Search

Objective: The study aimed to evaluate the epidemiological, clinical, and molecular data of mucopolysaccharidosis type II (MPS II) patients and their outcomes using the national registry of patients in the Russian Federation (RF). Materials and Methods: In the retrospective cohort study, the authors included data from the Russian national registry of MPS II. Results: The prevalence of MPS II in RF is 0.62 per 100 000 live births or 0.09 per 100 000 population with the majority of patients in the Central (n = 36) and the Volga Federal District (n = 35). Males were 157 (99.4%), positive MPS II family history had 47 (29.7%) patients. The median age of the first symptoms was 1.8 (0.8-2.6) years, ranging from 0.1 to 19 years, and the age of diagnosis was 4.0 (2.5; 5.9) years, ranging from 0.1 to 38.9 years. A genetic study was available for the analysis in 116 (73.4%) patients. Single nucleotide variants in the IDS gene were found in 98/116 (84.5%) patients, and 18 further patients (15.5%) had gross rearrangements. About 59/98 (60.2%) patients had missense, 15/98 (15.3%) had frame-shift variants, 12/98 (12.2%) had splice site, and 11/98 (11.2%) had nonsense variants. One (1.0%) patient out of 98 patients had a small deletion. Pathogenic, likely pathogenic variants, and variants with uncertain significance were found in 54 (55.1%), 36 (36.7%), and 8 (8.2%) patients, respectively. About 138 (87.3%) patients received enzyme replacement therapy. Conclusion: The prevalence of MPS II in the RF is higher than that in some European countries and closer to the Asian population. The registry is a convenient tool for disease epidemiology and monitoring. [ABSTRACT FROM AUTHOR]

Background: Macrophage activation syndrome (MAS) can be regarded as a key factor determining the severity of multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C), and often requires treatment in the intensive care unit (ICU) to avoid life-threatening complications. No reputable specific criteria for the diagnosis of MAS in MIS-C patients have yet been identified, and criteria currently used for the diagnosis of hemophagocytic syndromes, such as HLH-2004, MAS-2005, and MAS-2016, are not sufficient for MAS in MIS-C. Our goal in this study was to work out the criteria for the early diagnosis of MAS in MIS-C. Methods: One hundred and sixty-six (166) patients with MIS-C were assessed retrospectively. The two most experienced experts independently identified patients with MAS. The patients were divided into three cohorts: MAS (n = 19), without MAS (n = 78), and probable MAS (n = 67). The latter included patients diagnosed with MAS by only one expert, and it was excluded from the analysis. Results: The age of patients with MAS was much higher, and they more frequently had edematous syndrome, hypotension and/or shock, splenomegaly, and CNS involvement. In their blood tests, thrombocytopenia, hypoalbuminemia, and hypertriglyceridemia occurred more often. The level of biomarkers of inflammation, such as ferritin, CRP, troponin, AST, and ALT, was also higher in this group. Increased fibrinogen and D-dimer were also found, demonstrating hypercoagulation in the MAS-MIS-C group. We chose 21 continuous and categorical variables with statistical significance, out of which 2—ferritin > 469 μg/L or platelets < 114 × 109/L—allowed us to discriminate MAS patients. Conclusions: Ferritin > 469 μg/L or platelets < 114 × 109/L can be regarded as key signs to differentiate MAS in MIS-C patients with a sensitivity of 100% and specificity of 94.9%, and they can be used along with other diagnostic methods. [ABSTRACT FROM AUTHOR]

The article in the International Journal of Rheumatic Diseases discusses a case report of a 14-year-old girl with Mevalonate Kinase Deficiency Syndrome (MKD) that presented with symptoms resembling Juvenile Idiopathic Arthritis (JIA). The patient experienced chronic arthritis, systemic inflammation, and other symptoms typical of MKD, leading to a delayed diagnosis. Treatment with canakinumab resulted in significant symptom improvement. The study highlights the importance of genetic testing in patients with systemic inflammation to rule out monogenic autoinflammatory disorders. [Extracted from the article]

