Search

Highlights • Large scale PS MCC film was obtained by combining spin-coating and lifting up method. • SDS solution was used to reduce the PS particle space. • The lifting-up process repaired the defects of PS films. • Hybrid film microlens array was obtained using the PS film as a mask. Abstract PS microspheres emulsions with different PS diameters of 207 and 378 nm were prepared by using an emulsifier-free polymerization method. A novel secondary self-assembly method which combined the spin coating and the lifting-up method was used to prepare the close-packed PS MCC films. During the process, the PS MCC film was firstly assembled on a glass substrate by a spin coating technique. Secondly, the obtained PS MCC film was transferred on the air-water interface by immersing the PS glass substrate in water using a dip-coater. Thirdly, the floating close-packed PS MCC films on the air-water interface was transferred to a new glass substrate by using a lifting-up method. During the spin-coating and the self-assembly process, some SDS solution was added in the PS films to improve the uniformity of the PS layer. Effects of the spin-coating speeds, the SDS solution concentration and the lifting-up rates on the morphology of PS MCC films have been discussed. Scanning electron microscopy was used to observe the morphological properties of the PS colloidal crystal films. Results indicate that a relatively close-packed and large scale PS MCC films can be obtained when the spinning speed is 2000 rpm for 60 s, the SDS solution concentration is 2 wt% and the lifting-up rate is 2 mm/min. Furthermore, the polydimethylsiloxane soft mold was replicated from the-fabricated PS MCC films and was then imprinted onto the photosensitive hybrid film under UV-irradiation and thus the micro-lens arrays built in the photosensitive hybrid sol–gel film were obtained. [ABSTRACT FROM AUTHOR]

The acoustic beamforming has been widely applied in the imaging of flow-induced aeroacoustic sound sources. However, the measured signals of the rotor blades often accompanied with the unwanted interference from other components of the experimental setup in the wind tunnel test (for example, the rotor shaft and the stand), which results in the undistinguished sources in the beamforming result. In this paper, the signals of rotor blades are defined first as the cyclostationary process based on the Ffowcs Williams-Hawkings (FW-H) equation in the form of Wold-Cramer decomposition, which connects the statistical definition of rotor blades signals with the wave propagation model of moving sources. Then the developed cyclostationary signal processing tools of a second order, specifically the reduced-rank cyclic Wiener filter, can be applied in the wind tunnel test of rotor blades. The rotor blades signals can be extracted from the noisy measurements with other interferences, which aide to purify the image results of beamforming in the final experiment of wind tunnel test. [ABSTRACT FROM AUTHOR]

The Cambrian strata in Tarim basin is mainly evaporate platform facies dolomite. Due to the lack of trilobite fossils, it is hardly to achieve isochronous stratigraphic division and correlation. The Xiaoerbulake outcrop and Fang 1 well are typical surface and subsurface Cambrian sections in Tarim Basin respectively. Shayilike, Awatage and Xiaqiulitage Groups were regarded as the complete Upper -Middle Cambrian previously which composed of dolomite. The carbon isotope values range from –15.5 to 2‰, and three negative excursions are found (N1, N2 and N3). Comparing with the Global Standard Chronostratigraphic Scale for the Middle and Upper Cambrian System, the fifth stage and the Drumian of the third Series, the ninth and the tenth Stage of Furongian Series can be recognized, while the Guzhangian and Paibian are lost. As a result, the Cambrian Formation in Tarim Basin can be divided accurate to stage scale. [ABSTRACT FROM AUTHOR]

Abstract To improve the mechanical and electrical properties of natural rubber (NR), we used cellulose nanofibrils (CNF) as biotemplates, dispersing conductive graphene composites at 10% and 7.5% and coated graphenes (GNS) between natural rubber molecules on the CNF surface by solution blending. The conductive CNF-GNS/NR nanocomposite material was prepared by dispersing and overlapping CNF and GNS in NR to form a three-dimensional multi-layered network structure composite. The product was characterized by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR), tensile testing, and conductivity testing. Results show that the combination of GNS and CNF did not clearly change the GNS chain, did not destroy the GNS structure, and maintained GNS conductivity. When 10% GNS was added, the draw ratio of the CNF-GNS/NR composite was 208%, 56% higher than that of pure NR. The tensile strength increased by 340% compared with pure NR and was 79% higher than that of CNS without CNF. The percolation threshold of CNF-GNS/NR was between 5 and 7.5 phr, lower than the 7.5–10 phr permeation threshold of GNS-NR. When 7.5% GNS was added, the conductivity of CNF-GNS/NR was 3.80 × 10−2 S/m. Compared to the conductivity of 1.25 × 10−6 S/m GNS-NR, the improvement was approximately 4 orders of magnitude. The percolation threshold of CNF-GNS/NR composites was significantly lower than that of composites without CNF. Thus, the addition of CNF can reduce the percolation threshold of composites. Using CNF as a biological template to construct a multi-level three-dimensional conductive network in NR can improve the conductive properties of NR composites substantially. Graphical abstract Image Highlights • This work presents the results of natural rubber modified by nanofilament/graphene. • This study is engaged in the modification compound, microstructure, and mechanical properties of natural rubber. • XDR, SEM, IR, tensile test, and conductivity test were used as scientific analytical methods. • GNS chain, conductivity, tensile strength, and percolation threshold of modified rubber were examined in detail. • The results of this work can provide a good prospect for the application of modified natural rubber. [ABSTRACT FROM AUTHOR]

A long-term sublimation model to explain how Phaethon could provide the Geminid stream is proposed. We find that it would take ∼6 Myr or more for Phaethon to lose all of its internal ice (if ever there was) in its present orbit. Thus, if the asteroid moved from the region of a 5:2 or 8:3 mean motion resonance with Jupiter to its present orbit less than 1 Myr ago, it may have retained much of its primordial ice. The dust mantle on the sublimating body should have a thickness of at least 15 m but the mantle could have been less than 1 m thick 1000 yr ago. We find that the total gas production rate could have been as large as |$10^{27}\rm \,s^{-1}$| then, and the gas flow could have been capable of lifting dust particles of up to a few centimetres in size. Therefore, gas production during the past millennium could have been sufficient to blow away enough dust particles to explain the entire Geminid stream. For present-day Phaethon, the gas production is comparatively weak. But strong transient gas release with a rate of |${\sim }4.5\times 10^{19}\rm \,m^{-2}\,s^{-1}$| is expected for its south polar region when Phaethon moves from 0° to 2° mean anomaly near perihelion. Consequently, dust particles with radii of <∼260 μm can be blown away to form a dust tail. In addition, we find that the large surface temperature variation of >600 K near perihelion can generate sufficiently large thermal stress to cause fracture of rocks or boulders and provide an efficient mechanism to produce dust particles on the surface. The time-scale for this process should be several times longer than the seasonal thermal cycle, thereby dominating the cycle of appearance of the dust tail. [ABSTRACT FROM AUTHOR]

