Search

Ectodermal dysplasia is a rare disease that belongs to a diverse group of inherited monogenic disorders involving defects in one or more ectodermally or mesodermally derived tissues. Hypohidrotic ectodermal dysplasia, also known as Christ-Siemens-Touraine syndrome is a type of ectodermal dysplasia characterized by a triad of anhidrosis, dysodontia, and hypotrichiasis. The most prevalent method of transmission is X-linked recessive, manifesting fully in men and only partially in female carrier heterozygotes. Atrophic rhinitis and nasal myiasis are rare characteristics of this condition. We hereby report a case of a 52-year-old female with atrophic rhinitis and nasal myiasis who was managed conservatively.

Abstract Background The aim of this study was to analyse the differences in the phenotypes of missing teeth between a pair of brothers with hypohidrotic ectodermal dysplasia (HED) and to investigate the underlying mechanism by comparing the mutated gene loci between the brothers with whole-exome sequencing. Methods The clinical data of the patients and their mother were collected, and genomic DNA was extracted from peripheral blood samples. By Whole-exome sequencing filtered for a minor allele frequency (MAF) ≤0.05 non-synonymous single-nucleotide variations and insertions/deletions variations in genes previously associated with tooth agenesis, and variations considered as potentially pathogenic were assessed by SIFT, Polyphen-2, CADD and ACMG. Sanger sequencing was performed to detect gene variations. The secondary and tertiary structures of the mutated proteins were predicted by PsiPred 4.0 and AlphaFold 2. Results Both brothers were clinically diagnosed with HED, but the younger brother had more teeth than the elder brother. An EDA variation (c.878 T > G) was identified in both brothers. Additionally, compound heterozygous variations of WNT10A (c.511C > T and c.637G > A) were identified in the elder brother. Digenic variations in EDA (c.878 T > G) and WNT10A (c.511C > T and c.637G > A) in the same patient have not been reported previously. The secondary structure of the variant WNT10A protein showed changes in the number and position of α-helices and β-folds compared to the wild-type protein. The tertiary structure of the WNT10A variant and molecular simulation docking showed that the site and direction where WNT10A binds to FZD5 was changed. Conclusions Compound heterozygous WNT10A missense variations may exacerbate the number of missing teeth in HED caused by EDA variation.

Objectives: To analyse the pathogenic genes in a patient with hypohidrotic ectodermal dysplasia (HED) and explore the relationship between pathogenic genes and the oligodontia phenotype. Methods: Clinical data and peripheral blood were collected from a patient with HED. Pathogenic genes were analysed by whole-exon sequencing (WES) and verified by Singer sequencing. The secondary and tertiary structures of the variant proteins were predicted to analyse their toxicity. Results: The patient exhibited a severe oligodontia phenotype, wherein only two deciduous canines were left in the upper jaw. WES revealed a hemizygous EDA variant c.466C > T p.(Arg156Cys) and a novel heterozygous EVC2 variant c.1772T > C p.(Leu591Ser). Prediction of the secondary and tertiary structures of the EDA variant p.(Arg156Cys) and EVC2 variant p.(Leu591Ser) indicated impaired function of both molecules. Conclusion: The patient demonstrated a more severe oligodontia phenotype when compared with the other patients caused by the EDA variant c.466C > T. Since Evc2 is a positive regulator of the Sonic Hedgehog (Shh) signal pathway, we speculated that the EVC2 variant p.(Leu591Ser) may play a synergistic role in the oligodontia phenotype of HED, thereby exacerbating the oligodontia phenotype. Knowledge of oligodontia caused by multiple gene variants is of great significance for understanding individual differences in oligodontia phenotypes.

Abstract Objective The objective of this systematic review was to determine the orthodontic and dentofacial orthopedic treatments carried out in patients with ectodermal dysplasia to facilitate functional and aesthetic rehabilitation. Methods The systematic review was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis statement. We systematically searched PubMed, Web of Science, Scopus, Scielo, LILACS, EBSCOhost and Embase databases up to 6 January 2022. We included articles describing patients with any type of ectodermal dysplasia who received orthodontic or dentofacial orthopedic treatment to facilitate functional and aesthetic oral rehabilitation. The search was not restricted by language or year of publication. The quality of the studies was assessed using the Joanna Briggs Institute Quality Assessment Scale of the University of Adelaide for case series and case reports. The review was registered at the University of York Centre for reviews (CRD42021288030). Results Of the initial 403 studies found, 29 met the inclusion criteria. After applying the quality scale, 23 were left for review—21 case reports and 2 case series. The initial age of patients ranged from 34 months to 24 years. Thirteen studies were on hypohidrotic and/or anhidrotic ectodermal dysplasia, of which two were X-chromosome linked. In one study, the patient had Wiktop syndrome, and in nine the type of ectodermal dysplasia was not specified. The duration of treatment was 7 weeks to 10 years. The treatments described were: fixed orthodontic appliances or simple acrylic plates designed for tooth movement, including leveling and aligning, closing of diastemata, retraction of impacted teeth in the dental arch; clear aligners; fixed and/or removable appliances for the correction of skeletal and/or dentoalveolar relationships; palatal expanders in combination with face masks for orthopedic traction of the maxilla; and orthognathic surgery. Only three studies provided cephalometric data. Conclusion The level of evidence of the articles reviewed was low and most orthopedic and dentofacial orthodontic treatments described were focused on correcting dental malpositioning and jaw asymmetries and not on stimulating growth from an early age. Studies with greater scientific evidence are needed to determine the best treatment for these patients.