Introduction: Interferon I (IFN I) signaling hyperactivation is considered one of the most important pathogenetic mechanisms in systemic lupus erythematosus (SLE). Early manifestation and more severe SLE courses in children suggest a stronger genetic influence in childhood-onset SLE (cSLE). Aim: To evaluate IFN-I score and SLE-associated genetic variants in cSLE. Material and Methods: 80 patients with cSLE were included in the study. IFN I-score was assessed by real-time PCR quantitation of 5 IFN I-regulated transcripts (IFI44L, IFI44, IFIT3, LY6E, MXA1) in 60 patients. Clinical exome sequencing (CES) was performed in 51 patients. Whole-exome sequencing was performed in 32 patients with negative results of CES. Results: 46/60 patients (77%) had elevated IFN-I scores. Leucopenia and skin involvement were associated with over-expression of IFI44 and IFI44L, while hypocomplementemia—with hyperactivation of IFIT3, LY6E, and MX1. No correlation of IFN-I score with disease activity was found. At least one rare genetic variant, potentially associated with SLE, was found in 29 (56.9%) patients. The frequency of any SLE-genetic variants in patients with increased IFN scores was 84%, in patients with normal IFN scores—33%, and in the group whose IFN score was not assessed was 65% (p = 0.040). The majority of genetic variants (74%) are functionally related to nucleic acid sensing and IFN-signaling. The highest frequency of genetic variants was observed in Sakha patients (9/14; 64.3%); three and two unrelated patients had identical variants in PTPN22 and TREX1 genes, respectively. Conclusions: More than half of patients with childhood-onset SLE have rare variants in SLE-associated genes. The IFN-I score could be considered a tool for the selection of patients for further genetic assessment in whom monogenic lupus is suspected. [ABSTRACT FROM AUTHOR]

Hemophagocytic syndrome is a key point in the pathogenesis of severe forms of multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C). The factors associated with hemophagocytosis in patients with MIS-C were assessed in the present study of 94 boys and 64 girls ranging in age from 4 months to 17 years, each of whose HScore was calculated. In accordance with a previous analysis, patients with HScore ≤ 91 (n = 79) and HScore > 91 (n = 79) were compared. Patients with HScore > 91 had a higher frequency of symptoms such as cervical lymphadenopathy, dry cracked lips, bright mucous, erythema/swelling of hands and feet, peeling of fingers, edematous syndrome, hepatomegaly, splenomegaly, and hypotension/shock. They also had a higher erythrocyte sedimentation rate (ESR), C-reactive protein (CRP) and D-dimer levels, and a tendency to anemia, thrombocytopenia, and hypofibrinogenemia. They more often needed acetylsalicylic acid and biological treatment and were admitted to ICU in 70.9% of cases. Conclusion: The following signs of severe MIS-C were associated with HScore > 91: myocardial involvement, pericarditis, hypotension/shock, and ICU admission. [ABSTRACT FROM AUTHOR]

Juvenile idiopathic arthritis (JIA) is a systemic autoimmune disease that affects the joints, leading to disability. Cytokines and signaling molecules expressed by the immune system cells play a key role in JIA pathogenesis. Understanding how their content changes during pathology development can open up new opportunities for its diagnosis and treatment. The blood plasma of 30 patients with JIA (14 males and 16 females with a mean age of 12.2 ± 4.1) and 20 relatively healthy individuals (10 males and 10 females with a mean age of 10.20 ± 5.85) was analyzed to determine the levels of cytokines using the MILLIPLEX® kit. An increase in interleukins (IL)-1α, 1β, 2, 4, 5, 6, 7, 8, 9, 10, 13, 15, 17F, 22, and 27 and a decrease in IL-3 levels have been shown in patients with JIA. Levels of cytokines, which are important for B-cell activation and proliferation, are increased, while levels of T-cell activating factors remained similar to the control group. Based on our results, it can be assumed that the use of combination therapy aimed at inhibiting both nonspecific interleukins and cytokines that activate B-cells will be more effective for the treatment of JIA. [ABSTRACT FROM AUTHOR]