Highlights • We validated that the combined usage of direct sequencing and MLPA can achieve a high detection rate in Chinese Han PJS patients. • We found significantly more splice mutations in Chinese Han PJS patients. • We suggest that wide usage of enteroscopy would be helpful in PJS surveillance. Abstract Background The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. Aims To test the efficacy of the combination in Chinese patients with PJS. Methods PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. Results We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. Conclusion The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance. [ABSTRACT FROM AUTHOR]

An arbitrated quantum multi-proxy blind signature scheme, which is based on four-qubit cluster states, is proposed in this paper. This scheme satisfies all the characteristics of a multi-proxy blind signature scheme. To guarantee the security of this scheme, some quantum technologies such as quantum key distribution (QKD) protocol, eavesdropping check, quantum one-time pad and quantum secure direct communication (QSDC) protocol are used. Analysis results show that our scheme is secure. [ABSTRACT FROM AUTHOR]

Abstract The sheet-pile wall is widely combined with anchoring frame beam to support high slope in Geotechnical Engineering. However, the dynamic characteristics of the sheet-pile wall with anchoring frame beam subjected to seismic excitation are not clear, and the seismic design for such combined structure is still performed based on pseudo-static method or experience. The combination effect will probably induce an interaction between the sheet-pile wall and the anchoring frame beam, which subsequently makes the seismic behavior of such combined structure more complex. In this study, numerical simulation and shaking table test were carried out to investigate the seismic response of the sheet-pile wall with anchoring frame beam by applying Wenchuan ground motion with different amplitudes. The acceleration response, the earth pressure response and the axial stress of anchor were studied in time domain, and the failure mode of structure was obtained by analyzing the element state at different excitation moment. The influence of the excitation amplitudes on the seismic response of sheet-pile wall with anchoring frame beam was also studied regarding the acceleration amplification, the residual earth pressure, the peak earth pressure response, the distribution of anchor stress and the element state of structure. The results show that the acceleration response of sheet-pile wall with anchoring frame beam is less intense while experiencing another equal seismic excitation. The acceleration amplification of anchoring frame beam is greater than that of sheet-pile wall. The residual earth pressure behind sheet-pile wall increases with an increase in excitation amplitude, especially at the top of sheet-pile wall. The peak earth pressure response at the back of sheet-pile wall increases along the wall height, while it presents a decreasing trend behind anchoring frame beam. The anchor is more likely to fail at the beginning of earthquake. The axial stress of anchor increases nonlinearly with an increase in excitation amplitude, and the increasing ratio increases for a larger value of input acceleration. The outer surface of soil deposit experiences repeated tension and shear failures. The element state of structure changes greatly during the intense periods of seismic excitation. Highlights • Response of sheet pile wall with anchoring frame beam is studied by simulation & test. • The acceleration, earth pressure and anchor stress were studied in time domain. • The effect of excitation amplitudes on response of retaining structure is analyzed. • The failure mode of retaining structure was discussed by analyzing the element state. [ABSTRACT FROM AUTHOR]

The transient performances of impeller machinery under typical mutational working conditions play an important role in the area of engineering and have attracted extensive attention. In order to fully understand transient behaviors of impeller machinery under mutational working conditions, it is very necessary to confirm an efficient and reliable solving method. In this paper, the dynamic mesh method and the sliding mesh method are respectively used to be solved the inner transient flow of a 2D centrifugal pump model during abrupt start-up period. The  Renormalization-group (RNG) k–ε turbulence model in eddy viscosity models is chosen to close the Reynolds-average equation and to complete the turbulence calculation. Moreover, the SIMPLE algorithm is also adapted to accomplish the coupling calculation between velocity and pressure. The study shows that in theory, the most appropriate method to solve transient flow is the dynamic mesh method, but it has the shortage of low mesh quality during mesh reconstruction. The sliding mesh method with high mesh quality is an ideal solving method under mutational working conditions. In general, both of the methods would reflect the basic characteristics of inner flow, while the sliding mesh method has higher solution precision. [ABSTRACT FROM AUTHOR]

Development of N‐doped carbon nanotubes (CNTs) with a hollow structure is extremely important for its application to electrochemical catalysis and energy storage. Here we demonstrate a facile synthesis of N‐doped CNTs from direct pyrolysis of a mixture of nickel salt (or nickel / cobalt salts), glucose and dicyandiamide, in which both the N‐doping process and the synthesis of carbon nanotubes are completed. The resulting hybrid N−C composites with high N doping contents show an emblematic tubular morphological structure revealing a hollow interior. Nickel salt is found to be an essential growth catalyst of these N‐doped CNTs and the as‐obtained tubular structure is about 27 nm in diameter in the presence of nickel and cobalt salts. All the as‐prepared catalysts display a comparable onset potential and high current density for ORR compared to Pt/C both in acidic and in alkaline media. Ni−Co/C−N‐HT catalyst even displays an extremely high ORR limiting current density of 7.17 mA cm ‐2@1600 rpm in acidic media, which is more than 1.3 times larger than the Pt/C. ORR in acidic solution takes place via a four‐electron mechanism. And for most of the catalysts a four‐electron mechanism of ORR in alkaline medium also prevails over a two‐electron mechanism. C−N 1D nanoparticles with a distinguishable hollow tubular structure were prepared via a facile one‐step pyrolysis by using dicyandiamide as the nitrogen source. The prepared catalysts present excellent ORR performance whether in an alkaline solution or an acidic solution, characterized by high limiting diffusion current density and comparable ORR onset potential to Pt/C. [ABSTRACT FROM AUTHOR]

Itchiness triggers a strong urge to engage in scratching behavior, which could lead to severe skin or tissue damage in patients with chronic itch. This process is dynamically modulated. However, the neural mechanisms underlying itch modulation remain largely unknown. Here, we report that dopaminergic (DA) neurons in the ventral tegmental area (VTA) play a critical role in modulating itch-induced scratching behavior. We found that the activity of VTA DA neurons was increased during pruritogen-induced scratching behavior in freely moving male mice. Consistently, individual VTA DA neurons mainly exhibited elevated neural activity during itch-induced scratching behavior as demonstrated by in vivo extracellular recording. In behavioral experiments, the transient suppression of VTA DA neurons with the optogenetic approach shortened the pruritogen-induced scratching train. Furthermore, the DA projection from the VTA to the lateral shell of the nucleus accumbens exhibited strong activation as measured with fiber photometry during itch-elicited scratching behavior. These results revealed the dynamic activity of VTA DA neurons during itch processing and demonstrated the modulatory role of the DA system in itch-induced scratching behavior. [ABSTRACT FROM AUTHOR]