Background: Hypohidrotic ectodermal dysplasia (HED) mainly results from gene mutations in the EDA/EDAR/NF‐κB pathway. Function analysis of the mutations in the collagen domain of ectodysplasin A (EDA)result in HED has been rarely studied. This study aimed at determining the mechanism by which the novel collagen domain mutation of EDA results in HED. Methods: We analyzed the DNAs from a Chinese family with HED and performed bioinformatics analysis. A new three‐dimensional structure model of the EDA trimer was built and used to predict the effect of the mutations on EDA. We performed a western blot to detect EDA1 proteins in cell lysates and supernatants. We then performed coimmunoprecipitation to determine whether the mutation would affect the interaction of EDA1 with the EDA receptor (EDAR). Dual luciferase reporter assay and immunofluorescence were performed to detect the effect of the mutant EDA1 protein on nuclear factor kappa B (NF‐κB) activation. Results: A novel missense mutation (c.593G > A, p. Gly198Glu) in the collagen domain of EDA was detected. The mutation was predicted to be disease‐causing. A three‐dimensional structure model of the EDA trimer was first built in this study, in which the mutation site is located around the receptor binding domain. Functional studies showed that there was no difference in the secretion activity between the mutant EDA1 and the wild‐type EDA1. However, the receptor‐binding activity and the transcription activation of NF‐κB were impaired by the mutation. Conclusion: We identified a novel mutation (c.593G > A, p. Gly198Glu) in the collagen domain of EDA. Bioinformatics analysis and functional studies showed this mutation was damaging, indicating that mutations in the collagen domain of EDA could result in HED by affecting the receptor‐binding activity of EDA and the transcriptional activity of NF‐κB. [ABSTRACT FROM AUTHOR]

Abstract Background Hypohidrotic ectodermal dysplasia (HED) mainly results from gene mutations in the EDA/EDAR/NF‐κB pathway. Function analysis of the mutations in the collagen domain of ectodysplasin A (EDA)result in HED has been rarely studied. This study aimed at determining the mechanism by which the novel collagen domain mutation of EDA results in HED. Methods We analyzed the DNAs from a Chinese family with HED and performed bioinformatics analysis. A new three‐dimensional structure model of the EDA trimer was built and used to predict the effect of the mutations on EDA. We performed a western blot to detect EDA1 proteins in cell lysates and supernatants. We then performed coimmunoprecipitation to determine whether the mutation would affect the interaction of EDA1 with the EDA receptor (EDAR). Dual luciferase reporter assay and immunofluorescence were performed to detect the effect of the mutant EDA1 protein on nuclear factor kappa B (NF‐κB) activation. Results A novel missense mutation (c.593G > A, p. Gly198Glu) in the collagen domain of EDA was detected. The mutation was predicted to be disease‐causing. A three‐dimensional structure model of the EDA trimer was first built in this study, in which the mutation site is located around the receptor binding domain. Functional studies showed that there was no difference in the secretion activity between the mutant EDA1 and the wild‐type EDA1. However, the receptor‐binding activity and the transcription activation of NF‐κB were impaired by the mutation. Conclusion We identified a novel mutation (c.593G > A, p. Gly198Glu) in the collagen domain of EDA. Bioinformatics analysis and functional studies showed this mutation was damaging, indicating that mutations in the collagen domain of EDA could result in HED by affecting the receptor‐binding activity of EDA and the transcriptional activity of NF‐κB.

Objective: The objective of this systematic review was to determine the orthodontic and dentofacial orthopedic treatments carried out in patients with ectodermal dysplasia to facilitate functional and aesthetic rehabilitation.Methods: The systematic review was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis statement. We systematically searched PubMed, Web of Science, Scopus, Scielo, LILACS, EBSCOhost and Embase databases up to 6 January 2022. We included articles describing patients with any type of ectodermal dysplasia who received orthodontic or dentofacial orthopedic treatment to facilitate functional and aesthetic oral rehabilitation. The search was not restricted by language or year of publication. The quality of the studies was assessed using the Joanna Briggs Institute Quality Assessment Scale of the University of Adelaide for case series and case reports. The review was registered at the University of York Centre for reviews (CRD42021288030).Results: Of the initial 403 studies found, 29 met the inclusion criteria. After applying the quality scale, 23 were left for review-21 case reports and 2 case series. The initial age of patients ranged from 34 months to 24 years. Thirteen studies were on hypohidrotic and/or anhidrotic ectodermal dysplasia, of which two were X-chromosome linked. In one study, the patient had Wiktop syndrome, and in nine the type of ectodermal dysplasia was not specified. The duration of treatment was 7 weeks to 10 years. The treatments described were: fixed orthodontic appliances or simple acrylic plates designed for tooth movement, including leveling and aligning, closing of diastemata, retraction of impacted teeth in the dental arch; clear aligners; fixed and/or removable appliances for the correction of skeletal and/or dentoalveolar relationships; palatal expanders in combination with face masks for orthopedic traction of the maxilla; and orthognathic surgery. Only three studies provided cephalometric data.Conclusion: The level of evidence of the articles reviewed was low and most orthopedic and dentofacial orthodontic treatments described were focused on correcting dental malpositioning and jaw asymmetries and not on stimulating growth from an early age. Studies with greater scientific evidence are needed to determine the best treatment for these patients. [ABSTRACT FROM AUTHOR]

We report a case of a patient with genetic sequencing-confirmed X-linked hypohidrotic ectodermal dysplasia without the typical characteristic hair growth abnormalities with the disorder. While this patient had already received guidance from a genetic counselor about his condition, many cases of ectodermal dysplasia go underdiagnosed or misdiagnosed due to mild or atypical presentations. With gene therapies emerging, the authors hope to highlight the importance of recognizing the disorder in patients who have not yet received a diagnosis to better manage their clinical course and guide future life decisions., Competing Interests: Human subjects: Consent was obtained or waived by all participants in this study. Conflicts of interest: In compliance with the ICMJE uniform disclosure form, all authors declare the following: Payment/services info: All authors have declared that no financial support was received from any organization for the submitted work. Financial relationships: All authors have declared that they have no financial relationships at present or within the previous three years with any organizations that might have an interest in the submitted work. Other relationships: All authors have declared that there are no other relationships or activities that could appear to have influenced the submitted work., (Copyright © 2024, Nardone et al.)