Background: The causative agent of the new coronavirus infection SARS-CoV-2 has unique properties causing hyperinflammatory syndrome and cytokine storm, as well as widespread endotheliitis and thrombotic microangiopathy, initially detected in the lungs of adult patients who died from a severe form of the disease. Venous and arterial thrombosis in adults were identified as common causes of severe complications and deaths in new coronavirus infections. There are very few reports of thrombotic events in children with COVID-19 in the literature. Methods: We conducted a retrospective analysis of the histories of 60 patients in the Irkutsk Regional Children's Clinical Hospital from November 2020 to November 2022 with a MIS-C diagnosis established according to WHO criteria, of which 8 (13.3%) were diagnosed with venous and/or arterial thrombosis, confirmed by laboratory and ultrasound and/or X-ray methods. Results: The average age of children with thrombosis (Me) was 7.5 years (min 4 months, max 17 years), with a M:F ratio of 3.0. Venous thrombosis was detected in six of the eight patients, including in the deep veins of the lower extremities in four. Pulmonary embolism occurred in two (one of them was fatal), and cerebral venous sinus thrombosis and thrombosis of the branches of the upper and lower vena cava were found in one patient. Extensive bilateral stroke due to thrombosis of the large cerebral arteries occurred in two patients, including one in combination with distal gangrene. Secondary thrombotic renal microangiopathy took place in three of the eight patients. Among these three, atypical HUS was diagnosed in one case. Multiple thrombosis involving the venous and arterial bed was detected in four of the eight patients. High levels of D-dimer, thrombocytopenia, increased NT-proBNP, cerebral coma, and aseptic meningitis were the events most often associated with thrombosis. All patients received immunomodulatory therapy (immunoglobulin, dexamethasone/methylprednisolone), pathogenetic therapy for multiorgan failure, anticoagulant therapy with heparin/LMWH, and acetylsalicylic acid. Biologics were used in two patients. Conclusions: The main predictors of thrombosis in children with MIS-C were increased D-dimer, thrombocytopenia, hospitalization in the ICU, and noncardiogenic pulmonary edema. Thrombosis of the deep veins of the lower extremities, large cerebral arteries, and secondary thrombotic microangiopathy was common. There was a single death (12.5% of the eight patients), associated with PE. [ABSTRACT FROM AUTHOR]

Multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) is a life-threatening condition that often requires intensive care unit (ICU) admission. The aim of this study was to determine risk factors for severe/life-threatening course of MIS-C. The study included 166 patients (99 boys, 67 girls) aged 4 months–17 years (median 8.2 years). The criterion of severity was the fact of ICU admission. To conduct a comparative analysis, MIS-C patients were divided into two groups: patients hospitalized in the ICU (n = 84, 50.6%) and those who did not need ICU admission (n = 82, 49.4%). Patients with a more severe course of MIS-C were significantly older. They had a higher frequency of signs such as rash, swelling, hepatomegaly, splenomegaly, and neurological and respiratory symptoms. Hypotension/shock and myocardial involvement were much more common in patients with severe MIS-C. These patients had a more significant increase in CRP, creatinine, troponin, and D-dimer levels. Additionally, the presence of macrophage activation syndrome was higher in patients admitted to the ICU. Conclusion: Nineteen predictors of severe course of MIS-C were found, out of which hepatomegaly, splenomegaly, D-dimer > 2568 ng/mL, troponin > 10 pg/mL were mainly associated with the probability of being classified as early predictors of severe MIS-C requiring ICU admission. [ABSTRACT FROM AUTHOR]