Graphical abstract Highlights • S, Se and Te-doped NaTaO 3 is a promising material for photocatalytic water splitting. • Enhanced absorption coefficient in the visible light range is identified for Te-doped NaTaO 3. • Te-doped NaTaO 3 exhibits higher electron and hole mobility than pristine NaTaO 3. Abstract The photocatalytic hydrogen production from water splitting can be achieved by using the pristine NaTaO 3 experimentally, but the reaction cannot be driven by the visible light because of the wide band gap of NaTaO 3. The present work focuses on tuning the photocatalytic performance of NaTaO 3 into the visible light range by doping S, Se, and Te elements. The obvious decrease in band energy gaps ( E g s) and noticeable red-shift of the absorption edges are observed for the doped structures. The valence band maximum and conduction band minimum of the doped structures satisfy the requirement of the water splitting. Moreover, a significant enhancement of absorption coefficient in the visible light range is observed for the doped structure of Te@O. The calculated carrier mobility is used to evaluate the charge spatial separation of Te@O and the unusual increases and the obvious differences of the mobility of the electrons and holes are observed. [ABSTRACT FROM AUTHOR]

The exchanged crossed cube, denoted by ECQ(s,t), is a novel graph with fewer edges and smaller diameter compared to other variations of the corresponding hypercube. The ring topology, denoted by Rn, is one of the most popular topologies in Wavelength division multiplexing optical networks. This paper addresses the routing and wavelength assignment problem for realizing ECQ(s,t) communication pattern on Rn, where n=s+t+1. We propose an embedding scheme. Base on the embedding scheme, a wavelength assignment algorithm using 2s+t-2+⌊2t/3⌋ wavelengths is devised. We show that the wavelength assignment algorithm uses no more than 1.25 times of wavelengths compared to the optimal wavelength number, i.e., it is a factor 1.25 approximation algorithm. Moreover, the number of additional required wavelengths is no more than ⌊2t-1/3⌋. [ABSTRACT FROM AUTHOR]

Abstract Autoignition characteristics of decalin, a bicyclic alkane, were investigated in a heated rapid compression machine (RCM) over a wide range of conditions. Ignition delay time (IDT) was measured at compressed pressures of 10, 15 and 20 bar, for equivalence ratios of 0.5, 1.0, 1.5 and 2.0, and at temperatures in the range 631−930 K. Negative temperature coefficient (NTC) behavior of decalin ignition delay time was observed within the temperatures of 750−860 K, in which the ignition delay time increases with rising temperature. The dependence of ignition delay time on compressed pressure, equivalence ratio, and oxygen concentration was systemically studied. A reasonable modification was made to a literature mechanism. The simulation results using the tuned mechanism are found to well capture the dependence of the measured ignition delay time on temperautre, pressure, equivalence ratio, and oxygen concentration over the entire temperature range. Correlation formulas of the simulated and measured ignition delay times were proposed to quantitatively reveal the ignition delay time dependence and to evaluate the mechanism performance. A reaction pathway analysis was carried out at low temperature (700 K), NTC temperature (850 K), and high temperature (1000 K), respectively, to identify the dominant reaction pathways consuming decalin and intermediate species. A sensitivity analysis was also performed at different temperatures and equivalence ratios to find out the important reactions that promote and inhibit decalin autoignition. [ABSTRACT FROM AUTHOR]

By introducing multiple-site correlation functions, we propose a hierarchical Green’s function approach, and apply it to study the characteristic properties of a two-dimensional (2D) square lattice Hubbard model by solving the equation of motions of a one-particle Green’s function and related multiple-site correlation functions. Under a cut-off approximation and taking the Fourier representation of multiple-site correlation functions, we obtain an analytical expression of one-particle Green’s function with static correlation functions. Then we calculate the spectral density function of electrons, and obtain that besides two main peaks corresponding to the lower and upper Hubbard bands in the spectral density function, there emerge some novel states between these two main peaks, and the total spectral weight of these emerged states is proportional to the hole doping concentration δ. Meanwhile, there also emerge some collective modes related to possible charge/spin density wave and/or electronic pairing density wave ordering states. This calculation is completely consistent with the spectroscopy observations of the cuprate superconductors in normal states. On the other hand, the appearance of the static correlation functions in the one-particle Green’s function can be used to describe the intertwined orders observed in the normal state of the cuprate superconductors. [ABSTRACT FROM AUTHOR]

This paper analyzes the influence of stator windings turn-to-turn fault on inverter-fed permanent magnet (PM) machines. By adding a secondary neutral point (NP) in stator windings, the turn fault detection and tolerant capability can all improve considering a small turn-to-turn short at an early stage. From the perspective on fault detection, the proposed windings with two NPs increase the equipment impedance per NP. Once a turn fault occurs, the fault-induced voltage harmonic magnitude increases. It results in a better signal-to-noise ratio for the fault detection. From the perspective on tolerant drive, the fault-induced circulating currents can flow across different phase coils in the windings with two NPs. Reduced effect on circulating currents in a faulty machine is achieved due to the current diversion. Turn fault induced additional losses are then decreased compared to conventional windings with only one NP. A 1-kW PM machine with two different windings is tested to verify the fault detection and tolerant performance. [ABSTRACT FROM AUTHOR]

The exchanged crossed cube, denoted by E C Q (s , t) , is a novel interconnection network with fewer edges and smaller diameter compared to other variations of the corresponding hypercube. The linear array, denoted by L n , is one of the most popular topologies in optical networks. This paper addresses the routing and wavelength assignment for realizing E C Q (s , t) communication pattern on wavelength division multiplexing (WDM) optical network L n , where n = s + t + 1. We prove that the congestion for E C Q (s , t) on L n is equal to 2 s + t − 1 + ⌊ 2 t / 3 ⌋ , which is the lower bound of the minimum number of required wavelengths. In addition, an embedding scheme and an optimal wavelength assignment algorithm that achieve this bound are also proposed. [ABSTRACT FROM AUTHOR]

• A voltage regulation optimization problem is formulated considering source-load-storage collaboration. • An attention-based multi-agent deep reinforcement learning approach is designed for voltage control. • A multi-stage parallel training framework and an evolutionary selection mechanism is adopted to improve the scalability of voltage control. With the increasing penetration of renewable energy in active distribution networks (ADNs), voltage regulation problem is becoming more and more challenging. In this article, we focus on providing a scalable data-driven approach to ensure the voltage security of ADNs with high penetration of PVs. To this end, we first formulate an optimization problem for real-time voltage control considering source-load-storage collaboration while minimizing the total active power curtailment of PVs. Then, we reformulate the above problem as a Markov game and propose a novel voltage regulation algorithm based on evolutionary curriculum-based multi-agent deep reinforcement learning (EC-MADRL) to solve it. The key idea of the proposed algorithm is to adopt a multi-stage parallel training framework based on attention multi-agent deep deterministic policy gradient algorithm (Attention-MADDPG) and use an evolutionary mechanism to select voltage regulation models with high fitnesses in the previous stage, which means that good agents with best adaptability could be utilized for learning in the environment with a larger number of PVs. Simulation results show the effectiveness and scalability of the proposed algorithm. [ABSTRACT FROM AUTHOR]