The term ectodermal dysplasias (EDs) describes a heterogeneous group of inherited developmental disorders that affect several tissues of ectodermal origin. The most common form of EDs is hypohidrotic ectodermal dysplasia (HED), which is characterized by hypodontia, hypotrichosis, and partial or total eccrine sweat gland deficiency. HED is estimated to affect at least 1 in 17,000 people worldwide. Patients with HED have characteristic facies with periorbital hyperpigmentation, depressed nasal bridge, malar hypoplasia, and absent or sparse eyebrows and eyelashes. The common ocular features of HED include madarosis, trichiasis, and ocular chronic surface disease due to dry eye syndrome, which manifests clinically with discomfort, photophobia, and redness. Dry eye is common in HED and results from a combination of ocular surface defects: mucus abnormalities (abnormal conjunctival mucinous glands), aqueous tear deficiency (abnormalities in the lacrimal gland) and lipid deficiency (due to the partial or total absence of the meibomian glands; modified sebaceous glands with the tarsal plate). Sight-threatening complications result from ocular surface disease, including corneal ulceration and perforation with subsequent corneal scarring and neovascularization. Rare ocular features have been reported and include bilateral or unilateral congenital cataracts, bilateral glaucoma, chorioretinal atrophy and atresia of the nasolacrimal duct. Recognition of the ocular manifestations of HED is required to perform clinical surveillance, instigate supportive and preventative treatment, and manage ocular complications. [ABSTRACT FROM AUTHOR]

Background: Ectodysplasin A (EDA) variations are major pathogenic factors for hypohidrotic ectodermal dysplasia (HED), the most common form of ectodermal dysplasia (ED), characterized by hypotrichosis, hypohidrosis, hypodontia, and other oral features. Methods: Molecular genetic defects in three HED families were detected by whole-exome sequencing and confirmed by Sanger sequencing or multiplex ligation-dependent probe amplification. The effect of splicing variant was further verified by EDA minigene in vitro analysis. De novo deletion was confirmed by chromosomal microarray analysis. Results: Three variants (c.396 + 1 G > C, c.171-173 del GTT, and exon 1 deletion) were identified, all affecting exon 1 of the EDA gene. Variants c.396 + 1 G > Cand c.171-173 del GTT were first identified. Minigene analysis of the splicing variant (c.396 + 1 G > C) displayed a prolonged EDA-A1 transcript containing extra 699 bp at the start of intron 1, representing a functional cryptic splice site formation in vitro. Combining the results of chromosomal microarray analysis and whole-exome sequencing, the deletion variant was over 87 kb. Three variants were predicted to affect protein function to differing degrees, and were responsible for X-linked HED with varying phenotype. Conclusion: Investigating the clinical and molecular characteristics of these variations broadens our understanding of EDA gene variants, supporting clinical diagnosis, genetic counseling, and prenatal diagnosis of HED. [ABSTRACT FROM AUTHOR]

Abstract Background Hypohidrotic ectodermal dysplasia (HED) is a group of genodermatoses in which deficient ectodysplasin A signalling leads to maldevelopment of skin appendages, various eccrine glands, and teeth. Individuals with HED often have disrupted epithelial barriers and, therefore, were suspected to be more susceptible to coronavirus infection. Methods 56 households with at least one member who had coronavirus disease of 2019 (COVID-19) were enrolled in a longitudinal study to compare the course of illness, immune responses, and long-term consequences of severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) infection in HED patients (n = 15, age 9–52 years) and control subjects of the same age group (n = 149). Results In 14 HED patients, mild or moderate typical COVID-19 symptoms were observed that lasted for 4–45 days. Fever during the first days sometimes required external cooling measures. The course of COVID-19 was similar to that in control subjects if patients developed antibodies blocking the SARS-CoV-2 spike protein. Five out of six HED patients with completely abrogated ectodysplasin A signalling (83%) suffered from chronic, in two cases very severe fatigue following COVID-19, while only 25% of HED patients with residual activity of this pathway and 21% of control subjects recovering from COVID-19 experienced postinfectious fatigue. Hair loss after COVID-19 was also more frequent among HED patients (64%) than in the control group (13%). Conclusions HED appears to be associated with an increased risk of long-term consequences of a SARS-CoV-2 infection. Preventive vaccination against COVID-19 should be recommended for individuals affected by this rare genetic disorder.

Introduction: Ectodermal dysplasia is a genetic rare disease, consisting of a group of abnormalities which are the results of the abnormal development of two or more embryonic ectoderm derivatives, such as the skin, hair, nail, sweat gland, tooth, and other organs. Systemic features of ectodermal dysplasia include sparse hair (hypotrichosis), dry and hypopigmented skin, and malfunction of sweat glands that could cause hyperthermia. Intraoral symptoms of ectodermal dysplasia are abnormalities in tooth number (hypodontia or oligodontia of primary and permanent dentitions) and morphology (conical or peg tooth). Reestablishment of dental esthetics in a growing child with ectodermal dysplasia is crucial to amend psychosocial, esthetic, and functional problems. In this case report, an 8-year-old boy with esthetic and functional complaints was treated by a multidisciplinary approach. His parents declared no systemic diseases. Chief compliant of the patient was the problem in the eruption of the anterior teeth and dental abcess. The patient was reported to have major problems in terms of esthetics and social communications because of the missing teeth. The aim of this case report was to display a simple and cost-benefit method to reproduce an agreeable smile in an 8-year-old male patient with hypohidrotic ectodermal dysplasia. After the dental management in this case, the esthetics, phonetics, and chewing functions were rectified significantly. In addition, the parents reported an increased level of self-esteem in their child.

