs; the development of individual strategies for coping with stress, etc.).
- Published
- 2021
- Full Text
- View/download PDF
43. The NMR Structure of 31mer RNA Domain of Escherichia Coli RNase P RNA Using Its Non-Uniformly Deuterium Labelled Counterpart [the ‘NMR-window’ Concept].
- Author
-
Glemarec, C., Kufel, J., Földesi, A., Maltseva, T., Sandström, A., Kirsebom, L. A., and Chattopadhyaya, J.
- Published
- 1996
- Full Text
- View/download PDF
44. Analysis of the micronization process effect on the amino acid composition in compound feed
- Author
-
Rudoy Dmitry, Pakhomov Victor, Maltseva Tatyana, Kulikova Natalia, Ugrekhelidze Natia, Enalyeva Larisa, and Babajanyan Arkady
- Subjects
Environmental sciences ,GE1-350 - Abstract
The article presents the results of a study of the effect of feed samples micronization on proteinogenic amino acids, such as: arginine, lysine, tyrosine, phenylalanine, histidine, leucine-isoleucine, methionine, valine, proline, tyrosine, serine, alanine. The optimal parameters of the micronization process of compound feed have been substantiated in order to increase the digestibility of feed and disinfection.
- Published
- 2020
- Full Text
- View/download PDF
45. Extracts of medical plants suppress the SOS response and reduce mutagenesis in E. coli
- Author
-
Mazanko Maria, Prazdnova Evgenia, Rudoy Dmitriy, Ermakov Alexey, Olshevskaya Anastasiya, and Maltseva Tatiana
- Subjects
Environmental sciences ,GE1-350 - Abstract
One of the promising directions in the fight against the emergence and spread of farm animal microbiota resistance factors is the development and search for feed additives that can inhibit the SOSresponse. SOS-response is one of the main mechanisms of the occurrence of mutations in bacteria. Plants used in traditional medicine can be a promising source of safe substances that reduce the SOS-response of bacteria. A screening of plants potentially containing substances with antiSOS activity was performed. During the initial screening, the E. coli MG 1655 pRecA-lux biosensor strain with ciprofloxacin as RecA inducer was used. Seven plants were identified whose extracts reduced the expression of the RecA operon. In further experiments on bacteria exposed to antibiotics, we identified four plants whose exstracts significantly reduced the mutagenesis rate of clinical E. coli strains: Austrian broom (Cytisus austriacus), greater celandine (Chelidonium majus), walnut (Juglans regia) and smooth sumac (Rhus glabra).
- Published
- 2020
- Full Text
- View/download PDF
46. Immunobiotics mechanisms of action and prospects of use in veterinary medicine
- Author
-
Refeld Aleksandr, Bogdanova Anna, Prazdnova Evgeniya, Beskopylny Alexey, Olshevskaya Anastasiya, Maltseva Tatyana, and Zubtsov Vladislav
- Subjects
Environmental sciences ,GE1-350 - Abstract
Probiotics are becoming more and more common means of combating intestinal diseases of various origins: infectious pathologies, chronic inflammation, autoimmune disorders. The complex action, coupled with low side effects, makes probiotics promising drugs, especially in veterinary medicine, with an increasing trend towards the inefficient use of antibiotics in the livestock industry. One of the main mechanisms of probiotics action - modulation of host immunity - is perhaps the most difficult and, at the same time, the most actively studied since it is crucial for therapy. Immunobiotics (probiotics that modulate the host's immune response) interact with various innate and adaptive immune cells, changing the expression of pro- and anti-inflammatory cytokines. This action is provided by both the cellular components of probiotic microorganisms and their metabolites and is primarily associated with the host's immunocompetent cells' pattern-recognition receptors, although other molecular mechanisms also exist. This review aims to briefly describe both the molecular mechanisms of immunomodulation by probiotics and the prospects for their use in veterinary medicine.
- Published
- 2020
- Full Text
- View/download PDF
47. Assessment succession of student's goes in for table tennis [Ocenivanie uspevaemosti studentov, zanimaiushchikhsia badmintonom]
- Author
-
Temchenko V.A. and Maltseva T.N.
- Subjects
student ,badminton ,criteria ,estimation ,physical ,Medicine - Abstract
The questions of development of criteria of evaluation of progress of students are considered in the article. Possible directions of sectional form organization of educational process are rotined in discipline «Physical education» in the conditions of to credit-module systems. Norms are resulted on general and special physical preparation. Positive motivation of students is exposed to employments: the differentiated estimation of progress on physical education stimulates students to regular employments by the chosen type of sport. Underline, that presently absents single system of evaluation of progress of students. Attention on the under exploitation of model of sectional form of employments is accented.
- Published
- 2011
48. Thin-walled shell foundations
- Author
-
Pronozin Yakov, Maltseva Tatyana, Poroshin Oleg, and Medvedeva Anna
- Subjects
Engineering (General). Civil engineering (General) ,TA1-2040 - Abstract
The article presents a study of the interaction of strip foundations of multistorey apartment houses united by flat cylindrical shells with a ground base. The foundation of a 17-storey residential building has been taken as an example. The ground base consists of strong upper and highly compressible underlying layers. The use of traditional foundations under the specified conditions is hardly possible. The calculation scheme of the building and the stages of the ground foundation work are represented. Also, the researchers share the results of geotechnical monitoring in the construction process including observations of settlings at 25 points with an accuracy of 0.1 mm and measurement of layer-by-layer deformations of the ground base under the building to a depth of 10 meters from the surface. The diagrams demonstrate the actual settlement of the building with increasing load and layer-by-layer deformations of the ground base in depth are presented.
- Published
- 2019
- Full Text
- View/download PDF
49. Study of the nature of the dynamic coefficient of internal friction of grainmaterials
- Author
-
Savenkov Dmitriy, Kirischiev Oleg, Kirischieva Ylia, Tupolskikh Tatiana, Maltseva Tatiana, Magomedov Magomed, and Chistyakov Andrey
- Subjects
Environmental sciences ,GE1-350 - Abstract
The article highlights the issues related to the study of physical and mechanical characteristics of bulk materials, namely internal friction coefficients in static and dynamic modes. An innovative device of the carousel type for determining the frictional characteristics of bulk materials is described, which allows to implement the tasks of practical determination of dynamic coefficients of internal friction. Presented the program, methodology and results of research on the practical study of the internal friction coefficient of typical bulk products of agricultural production in the range of linear velocities of displacement of layers from 0 to 2.79 m/s, the reliability of which is not lower than 0.878.
- Published
- 2019
- Full Text
- View/download PDF
50. Potent Macrocyclic Inhibitors of the Hepatitis C Virus NS3 Protease. Use of Cyclopentane and Cyclopentene Derived P2-Scaffolds
- Author
-
Bäck, M., Johansson, P-O., Jansson, K., Vrang, L., Hamelink, E., Hallberg, A., Rosenquist, Å., Samuelsson, B., Wångsell, F., Thorstensson, F., Kvarnström, I., Ayesa-Alvarez, S., Maltseva, T., Bäck, M., Johansson, P-O., Jansson, K., Vrang, L., Hamelink, E., Hallberg, A., Rosenquist, Å., Samuelsson, B., Wångsell, F., Thorstensson, F., Kvarnström, I., Ayesa-Alvarez, S., and Maltseva, T.
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.