Four new oxepine-containing pyrazinopyrimidine alkaloids, versicoxepines A − D (1 – 4), two quinolinone alkaloid analogs including 3-hydroxy-6-methoxy-4-phenylquinolin-2(1 H)-one (5) and 3-methoxy-6-hydroxy-4-phenylquinolin-2(1 H)-one (6) which were new naturally occurring compounds, together with two known compounds (7 and 8) were isolated from Aspergillus versicolor AS-212, an endozoic fungus isolated from the deep-sea coral Hemicorallium cf. imperiale , which was collected from the Magellan Seamounts in the Western Pacific Ocean. Their structures were determined by extensive analysis of the spectroscopic and X-ray crystallographic data as well as by chiral HPLC analysis, ECD calculation, and DP4+ probability prediction. Structurally, versicoxepines B and C (2 and 3) represent the first example of a new oxepine-containing pyrazinopyrimidine alkaloid whose cyclic dipeptide moiety is composed of the same type of amino acid (Val or Ile). Compound 5 displayed antibacterial activity against aquatic pathogens, Vibrio harveyi and V. alginolyticus , with MICs of 8 μg/mL. [Display omitted] • Four new oxepine-containing diketopiperazines were isolated from deep-sea coral-derived Aspergillus versicolor AS-212. • Chiral HPLC, ECD and DP4+, and X-ray diffraction were used for structure determination. • Compound 5 exhibited potent activities against aquatic- and plant-pathogenic microbes. [ABSTRACT FROM AUTHOR]

• Spatial knowledge was less grasped under pressure than normal conditions. • People with wayfinding experience rely less on signage, but this effect was not significant at landmarks. • The use of signs near the starting point affects the choice of pedestrian routes. This study aimed to examine differences in the development of spatial knowledge under normal and pressure conditions, as well as differences in the use of signage. To this end, a virtual reality environment of a subway station was developed. We conducted a wayfinding experiment in the environment using a headset device with an eye-tracker. The wayfinding performance and eye-tracking data from 48 participants were recorded and analyzed. The results indicated that spatial knowledge was less grasped under pressure than in normal conditions. Despite the particular diversity across wayfinding conditions, we found a higher reliance on signage among first-time participants. Still, this effect was not significant at landmarks. And the importance of signs near the starting point for route selection was also reported. This study is helpful for understanding the differences in wayfinding and signage use across conditions and provides recommendations for signage design and emergency capacity promotion. [ABSTRACT FROM AUTHOR]

We show that photoluminescence quantum yields (PLQYs) of chromophore-incorporated MOFs can be improved substantially by increasing their structural dimensionality. A novel 3D zinc-based metal–organic framework built on tetrakis(4-carboxyphenyl)ethylene has been developed and its fluorescence compared with that of the 2D parent structure. [ABSTRACT FROM AUTHOR]

In order to realize the lightweight design of mobile pump truck, this paper takes the frame of a certain type of mobile pump truck as the research object. The response surface method is used to carry out lightweight design of the longitudinal beam structure of the frame, and the finite element method is used to establish the finite element model to compare and analyze the optimized and original designs. The results show that the height, width and thickness of the optimized longitudinal beam section are reduced by 10mm, 11mm, and 0.8mm respectively, and the weight of the whole frame is reduced by 35.8kg. Before and after optimization, the displacement and stress changes of the frame are small in four motion situations, which meet the lightweight requirements of optimization design. [ABSTRACT FROM AUTHOR]

Small extracellular vesicles (sEVs) play a key role in exchanging cargoes between cells in tumour microenvironment. This study aimed to elucidate the functions and mechanisms of hepatocellular carcinoma (HCC) derived sEV‐clathrin light chain A (CLTA) in remodelling microvascular niche. CLTA level in the circulating sEVs of HCC patients was analysed by enzyme‐linked immunosorbent assay (ELISA). The functions of sEV‐CLTA in affecting HCC cancerous properties were examined by multiple functional assays. Mass spectrometry was used to identify downstream effectors of sEV‐CLTA in human umbilical vein endothelial cells (HUVECs). Tube formation, sprouting, trans‐endothelial invasion and vascular leakiness assays were performed to determine the functions of sEV‐CLTA and its effector, basigin (BSG) in HUVECs. BSG inhibitor, SP‐8356, was tested in a mouse model of patient‐derived xenografts (PDXs). Circulating sEVs of HCC patients had markedly enhanced CLTA levels than control individuals and were reduced in patients after surgery. HCC derived sEV‐CLTA enhanced HCC cancerous properties, disrupted endothelial integrity and induced angiogenesis. Mechanistically, CLTA remodels microvascular niche by stabilizing and upregulating BSG. Last, SP‐8356 alone or in combination with sorafenib attenuated PDXs growth. The study reveals the role of HCC derived sEV‐CLTA in microvascular niche formation. Inhibition of CLTA and its mediated pathway may illuminate a new therapeutic strategy for HCC patients. [ABSTRACT FROM AUTHOR]

Employing the correlation matrix technique, the spatial distribution of thermal energy in two-dimensional triangular lattices in equilibrium, interacting with linear springs, is studied. It is found that the spatial distribution of thermal energy varies with the included angle of the springs. In addition, the average thermal energy of the longer springs is lower. Springs with different included angle and length will lead to an inhomogeneous spatial distribution of thermal energy. This suggests that the spatial distribution of thermal energy is affected by the geometrical structure of the system: the more asymmetric the geometrical structure of the system is, the more inhomogeneous is the spatial distribution of thermal energy. [ABSTRACT FROM AUTHOR]

Multimedia learning environments facilitate the construction of certain forms of representations and allow users to combine forms of representation that address different modalities. A promising approach entails having students construct representations of the domain. The process of constructing a representation elicits self-explanation effects and consists of dynamic iterations and interactions between the constructed representations and mental representations, and therefore helps students to refine and disambiguate their domain knowledge. Because mobile multimedia learning environments have enabled numerous new forms of presenting and communicating information, this study restores interest in the method of adopting mobile video conferencing in learning, and proposes its use in face-to-face collaborative learning of the first law of reflection in optics with the aim of harnessing the synergy of both communication modes. A total of 34 junior high school students participated in the study. The results showed that the participants acquired a new aspect of learning regarding the law of reflection, and their metacognitive awareness increased as a result of using the mobile video, which regulated their explorative learning process. This study provided an unprecedented and meaningful learning experience to students and stimulated teachers to explore the full potential of technologies around them in education. [ABSTRACT FROM AUTHOR]