Abstract Background X-linked hypohidrotic ectodermal dysplasia (XLHED) is caused by pathogenic variants of the gene EDA disrupting the prenatal development of ectodermal derivatives. Cardinal symptoms are hypotrichosis, lack of teeth, and hypo- or anhidrosis, but the disease may also evoke other clinical problems. This study aimed at investigating the clinical course of XLHED in early childhood as the basis for an evaluation of the efficacy of potential treatments. Methods 25 children (19 boys and 6 girls between 11 and 35 months of age) with genetically confirmed XLHED were enrolled in a long-term natural history study. Clinical data were collected both retrospectively using parent questionnaires and medical records (pregnancy, birth, infancy) and prospectively until the age of 60 months. General development, dentition, sweating ability, ocular, respiratory, and skin involvement were assessed by standardized clinical examination and yearly quantitative surveys. Results All male subjects suffered from persistent anhidrosis and heat intolerance, although a few sweat ducts were detected in some patients. Sweating ability of girls with XLHED ranged from strongly reduced to almost normal. In the male subjects, 1–12 deciduous teeth erupted and 0–8 tooth germs of the permanent dentition became detectable. Tooth numbers were higher but variable in the female group. Most affected boys had no more than three if any Meibomian glands per eyelid, most girls had fewer than 10. Many male subjects developed additional, sometimes severe health issues, such as obstructive airway conditions, chronic eczema, or dry eye disease. Adverse events included various XLHED-related infections, unexplained fever, allergic reactions, and retardation of psychomotor development. Conclusions This first comprehensive study of the course of XLHED confirmed the early involvement of multiple organs, pointing to the need of early therapeutic intervention.

X-linked hypohidrotic ectodermal dysplasia (XLHED) is caused by EDA pathogenic variants. Female carriers show several clinical manifestations in variable percentages. We studied 11 Mexican heterozygous females with an EDA variant. The most frequent symptoms were similar to previous reports; however, two females (18%) reported dry eye syndrome, data rarely explored in carriers. The penetrance was 91% with clinical variability that might be related to the location of the mutation and/or to a skewed X-inactivation pattern. Our results highlight the importance of offering molecular testing to potential female carriers and support XLHED as an X-linked entity with incomplete penetrance in females.

In mice, rats, dogs and humans, the growth and function of sebaceous glands and eyelid Meibomian glands depend on the ectodysplasin signalling pathway. Mutation of genes encoding the ligand EDA, its transmembrane receptor EDAR and the intracellular signal transducer EDARADD leads to hypohidrotic ectodermal dysplasia, characterised by impaired development of teeth and hair, as well as cutaneous glands. The rodent ear canal has a large auditory sebaceous gland, the Zymbal’s gland, the function of which in the health of the ear canal has not been determined. We report that EDA-deficient mice, EDAR-deficient mice and EDARADD-deficient rats have Zymbal’s gland hypoplasia. EdaTa mice have 25% prevalence of otitis externa at postnatal day 21 and treatment with agonist anti-EDAR antibodies rescues Zymbal’s glands. The aetiopathogenesis of otitis externa involves infection with Gram-positive cocci, and dosing pregnant and lactating EdaTa females and pups with enrofloxacin reduces the prevalence of otitis externa. We infer that the deficit of sebum is the principal factor in predisposition to bacterial infection, and the EdaTa mouse is a potentially useful microbial challenge model for human acute otitis externa.

Background: Hypohidrotic ectodermal dysplasia (HED) is mainly caused by ectodysplasin A (EDA) gene mutation. Fetus with genetic deficiency of EDA can be prenatally corrected. This study aimed at revealing the pathogenesis of two HED families and making a prenatal diagnosis for one pregnant female carrier. Designs: Genomic DNA was extracted from two HED patients and sequenced using whole exome sequencing (WES). The detected mutations were confirmed in patients and family members using Sanger sequencing. The expression of soluble ectodysplasin A1 (EDA1) protein was studied by western blot. The transcriptional activity of NF‐κB pathway was tested by dual luciferase assay. The genomic DNA of fetus was extracted from shed chorion cells and EDA gene was screened through Sanger sequencing. Results: We identified two novel EDA mutations: c.1136T>C (p.Phe379Ser) and c.[866G>C;868A>T] (p.[Arg289Pro;Ser290Cys]). Further examinations revealed that these two mutated EDA1 proteins showed completely impaired solubility, and the transcriptional NF‐κB activation induced by these missense mutant‐type EDA1 proteins was significantly reduced compared with wild‐type EDA1. Furthermore, the analysis of amniotic fluid samples from a pregnant heterozygote indicated that the fetus was a c.1136T>C mutation female carrier. Conclusions: This study extended the mutation spectrum of X‐linked hypohidrotic ectodermal dysplasia (XLHED) and applied prenatal diagnosis for the pregnant carrier, which can be helpful in genetic counseling, prenatal diagnosis, and intervention for the XLHED family. [ABSTRACT FROM AUTHOR]