Abstract: In recent years, flipped learning has received tremendous attention from educational practitioners and researchers. However, this study argues that existing e‐learning systems mainly serve for learning management and content delivery purposes, although they lack support for flipped learning. As an innovative educational approach, flipped learning requires more pedagogical elements, such as integrated instructional design and adaptive content delivery, to achieve effective direct instruction. This study aims to create a learning adaptivity design to support effective learning in the flipped individual learning space in which the teacher is absent. Because teaching involves various pedagogical and content knowledge sources, we propose a conceptual model of teaching as a function of the knowledge triad of Guideline (G), Teaching Activity (T), and Material (M). To realize this conceptualization, an ontological problem‐solving approach is used for knowledge‐based systems development to integrate the relevant knowledge sources. The knowledge model is created using the Protégé platform to develop OWL‐based domain ontology, task ontology, and SWRL‐based semantic rules to enable inference in the GTM triad for learning adaptivity. The case illustration shows that the knowledge‐based system prototype can adaptively guide student learning in the flipped individual learning space with the knowledge sources integrated. [ABSTRACT FROM AUTHOR]

This study investigated the relationship between adolescents' problematic Internet use (PIU) and demographic characteristics such as age, gender, and information and communication technology (ICT) literacy and the moderating effect of geographic area on this relationship using a cross-sectional research design. The study sample comprised 2160 adolescents from the Chongqing area of China and consisted of 47.3 percent boys (N = 1022) and 52.7 percent girls (N = 1138). Participants anonymously completed a 38-item questionnaire that examined their Internet use, behaviors, and attitudes, ICT literacy, parents' education level, and other demographic information. The results showed that the geographic area in which respondents lived (urban vs. rural), gender, age, father's education, mother's education, and ICT literacy had significant relationships with PIU. Moreover, hierarchical multiple regression analyses indicated that geographic area was found to be a significant moderator for both age and gender in their relationship with PIU. These findings suggest that it is essential to address differences between urban and rural areas when seeking to mitigate PIU among adolescents. [ABSTRACT FROM AUTHOR]

A new scheme of pulsed voltage adding using inductively charged Blumlein lines has been proposed and experimentally demonstrated. The circuit principle is explained based on the analogy with capacitively charged Blumlein lines. In the experiments, striplines have been used for inductive energy storage, and SiC power devices have been used as the opening switches. The experimental results have proved both the circuit behavior and the voltage adding by using multimodule stack. This circuit method is expected to become a new approach to compact and repetitive pulsed-power generation. [ABSTRACT FROM AUTHOR]

It is important to calculate solar flux distribution with a precise and simple method for the design and optimization of solar tower systems. In this paper, the Gaussian flux density function at the image plane is deduced after simulating the image function of the heliostat with Gaussian distribution function. The flux density distribution of various round or rectangular focusing heliostats at the receiver plane can be calculated through projection. The simulation results are compared with SolTrace analysis and experimental data. Comparison of the flux density distributions between this method and SolTrace show excellent agreement especially when the optical error is equivalent to or larger than the Gaussian function parameter of heliostat image which fits to most of heliostats in a solar tower system. Although it increases error to simulate the image of the heliostat with elliptical Gaussian distribution, compared with the experimental data, the average prediction error of the elliptical Gaussian function is 2.24%, which is less than that of SolTrace because SolTrace applies the circular Gaussian distribution for optical error which bring more errors. Therefore, the Gaussian flux density function proposed is validated and can be used to simulate and optimize the design of solar heliostats field. [ABSTRACT FROM AUTHOR]

The combined retaining structure is widely used in high slope supporting engineering. In this paper, shaking table test and numerical simulation are carried out on the seismic response of a combined retaining structure where a gravity wall and an anchoring frame beam are used as a lower structure and an upper structure, respectively. The shaking events of Wenchuan, Da-Rui and Kobe ground motions with different amplitudes are applied in both horizontal and vertical directions. The horizontal and vertical acceleration responses are studied in time domain and frequency domain based on shaking table test, and the results are compared with those obtained from numerical simulation. The axial stress response of anchor and the element state of combined retaining structure subjected to earthquake loading are supplemented and studied by using numerical simulation. Both horizontal and vertical acceleration responses near the bottom of frame beam are significantly magnified, which results in a dramatic increment in acceleration amplification. The acceleration response behind the frame beam is more intensive than that at the back of the gravity wall. The high-frequency component of seismic ground motion is weakened by the combined retaining structure, and the vertical acceleration response presents a wider frequency band. The axial stress of anchor is greatly increased by seismic excitation, and the increment is mainly induced within the excitation period of great acceleration amplitude. Shear failure, tension failure, or both are observed at different positions of combined retaining structure during seismic excitation. [ABSTRACT FROM AUTHOR]

Conventional permanent magnet (PM) machine open-phase fault detection relies on the estimation of current harmonics using available phase current sensors. Because the magnitudes of current harmonic are proportional to the machine load condition, it is still a challenge to detect a phase fault at light load when fault-induced current harmonics are too small to estimate. This paper investigates the phase fault detection specifically for the conditions under low fault harmonic magnitudes. Both fault-induced harmonics in dq currents and neutral point (NP) voltage are analyzed to find a suited signal for the fault detection. By adding a voltage sensor to measure the NP voltage in a PM machine, a better fault detection performance is achieved because the fault harmonic in NP voltage results in the reduced effect on torque loads and sensor measurement errors. A 50-W PM machine is tested to verify the phase fault detection performance under low fault harmonic magnitudes. This paper includes the experimental evaluation on the detection limitation in terms of load capability using current and voltage fault signals. [ABSTRACT FROM PUBLISHER]

Aims. Recent epidemiological studies have indicated that the incidence of epilepsy peaks after 60 years old, and epilepsy has become increasingly prevalent in elderly populations. The aim of this study is to identify the aetiologic characteristics of epilepsy in the elderly. Methods. We retrospectively recruited elderly patients with newly diagnosed epilepsy identified in three epilepsy centres in western China; elderly patients were defined as individuals aged 60 years or older. Demographic characteristics, clinical epilepsy data, and the diagnosis and aetiology of epilepsy were recorded. Results. A total of 760 patients with newly diagnosed epilepsy were enrolled in our study. Of these patients, 25% had experienced one or more episodes of status epilepticus, and 62.4% were confirmed as symptomatic. Among the symptomatic cohort, stroke and traumatic brain injury (TBI) were the two most common causes of epilepsy, followed by cerebral tumour, dementia, hippocampal sclerosis (HS), and central nervous system (CNS) infection. When analysed by residence and age, ischaemic stroke was the most common cause of epilepsy in urban patients, whereas traumatic brain injury was the leading cause of epilepsy in rural patients. Conclusion. More than three-fifths of newly diagnosed epilepsy cases in elderly patients were confirmed as symptomatic, and stroke and traumatic brain injury were the primary aetiologies in elderly epileptic patients. [ABSTRACT FROM AUTHOR]

Cranial nerve involvement frequently involves neuron damage and often leads to psychiatric disorder caused by multiple inducements. Lurasidone is a novel antipsychotic agent approved for the treatment of cranial nerve involvement and a number of mental health conditions in several countries. In the present study, the neuroprotective effect of lurasidone by antagonist activities on histamine was investigated in a rat model of cranial nerve involvement. The antagonist activities of lurasidone on serotonin 5‑HT7, serotonin 5‑HT2A, serotonin 5‑HT1A and serotonin 5‑HT6 were analyzed, and the preclinical therapeutic effects of lurasidone were examined in a rat model of cranial nerve involvement. The safety, maximum tolerated dose (MTD) and preliminary antitumor activity of lurasidone were also assessed in the cranial nerve involvement model. The therapeutic dose of lurasidone was 0.32 mg once daily, administered continuously in 14‑day cycles. The results of the present study found that the preclinical prescriptions induced positive behavioral responses following treatment with lurasidone. The MTD was identified as a once daily administration of 0.32 mg lurasidone. Long‑term treatment with lurasidone for cranial nerve involvement was shown to improve the therapeutic effects and reduce anxiety in the experimental rats. In addition, treatment with lurasidone did not affect body weight. The expression of the language competence protein, Forkhead‑BOX P2, was increased, and the levels of neuroprotective SxIP motif and microtubule end‑binding protein were increased in the hippocampal cells of rats with cranial nerve involvement treated with lurasidone. Lurasidone therapy reinforced memory capability and decreased anxiety. Taken together, lurasidone treatment appeared to protect against language disturbances associated with negative and cognitive impairment in the rat model of cranial nerve involvement, providing a basis for its use in the clinical treatment of patients with cranial nerve involvement. [ABSTRACT FROM AUTHOR]

Background Post-hepatectomy Liver Failure (PHLF) remains the primary cause of perioperative death. The kinetics of transaminase levels are usually measured as markers of hepatocellular injury following partial hepatectomy, but their correlation with PHLF and post-operative mortality is unclear. The aim of study was to compare the post-operative transaminase kinetics with short term survival in those patients that developed PHLF. Methods A retrospective review of patients with HBV-related HCC and who developed PHLF was performed. Logistic regression analysis was conducted to analyze risk factors for postoperative delayed elevation of ALT (PDE-ALT) PHLF and lethal PHLF. Result Of the 69 patients who developed PHLF 36 (52%) died. In those patients who died the mean ± SD ALT and AST rose from day (POD) 1–3 and continued to fluctuate with highly abnormal levels beyond day 3 with a mean ± SD peak ALT level beyond POD 3 of 1851 ± 1644 U/L (p < 0.001). Conclusions The kinetics of the post-operative transaminases were significantly correlated with perioperative mortality in those patients who developed PHLF. PDE-ALT indicates an increased risk of death in HBV-related HCC patients with PHLF. [ABSTRACT FROM AUTHOR]

Given the complexity and uncertainty of diesel compositions, it is of great challenges to study the fundamental combustion processes and mechanism of diesel fuel, in particular the gaseous and particulate pollutant formation mechanisms. A reasonably designed diesel surrogate is proved to be an effective way to study the fundamental combustion mechanism of diesel fuel. However, most existing diesel surrogates mainly adopt light hydrocarbon components, increasing the difficulty of accurately reflecting the physical and chemical properties of practical diesel fuel or the combustion and emissions characteristics of diesel engines. Therefore, in this study, a methodology to construct diesel surrogates with C 10  ∼ C 18 hydrocarbon components based on fuel properties and engine combustion and emissions characteristics was proposed. First, the key physical and chemical fuel properties that affect fuel injection, atomization, ignition, combustion, engine efficiency and emissions were discussed in detail. Second, 13 candidate components were chosen to represent n-alkanes, iso-alkanes, cycloparaffins and aromatics and blended with commercial diesel fuel in different proportions. Fuel injection, spray, ignition and combustion phase, engine efficiency and emissions versus changed blending component and proportion were systematically investigated. In particular, the effects of the cetane number and fuel volatility on combustion and emissions were investigated under fixed injection timing and fixed ignition timing conditions, respectively. Afterward, the key physical and chemical parameters of the surrogate fuels were defined, and the constraint equations were constructed for different parameters. Considered the uncertainties in the components and physicochemical properties of the actual diesel fuel, it is believed that the construction of surrogate fuel has only reasonable solutions and there is no optimal solution. Finally, three diesel surrogates were proposed from the feasible domains of constraint equations, including a 3-Components surrogate (41.3% n -hexadecane, 36.8% 2,2,4,4,6,8,8-heptamethylnonane (HMN), 21.9% 1-methylnaphthalene, by mol.), a 5-Components surrogate (21.6% n -hexadecane, 15.5% n -octadecane, 26.0% HMN, 20.7% 1-methylnaphthalene, 16.2% decalin, by mol.) and a 7-Components surrogate (21.5% n -hexadecane, 15.4% n -octadecane, 25.8% HMN, 13.7% 1-methylnaphthalene, 8.1% decalin, 8.1% n -butylbenzene, 7.4% n -butylcyclohexane, by mol.). It is found that the surrogates proposed in this study can accurately reproduce actual engine combustion characteristics. Also, the gaseous emissions of the 5-Components surrogate are closest to those of the target diesel fuel in the tested engine operation conditions. [ABSTRACT FROM AUTHOR]

The removal of propane and heavier hydrocarbons (C 3+ ) from natural gas is an important part of natural gas upgrading. In the present work, ultra-thin MFI zeolite membranes with a thickness of 400 nm and an estimated Si/Al ratio of 152 were evaluated for separation of C 3 H 8 and n -C 4 H 10 from binary and ternary mixtures with CH 4 . The membranes were selective towards the heavier hydrocarbons and showed high permeance at all investigated temperatures. At room temperature, the n -C 4 H 10 /CH 4 separation selectivity was 25, coupled with an n -C 4 H 10 permeance of 31 × 10 −7 mol m −2 s −1 Pa −1 for a 10/90 n -C 4 H 10 /CH 4 binary feed mixture. As the temperature was decreased to 281 K, the separation selectivity increased to as high as 55 with an n -C 4 H 10 permeance of 25 × 10 −7 mol m −2 s −1 Pa −1 . The separation selectivities for a 10/90 C 3 H 8 /CH 4 binary mixture were 9.5 and 19, with C 3 H 8 permeances as high as 54 and 37 × 10 −7 mol m −2 s −1 Pa −1 at 297 and 271 K, respectively. The higher selectivities observed for n -C 4 H 10 containing mixtures was ascribed to stronger adsorption of n -C 4 H 10 than C 3 H 8 in MFI, thus resulting in higher adsorption selectivities of the n -C 4 H 10 containing mixtures over CH 4 . For a 10/10/80 n -C 4 H 10 /C 3 H 8 /CH 4 ternary mixture, the highest sum selectivity of ( n -C 4 H 10 + C 3 H 8 )/CH 4 was 48 and the corresponding sum permance of ( n -C 4 H 10 + C 3 H 8 ) was 26 × 10 −7 mol m −2 s −1 Pa −1 at 283 K, which were similar to the separation results of n -C 4 H 10 /CH 4 binary mixture at the same conditions. The n -C 4 H 10 /CH 4 and C 3 H 8 /CH 4 separation selectivities from the ternary mixture were of course lower, but still as high as 32 and 16 at 283 K, with n -C 4 H 10 and C 3 H 8 permeances of 17 and 8 × 10 −7 mol m −2 s −1 Pa −1 , respectively. The results show that ultra-thin MFI zeolite membranes are promising candidates for separation of C 3+ hydrocarbons from natural gas. [ABSTRACT FROM AUTHOR]