Abstract Background Hypohidrotic ectodermal dysplasia (HED) is mainly caused by ectodysplasin A (EDA) gene mutation. Fetus with genetic deficiency of EDA can be prenatally corrected. This study aimed at revealing the pathogenesis of two HED families and making a prenatal diagnosis for one pregnant female carrier. Designs Genomic DNA was extracted from two HED patients and sequenced using whole exome sequencing (WES). The detected mutations were confirmed in patients and family members using Sanger sequencing. The expression of soluble ectodysplasin A1 (EDA1) protein was studied by western blot. The transcriptional activity of NF‐κB pathway was tested by dual luciferase assay. The genomic DNA of fetus was extracted from shed chorion cells and EDA gene was screened through Sanger sequencing. Results We identified two novel EDA mutations: c.1136T>C (p.Phe379Ser) and c.[866G>C;868A>T] (p.[Arg289Pro;Ser290Cys]). Further examinations revealed that these two mutated EDA1 proteins showed completely impaired solubility, and the transcriptional NF‐κB activation induced by these missense mutant‐type EDA1 proteins was significantly reduced compared with wild‐type EDA1. Furthermore, the analysis of amniotic fluid samples from a pregnant heterozygote indicated that the fetus was a c.1136T>C mutation female carrier. Conclusions This study extended the mutation spectrum of X‐linked hypohidrotic ectodermal dysplasia (XLHED) and applied prenatal diagnosis for the pregnant carrier, which can be helpful in genetic counseling, prenatal diagnosis, and intervention for the XLHED family.

Background: Hypohidrotic ectodermal dysplasia (HED) is a group of genodermatoses in which deficient ectodysplasin A signalling leads to maldevelopment of skin appendages, various eccrine glands, and teeth. Individuals with HED often have disrupted epithelial barriers and, therefore, were suspected to be more susceptible to coronavirus infection.Methods: 56 households with at least one member who had coronavirus disease of 2019 (COVID-19) were enrolled in a longitudinal study to compare the course of illness, immune responses, and long-term consequences of severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) infection in HED patients (n = 15, age 9-52 years) and control subjects of the same age group (n = 149).Results: In 14 HED patients, mild or moderate typical COVID-19 symptoms were observed that lasted for 4-45 days. Fever during the first days sometimes required external cooling measures. The course of COVID-19 was similar to that in control subjects if patients developed antibodies blocking the SARS-CoV-2 spike protein. Five out of six HED patients with completely abrogated ectodysplasin A signalling (83%) suffered from chronic, in two cases very severe fatigue following COVID-19, while only 25% of HED patients with residual activity of this pathway and 21% of control subjects recovering from COVID-19 experienced postinfectious fatigue. Hair loss after COVID-19 was also more frequent among HED patients (64%) than in the control group (13%).Conclusions: HED appears to be associated with an increased risk of long-term consequences of a SARS-CoV-2 infection. Preventive vaccination against COVID-19 should be recommended for individuals affected by this rare genetic disorder. [ABSTRACT FROM AUTHOR]

Abstract Background In mammals, hypohidrotic ectodermal dysplasia (HED) is a genetic disorder that is characterized by sparse hair, tooth abnormalities, and defects in cutaneous glands. Only four genes, EDA, EDAR, EDARADD and WNT10A account for more than 90% of HED cases, and EDA, on chromosome X, is involved in 50% of the cases. In this study, we explored an isolated case of a female Holstein calf with symptoms similar to HED. Results Clinical examination confirmed the diagnosis. The affected female showed homogeneous hypotrichosis and oligodontia as previously observed in bovine EDAR homozygous and EDA hemizygous mutants. Under light microscopy, the hair follicles were thinner and located higher in the dermis of the frontal skin in the affected animal than in the control. Moreover, the affected animal showed a five-fold increase in the number of hair follicles and a four-fold decrease in the diameter of the pilary canals. Pedigree analysis revealed that the coefficient of inbreeding of the affected calf (4.58%) was not higher than the average population inbreeding coefficient (4.59%). This animal had ten ancestors in its paternal and maternal lineages. By estimating the number of affected cases that would be expected if any of these common ancestors carried a recessive mutation, we concluded that, if they existed, other cases of HED should have been reported in France, which is not the case. Therefore, we assumed that the causal mutation was dominant and de novo. By analyzing whole-genome sequencing data, we identified a large chromosomal inversion with breakpoints located in the first introns of the EDA and XIST genes. Genotyping by PCR-electrophoresis the case and its parents allowed us to demonstrate the de novo origin of this inversion. Finally, using various sources of information we present a body of evidence that supports the hypothesis that this mutation is responsible for a skewed inactivation of X, and that only the normal X can be inactivated. Conclusions In this article, we report a unique case of X-linked HED affected Holstein female calf with an assumed full inactivation of the normal X-chromosome, thus leading to a severe phenotype similar to that of hemizygous males.

Hypohidrotic ectodermal dysplasia (HED) is a rare disorder which is characterized by the involvement of all ectodermal derivatives and marked deficiency of sweating. It has a prevalence of 1: 100,000. X-linked recessive fashion is the most common pattern of inheritance, and 90% of the individuals affected are males. Autosomal dominant and recessive forms of this disease are very rare. Here, a 24-year-old female presented with classical features of HED: sparse lusterless hair, everted lips, and artificial dentures with a history of hypodontia in childhood. Patient's niece had complaints of decreased hair growth and sweating since birth. The patient also gave a history of similar complaints in great grandmother. Hence, we present an uncommon scenario where three females of an extended family were affected with HED and had symptoms of varying severity.

The term ectodermal dysplasias (EDs) describes a heterogeneous group of inherited developmental disorders that affect several tissues of ectodermal origin. The most common form of EDs is hypohidrotic ectodermal dysplasia (HED), which is characterized by hypodontia, hypotrichosis, and partial or total eccrine sweat gland deficiency. HED is estimated to affect at least 1 in 17,000 people worldwide. Patients with HED have characteristic facies with periorbital hyperpigmentation, depressed nasal bridge, malar hypoplasia, and absent or sparse eyebrows and eyelashes. The common ocular features of HED include madarosis, trichiasis, and ocular chronic surface disease due to dry eye syndrome, which manifests clinically with discomfort, photophobia, and redness. Dry eye is common in HED and results from a combination of ocular surface defects: mucus abnormalities (abnormal conjunctival mucinous glands), aqueous tear deficiency (abnormalities in the lacrimal gland) and lipid deficiency (due to the partial or total absence of the meibomian glands; modified sebaceous glands with the tarsal plate). Sight-threatening complications result from ocular surface disease, including corneal ulceration and perforation with subsequent corneal scarring and neovascularization. Rare ocular features have been reported and include bilateral or unilateral congenital cataracts, bilateral glaucoma, chorioretinal atrophy and atresia of the nasolacrimal duct. Recognition of the ocular manifestations of HED is required to perform clinical surveillance, instigate supportive and preventative treatment, and manage ocular complications.

BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

Abstract Background Hypohidrotic ectodermal dysplasia (HED) is a common recessive X-linked hereditary disease that affects the development of ectoderm. Gene mutations of ectodysplasin A (EDA) play key roles in process of this disease. In our preliminary study, three unknown mutation sites (c.878 T > G, c.663-697del and c.587-615del) were detected from the pedigrees of HED. Methods Conservation analysis of the related homologous proteins in 3 unknown EDA gene mutation sites was conducted using the University of California Santa Cruz (UCSC) Genome Browser database. SIFT and PolyPhen-2, the online gene function prediction software, were utilized to predict the pathogenicity of point mutation of c.878 T > G. Results All three unknown mutation sites were located in the highly-conserved region of EDA and possessed strong amino acid conservation among different species. In addition, the results of the pathogenicity prediction of point mutation of c.878 T > G by SIFT (P = 0.00) and PolyPhen-2 (S = 0.997) demonstrated that the mutation site had considerable pathogenicity theoretically. Conclusions The EDA mutations of c.878 T > G, c.663-697del and c.587-615del may be responsible for the pathogenesis of HED in their pedigrees.

Christ–Siemens–Touraine syndrome/hypohidrotic ectodermal dysplasia (HED) is a heterogeneous group of inherited disorders with primary defects in tissues derived from embryonic ectoderm such as hair, tooth, nail, and sweat glands. To date, more than 192 distinct disorders have been described. Here we present a case of 19-year-old female patient that manifested with HED (Christ-Siemens-Touraine syndrome).

Introduction. Ectodermal dysplasia is a group of genetically determined disorders manifesting in the developmental malfunction of ectodermal structures: teeth, hair, nails and skin glands. Objective. We present the case of a 22-month-old boy with diagnosed hypohydrotic ectodermal dysplasia and the literature review. Case report. A 22-month-old boy was admitted to the Dermatology Department because of severe itching and erythematous skin patches in flexural areas. During the physical examination, in addition to skin lesions, hypodontia, hypotrichosis and hypohidrosis were found. The diagnosis of hypohidrotic ectodermal dysplasia was established. As the criteria of Hanifin and Rajka were met, the boy was also diagnosed with atopic dermatitis. Conclusions. Although hypohidrotic ectodermal dysplasia is a condition with good prognosis, a wide range of associated facial abnormalities, dental problems and other concomitant defects make patients' quality of life markedly impaired. Patients and their families need dental implant surgery, treatment of co-morbidities, psychological counselling and support. [ABSTRACT FROM AUTHOR]

X-linked hypohidrotic ectodermal dysplasia (XLHED) is caused by EDA pathogenic variants. Female carriers show several clinical manifestations in variable percentages. We studied 11 Mexican heterozygous females with an EDA variant. The most frequent symptoms were similar to previous reports; however, two females (18%) reported dry eye syndrome, data rarely explored in carriers. The penetrance was 91% with clinical variability that might be related to the location of the mutation and/or to a skewed X-inactivation pattern. Our results highlight the importance of offering molecular testing to potential female carriers and support XLHED as an X-linked entity with incomplete penetrance in females. [ABSTRACT FROM AUTHOR]

Background: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. Methods: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype–phenotype correlations. Results: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). Conclusions: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling. [ABSTRACT FROM AUTHOR]

Background: X-linked hypohidrotic ectodermal dysplasia (XLHED) is caused by pathogenic variants of the gene EDA disrupting the prenatal development of ectodermal derivatives. Cardinal symptoms are hypotrichosis, lack of teeth, and hypo- or anhidrosis, but the disease may also evoke other clinical problems. This study aimed at investigating the clinical course of XLHED in early childhood as the basis for an evaluation of the efficacy of potential treatments.Methods: 25 children (19 boys and 6 girls between 11 and 35 months of age) with genetically confirmed XLHED were enrolled in a long-term natural history study. Clinical data were collected both retrospectively using parent questionnaires and medical records (pregnancy, birth, infancy) and prospectively until the age of 60 months. General development, dentition, sweating ability, ocular, respiratory, and skin involvement were assessed by standardized clinical examination and yearly quantitative surveys.Results: All male subjects suffered from persistent anhidrosis and heat intolerance, although a few sweat ducts were detected in some patients. Sweating ability of girls with XLHED ranged from strongly reduced to almost normal. In the male subjects, 1-12 deciduous teeth erupted and 0-8 tooth germs of the permanent dentition became detectable. Tooth numbers were higher but variable in the female group. Most affected boys had no more than three if any Meibomian glands per eyelid, most girls had fewer than 10. Many male subjects developed additional, sometimes severe health issues, such as obstructive airway conditions, chronic eczema, or dry eye disease. Adverse events included various XLHED-related infections, unexplained fever, allergic reactions, and retardation of psychomotor development.Conclusions: This first comprehensive study of the course of XLHED confirmed the early involvement of multiple organs, pointing to the need of early therapeutic intervention. [ABSTRACT FROM AUTHOR]