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7–99.7% identity), E. reichenowi (97.9–100% identity), or E. gruis (98.6–99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes. [ABSTRACT FROM AUTHOR]

Objective: To present a case of influenza A infection complicated with focal encephalitis, meningitis, and acute respiratory distress syndrome.Clinical Presentation and Intervention: A 35-year-old woman presented with fever, headache, cough, and body aches. Seizures, altered consciousness, and dyspnea occurred later. A nasopharyngeal swab revealed a positive reaction for the influenza A antigen. Magnetic resonance imaging scans showed a T2 prolongation in the left frontoparietal subcortical white matter, which was consistent with focal encephalitis. She recovered after treatment with oseltamivir and antibiotics.Conclusion: This case report highlights focal encephalitis with concomitant pulmonary complications after influenza A infection. [ABSTRACT FROM AUTHOR]

Bound states of massive particles, such as nuclei, atoms, or molecules, constitute the bulk of the visible world around us. By contrast, photons typically only interact weakly. We report the observation of traveling three-photon bound states in a quantum nonlinear medium where the interactions between photons are mediated by atomic Rydberg states. Photon correlation and conditional phase measurements reveal the distinct bunching and phase features associated with three-photon and two-photon bound states. Such photonic trimers and dimers possess shape-preserving wave functions that depend on the constituent photon number. The observed bunching and strongly nonlinear optical phase are described by an effective field theory of Rydberg-induced photon-photon interactions. These observations demonstrate the ability to realize and control strongly interacting quantum many-body states of light. [ABSTRACT FROM AUTHOR]

Direct reduction in rotary hearth furnaces (RHF) can be used for metallurgical dusts recycling considering its high efficiency in reducing iron oxides and separating heavy and alkali metal elements. However, there is still a lack of understanding on the relationship between in-pellet behaviour and in-furnace phenomena of a RHF. In our previous study (Wu et al., 2017), a model was developed and validated and typical in-furnace phenomena and in-pellet behaviour were described. In connection with the previous study, this paper reports a numerical study of process design and optimization using the integrated model under industrial-scale RHF conditions for evaluating the sensitivity of main operating and controlling parameters of the RHFs on product quality in terms of iron metallization and Zn/Pb/K/Na removal. It is found that the final iron metallization rate is most affected by furnace atmosphere, and other product indexes are more sensitive to furnace temperature and hearth rotary speed. Several new designs are proposed and numerically tested in this study. The results show that the new designs, such as ladder furnace heights and adjustable obstruction, are useful to improve gas flow and pressure distribution inside the furnace, favourable for pellet direct reduction. The optimization of furnace temperature and rotary speed of furnace hearth also shows a good effect in product assurance and energy conservation, when facing on-site changes in raw material composition, production schedule and product quality target. The model and numerical results provide a cost-effective tool to solve technical problems in RHF industrial practice. [ABSTRACT FROM AUTHOR]

The paper presents a novel hydraulic fracturing model for the characterization and simulation of the complex fracture network in shale gas reservoirs. We go beyond the existing method that uses planar or orthogonal conjugate fractures for representing the ''complexity'' of the network. Bifurcation of fractures is performed utilizing the Lindenmayer system based on fractal geometry to describe the fracture propagation pattern, density and network connectivity. Four controlling parameters are proposed to describe the details of complex fractures and stimulated reservoir volume (SRV). The results show that due to the multilevel feature of fractal fractures, the model could provide a simple method for contributing reservoir volume calibration. The primary- and second-stage fracture networks across the overall SRV are the main contributions to the production, while the induced fracture network just contributes another 20% in the late producing period. We also conduct simulation with respect to different refracturing cases and find that increasing the complexity of the fracture network provides better performance than only enhancing the fracture conductivity. [ABSTRACT FROM AUTHOR]

Background: Hepatitis E infection is a global disorder that causes substantial morbidity. Numerous neurologic illnesses, including Guillain-Barre syndrome (GBS), have occurred in patients with hepatitis E virus (HEV) infection.Case Presentation: We report a 58 year-old non-immunocompromised man who presented with progressive muscle weakness in all extremities during an episode of acute HEV infection, which was confirmed by measuring the anti-HEV IgM antibodies in the serum. Both cerebrospinal fluid examination and electrophysiological study were in agreement with the diagnosis of HEV-associated GBS. Following the treatment with intravenous immunoglobulin, the patient's neurological condition improved rapidly.Conclusions: HEV infection should be strongly considered in patients with neurological symptoms, especially those with elevated levels of liver enzymes. [ABSTRACT FROM AUTHOR]

The aim of this meta-analysis was to assess the association between SLCO1B3 gene polymorphism and prostate cancer risk. PubMed, Embase, Cochrane Library, and Web of Science from inception to September 2017 were searched. Three authors independently selected studies, extracted data and assessed risk of bias. 5 articles published from 2008 to 2013 with 840 patients were included in this meta-analysis and were from Japan, USA and China. The prostate cancer risk of SLCO1B3 (rs4149117, GG) was markedly higher than that of SLCO1B3 (rs4149117, TT/TG, RR= 0.44, 95%CI: 0.39-0.49, p<0.00001), rs4149117 (TT, RR= 0.37, 95%CI: 0.32-0.42, p<0.00001) and rs4149117 (TG, RR= 0.07, 95%CI: 0.05-0.10, p<0.00001). 2 or 5 years risk free symptoms (RFS) of prostate cancer patient with SLCO1B3 (rs4149117, GG) was markedly higher than that of SLCO1B3 (rs4149117, TT/TG) (RR= -0.17, 95% CI: -0.27--0.07, p= 0.001 and RR= -0.08, 95% CI: -0.16-0.00, p= 0.004). However, no evidence showed there existed significant statistical relationship between SLCO1B3 (rs4149117) and 10 years RFS of prostate cancer (RR= -0.07, 95% CI: -0.19-0.06, p= 0.29). These data suggest that SLCO1B3 (rs4149117, GG) enhanced the RFS of prostate cancer. [ABSTRACT FROM AUTHOR]