Ectodermal dysplasia (ED) is a rare hereditary disorder involving two or more of the ectodermal structures, which include the skin, hair, nails, teeth, and sweat glands. The two most common forms of the disease are hypohidrotic/anhidrotic ED and hidrotic ED. They are caused by the mutations of several genes. We present a case of a 9-year-old child with hypohidrotic ED, who presented with hypodontia, dyshidrosis, hypotrichosis, and raised body temperature. We treated the raised body temperature symptomatically with cooling techniques and antipyretics. A multidisciplinary approach with physicians from several fields is required to provide comprehensive medical care to patients with ED.

Hypohidrotic ectodermal dysplasia (HED) is a rare genetic condition resulting from defective development of ectodermal derivatives, such as hair, teeth, and sweat glands. Autosomal recessive (AR) forms of HED may be caused by pathogenic variants of the ectodysplasin A1 receptor (EDAR) gene that encodes a receptor involved in the NF‐κB signaling pathway. Here, we describe three cases of AR‐HED in families of Turkish, Austrian, and German‐American origin (with or without known consanguinity). In these cases, two out‐of‐frame deletions and a pathogenic missense variant of EDAR were found to be disease‐causing due to reduced availability of the respective messenger RNA or impaired interaction of the encoded protein with its binding partner leading to diminished signal transduction. The same missense variant, c.1258C>T (p.Arg420Trp), has actually been reported to be restricted to the Icelandic population and to be associated with non‐syndromic tooth agenesis but not HED. As our patient has no known relationship to Icelandic individuals and displays a rather severe HED phenotype, we suggest that EDAR‐Arg420Trp is a more widespread variant, possibly with variable clinical expressivity. Phenotypic, molecular, and functional analysis of three cases of autosomal recessive hypohidrotic ectodermal dysplasia, caused by two out‐of‐frame deletions and a pathogenic missense variant of the gene EDAR (p.Arg420Trp). The latter has actually been reported to be restricted to Icelandic individuals. As the homozygous patient (figure) has no known relationship to the Icelandic population, we suggest this variant to be a more widespread one with variable clinical expressivity. [ABSTRACT FROM AUTHOR]

The hypohidrotic ectodermal dysplasia (HED) is a rare genetic disease characterized by the absence or deficiency function of the ectodermal derivatives. Ocular involvement includes dry eyes, cataract, blefaritis, and alterations of meibomian glands. However, keratoconus has not been included as a manifestation in the literature. We report the case of a 17-year-old male who presented HED and keratoconus, an ocular manifestation seldomly related to this syndrome. The patient was submitted to a contact lens fitting, and the final visual acuity was 0.1 logMAR in both eyes. Therefore, to the best of our knowledge, our patient can be considered the fourth patient diagnosed with keratoconus and HED simultaneously worldwide. The uniqueness and rarity of this syndrome associated with keratoconus, as well as the satisfactory contact lens fitting, motivated this case report, which can provide useful information and alert to this possible etiological association. [ABSTRACT FROM AUTHOR]

Introduction. Chronic rhinitis in children may have different causes, both local – with changes being present only in the nasalcavity – or systemic, with nasal congestion as one of the symptoms of a bigger clinical picture.Aim. the aim of this study was to draw attention to a very rare congenital cause of chronic rhinitis in children – which is hypohidrotic ectodermal dysplasia.Material and methods. A 6-month-old boy was admitted to the department of pediatric otolaryngology of Warsaw medicalUniversity due to chronic nasal obstruction present from birth. Clinical investigation included anterior and posterior rhinoscopy and fiberoscopy of nasopharynx. the mri was also performed before admission. Complete blood count, serum iron level,serum thyroid hormones and level of igG, igA, igm were examined to exclude anaemia, ozaena and hypothyroidism. Antinuclear antibodies (AnA) and antineutrophil cytoplasmic antibodies (AnCA) tests were also ordered to exclude granulomatosiswith polyangiitis. next, a mucosal biopsy of the nasal cavity was performed to exclude primary ciliary dyskinesia. Allergic pricktests were also performed.Results. After genetic tests, hypohidrotic ectodermal dysplasia was diagnosed.Conclusions. 1. every case of chronic nasal congestion in children requires not only adequate treatment, but also thoroughclinical investigation. 2. nasal obstruction may be due to local causes, systemic diseases and genetic disorders. 3. hypohidroticectodermal dysplasia is a very rare genetic disorder that causes severe, even life threatening symptoms, one of which is chronicrhinitis.

Genodermatoses are an inherited disorder, present with multisystem involvement. Help us to identify regular mutations and appalling skin diseases with recessive inheritance. Genetic heterogeneity is very common, and molecular diagnosis requires a broad effort. Recurrent mutations in unrelated families were seen in families with xeroderma, Griscelli. It seems likely that eventually oligonucleotide arrays will replace most other methods for routine mutation scanning of the more common diseases and planned sequencing will be increasingly used for rarer diseases.