A major challenge to take high rate advantage of thermophilic anaerobic digestion (AD) is overcoming ammonia inhibition without adding any significant cost to the process. A concept of thermophilic AD with simultaneous ammonia stripping was tested for treating dairy manure at high total solids concentration (TS%) as an attempt to address this challenge. The results showed that ammonia inhibition occurred at 1.8–2.4 g/L total ammonia nitrogen (TAN) concentration which corresponded to 10% TS as a threshold concentration. Thermophilic AD of dairy manure efficiency at the threshold TS% was significantly improved by simultaneously stripping ammonia with the optimum stripping rate of 1 L min −1 . The required time for reaching stable state was 4 days shorter than control, and the highest methane content (56.5–75.5%) was obtained. The ammonia stripping strategy maintained TAN level below the inhibition limit of 1.5 g/L throughout AD process. The maximum cumulative methane production of 192.3 L/kg-volatile solids (VS) was obtained, which was 2.3-fold the control. Therefore, simultaneous ammonia stripping overcame the ammonia inhibition on thermophilic AD of dairy manure at the threshold TS%. The proposed concept simplified the system by combining ammonia stripping and thermophilic AD within the same digester. [ABSTRACT FROM AUTHOR]

Objective To study the anatomy and clinical application of monolateral pterional keyhole approaches for treating bilateral cerebral aneurysms. Methods Twelve formalin-fixed cadaveric heads underwent right pterional keyhole approaches for management of simulative contralateral aneurysms. The length of the contralateral middle cerebral artery (MCA), distal internal carotid artery (DICA), anterior cerebral artery, and ophthalmic segment of the internal carotid artery (OICA) was recorded. The operability of contralateral aneurysms was assessed using a modified numeric grading system. A total of 16 patients (12 patients with ruptured aneurysms) with bilateral cerebral aneurysms undergoing contralateral pterional keyhole approaches were included. Results The contralateral A1 segment of the anterior cerebral artery, proximal A2 segment, M1 segment of the MCA, DICA, and OICA was exposed via pterional keyhole approaches. An additional 2 mm of the OICA was exposed after incision of the falciform dural fold was completed. Contralateral aneurysms of the M1 segment (posterior), M2 segment, MCA bifurcation (inferior), A2 segment (lateral), DICA (posterior and lateral), and OICA (superior, inferior, and lateral) could not be fully exposed to perform simulated surgical clipping (operability rate <75%). A total of 36 aneurysms underwent adequate surgical clipping via unilateral pterional keyhole approaches, whereas 1 aneurysm of the A3 segment did not. Conclusions Contralateral aneurysms of the M1 segment (anterior, superior, and inferior), MCA bifurcation (superior and lateral), A1 segment, A2 segment (anterior, posterior, and medial), internal carotid artery bifurcation, DICA (anterior and medial), and OICA (medial) were fully exposed from different angles and surgical maneuvers were performed via pterional keyhole approaches, including in patients presenting with subarachnoid hemorrhage. [ABSTRACT FROM AUTHOR]

Background: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Case presentation: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. Conclusions: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence. [ABSTRACT FROM AUTHOR]

Acoustical source reconstruction is a typical inverse problem, whose minimum frequency of reconstruction hinges on the size of the array and maximum frequency depends on the spacing distance between the microphones. For the sake of enlarging the frequency of reconstruction and reducing the cost of an acquisition system, Cyclic Projection (CP), a method of sequential measurements without reference, was recently investigated (JSV,2016,372:31-49). In this paper, the Propagation based Fast Iterative Shrinkage Thresholding Algorithm (Propagation-FISTA) is introduced, which improves CP in two aspects: (1) the number of acoustic sources is no longer needed and the only making assumption is that of a “weakly sparse” eigenvalue spectrum; (2) the construction of the spatial basis is much easier and adaptive to practical scenarios of acoustical measurements benefiting from the introduction of propagation based spatial basis. The proposed Propagation-FISTA is first investigated with different simulations and experimental setups and is next illustrated with an industrial case. [ABSTRACT FROM AUTHOR]

This paper presents an approach to optimize the shape of a general rotary cutter for five-axis flank milling of ruled and non-ruled surfaces. Based on the observation that tool shape optimization is equivalent to repositioning the control points of its B-spline meridian, the optimization of tool surface is reduced to that of a B-spline curve. Then, the meridian of rotary tool surface is represented by cubic B-spline curve, and it is used to obtain the analytic tool envelope surface. Subsequently, the flank milling error is measured by the distance between a point sampled from envelope surface and the design surface. On this basis, shape optimization of a general rotary cutter is formulated as an optimization problem from the perspective of approximating the tool envelope surface to the designed surface. Two examples are given to confirm the validity of the proposed method. The approach also applied to multi-pass five-axis flank milling. [ABSTRACT FROM AUTHOR]

Background and Aims: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and Results: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.Conclusions: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing. [ABSTRACT FROM AUTHOR]

We developed a series of molecule-scale hybrid amine-silica membranes synthesized from organoalkoxysilane precursors of 3-(triethoxysilyl)propan-1-amine (PA-Si) and 3-(triethoxysilyl)-N-methylpropan-1-amine (SA-Si), and made these functional using either unhindered amines or a 3-(triethoxysilyl)-N,N-dimethylpropan-1-amine (TA-Si) that is sterically hindered. CO 2 adsorption-desorption measurements of amine-silica powdered xerogels were conducted to observe the effect of amine type on CO 2 adsorption and desorption/diffusion properties. The results revealed that TA-Si xerogel powders demonstrated faster kinetics for both adsorption and desorption processes compared with those of the PA-Si and SA-Si samples due to the steric hindrance effect of the amine, which reduced the CO 2 binding energy and thereby boosted both the forward and reverse reaction rates of CO 2 -amine. In single-gas permeation performances, all the membranes exhibited excellent molecular sieving at higher temperatures and all the gases considered, except CO 2 , tended to permeate the membranes via activated diffusion. The effect of amine type on CO 2 separation performance was compared using CO 2 permeance, CO 2 /N 2 selectivity, activation energy for permeation ( E p ) of CO 2 [ E p (CO 2 ) ], and differences in E p between CO 2 and N 2 [ E p (CO 2 )-E p (N 2 ) ]. The TA-Si membrane demonstrated superior CO 2 separation performance, and achieved the highest values for both CO 2 permeance and selectivity. A relatively smaller difference in CO 2 separation performance was observed between PA-Si and SA-Si membranes despite some differences in basicity. This suggests that, rather than the basicity, it was the steric hindrance effect that played the greatest role in CO 2 transport performance across amine-silica membranes. [ABSTRACT FROM AUTHOR]