Ectodermal dysplasia (ED) represents a group of inherited conditions characterized by anomalies in two or more structures of ectodermal origin, which can be presented as problems related to hair, nail, teeth, sweat glands, and sebaceous glands. Based on clinical findings, there are two major types of this disorder: (1) Hypohidrotic/anhidrotic and (2) hidrotic ED. The anhidrotic/hypohidrotic ED (HED) is the more severe form and is associated with more dental defects. This article presents with prosthetic rehabilitation including removable partial and complete denture and implant supported overdenture of two male children of a family presenting with HED.

Objectives: To analyse the pathogenic genes in a patient with hypohidrotic ectodermal dysplasia (HED) and explore the relationship between pathogenic genes and the oligodontia phenotype., Methods: Clinical data and peripheral blood were collected from a patient with HED. Pathogenic genes were analysed by whole-exon sequencing (WES) and verified by Singer sequencing. The secondary and tertiary structures of the variant proteins were predicted to analyse their toxicity., Results: The patient exhibited a severe oligodontia phenotype, wherein only two deciduous canines were left in the upper jaw. WES revealed a hemizygous EDA variant c.466C > T p.(Arg156Cys) and a novel heterozygous EVC2 variant c.1772T > C p.(Leu591Ser). Prediction of the secondary and tertiary structures of the EDA variant p.(Arg156Cys) and EVC2 variant p.(Leu591Ser) indicated impaired function of both molecules., Conclusion: The patient demonstrated a more severe oligodontia phenotype when compared with the other patients caused by the EDA variant c.466C > T. Since Evc2 is a positive regulator of the Sonic Hedgehog (Shh) signal pathway, we speculated that the EVC2 variant p.(Leu591Ser) may play a synergistic role in the oligodontia phenotype of HED, thereby exacerbating the oligodontia phenotype. Knowledge of oligodontia caused by multiple gene variants is of great significance for understanding individual differences in oligodontia phenotypes., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2023 The Authors. Published by Elsevier Ltd.)

The hypohidrotic ectodermal dysplasia (HED) is a rare genetic disease characterized by the absence or deficiency function of the ectodermal derivatives. Ocular involvement includes dry eyes, cataract, blefaritis, and alterations of meibomian glands. However, keratoconus has not been included as a manifestation in the literature. We report the case of a 17-year-old male who presented HED and keratoconus, an ocular manifestation seldomly related to this syndrome. The patient was submitted to a contact lens fitting, and the final visual acuity was 0.1 logMAR in both eyes. Therefore, to the best of our knowledge, our patient can be considered the fourth patient diagnosed with keratoconus and HED simultaneously worldwide. The uniqueness and rarity of this syndrome associated with keratoconus, as well as the satisfactory contact lens fitting, motivated this case report, which can provide useful information and alert to this possible etiological association.

Ectodermal dysplasias are a large hereditary group of disorders which are usually manifested as X-linked recessive disorders and have a full expression in males, whereas females show little to no signs of the disorder. The two most common types of ectodermal dysplasias are hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine syndrome) and hidrotic ectodermal dysplasia (Clouston syndrome). Hypohidrotic ectodermal dysplasia is characterized by hypodontia, hypotrichosis, and hypohidrosis. Here, we present two female sibling cases of hypohidrotic ectodermal dysplasia.

Christ–Siemens–Touraine syndrome/hypohidrotic ectodermal dysplasia (HED) is a heterogeneous group of inherited disorders with primary defects in tissues derived from embryonic ectoderm such as hair, tooth, nail, and sweat glands. To date, more than 192 distinct disorders have been described. Here we present a case of 19-year-old female patient that manifested with HED (Christ-Siemens-Touraine syndrome). [ABSTRACT FROM AUTHOR]

Background: Anhidrotic ectodermal dysplasia (EDA) is a rare genodermatosis that causes developmental defects in ectoderm-derived structures. The clinical triad consists of hypodontia, hypotrichosis, and anhidrosis with other additional symptoms. The aim of this study is to summarize the clinical manifestations, family history, histopathological findings of the skin, and gene mutations in EDA patients who presented at a medical center in order to make the disease better known among medical personnel. Methods: A retrospective review of the medical charts and photographs of patients diagnosed with EDA at the Department of Dermatology, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University from June 1988 through May 2011 was performed. Information about the clinical manifestations, family history, histopathological findings of the skin, and genetic mutations was collected, and the initial presenting symptoms that lead to seeking medical services were determined. Results: One female patient and seven male patients were identified. The triad was present in all patients, in addition to other variable features. Five patients had a positive family history, while three of them were from the same family. Histopathological findings noted in the skin biopsies included the absence of sweat glands on the palmar skin. Genetic mutations were detected in six of seven patients in this study, but there was no genotype-phenotype correlation. The initial presentations most commonly noted were the absence of sweating with episodic hyperthermia since birth. Eczema since infancy was the main reason why these patients visited the dermatology department following the diagnosis of EDA. Conclusions: EDA is a rare genodermatosis, and it is invariably characterized by its clinical triad. Family history and genetic analysis help in the diagnosis. The dermatologist, pediatrician, and dentist are usually the medical personnel that these patients first visit, and therefore these individuals should be acquainted with this disease in order to provide appropriate care.

The ectodermal dysplasias are heterogenous group of inherited disorders with primary defects in tissues derived from embryonic ectoderm such as hair, tooth, nail and sweat gland. This disorder is broadly divided into hypohidrotic or anhidrotic and hidrotic forms. Here, we present a classical x-linked hypohidrotic ectodermal dysplasia with finger clubbing, the association of which is not being reported earlier.