Introduction: Aicardi-Gouteres syndrome (AGS) is a monogenic interferonopathy characterized by early onset, dysregulation of skin (chilblain lesions), brain, and immune systems (fever, hepatomegaly, glaucoma, arthritis, myositis, and autoimmune activity). The disease looks like TORCH (Toxoplasmosis, Others, Rubella, Cytomegalovirus, Herpes) infection with early-onset encephalopathy resulting in severe neuropsychological disability. Case description: A six-year-old girl has been suffering from generalized seizures, fever episodes, severe psychomotor development delay, and spastic tetraparesis since the first year of her life. Her two elder brothers died at a young age from suspected infantile cerebral palsy (ICP). Other siblings (younger brother and two elder sisters) are as healthy as their parents. The girl was diagnosed with juvenile dermatomyositis at 5.5 years. Basal ganglia, periventricular, and cerebellum calcifications; hypoplasia of the corpus callosum; and leukodystrophy were detected on CT. The IFN-I score was 12 times higher than normal. The previously not described nucleotide variant c.434G > C (chr 20:36935104C > G; NM_015474) was detected in exon 4 of the SAMHD1 gene in the homozygous state, leading to amino acid substitution p.R145P. Aicardi-Goutières syndrome 5 was diagnosed. Her treatment included corticosteroids, methotrexate, and tofacitinib 5 mg twice a day and it contributed to health improvements. The following brain CT depicted the previously discovered changes without the sign of calcification spreading. Conclusions: Early diagnosis of AGS is highly important as it allows starting treatment in a timely manner. Timely treatment, in return, can help avoid the development/progression of end-organ damage, including severe neurological complications and early death. It is necessary to spread information about AGS among neurologists, neonatologists, infectious disease specialists, and pediatricians. A multidisciplinary team approach is required. [ABSTRACT FROM AUTHOR]

Our study aimed to evaluate the clinical and laboratory features of juvenile idiopathic arthritis (JIA) children with temporomandibular joint (TMJ) arthritis. In the retrospective cohort study, we analyzed data of 753 patients with JIA aged 2–17 years, depending on TMJ arthritis or not. TMJ arthritis can to be diagnosed in the presence of at least two of the following clinical signs of inflammation: pain in TMJ, jaw opening limitation, jaw opening deviation, and micrognathia. We compared clinical, laboratory, and treatment features in JIA patients depending on the involvement of TMJ. TMJ arthritis was detected in 43 (5.7%) of our patients and associated with a longer course of the disease, polyarticular JIA category, treatment with systemic corticosteroids, and longer achievement of the remission and involvement of cervical spine, hip, and shoulder. Active joints >8 (OR = 14.9, p = 0.0000001), delayed remission >7 years (OR = 3.1; p = 0.0004), delayed hip involvement (OR = 4.6; p = 0.041), hip osteoarthritis (OR = 4.0; p = 0.014), cervical spine arthritis (OR = 10.3, p = 0.000001), and corticosteroid treatment (OR = 2.3, p = 0.0007) were associated with TMJ involvement. Patients with TMJ arthritis require more biologics (OR = 3.2, p = 0.0006, HR = 2.4, p = 0.005) and have decreased probability of remission achievement (p = 0.014). Consequently, TMJ arthritis was associated with a severe disease course. Early biologic treatment and corticosteroid avoidance might decrease TMJ involvement. [ABSTRACT FROM AUTHOR]

Background: Pediatric lupus nephritis (LN) is one of the most serious manifestations of systemic lupus erythematosus (SLE) in children, determining the outcomes of the disease. There are no standardized treatment protocols for pediatric LN, and the role of biologics has not yet been conclusively defined. Objectives: analyze the safety and efficacy of rituximab biosimilar BCD020 in pediatric patients with lupus nephritis. Methods: in a retrospective cohort study, the data from the case histories of 25 patients with LN (10 boys and 15 girls) with an onset age of 13 (9–16) years, who failed conventional non-biologic treatment or developed corticosteroid dependence/toxicity, were included. The diagnosis was made using Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. Rituximab biosimilar BCD020 was prescribed in a dosage of 375 mg/m2 every week (2–4 infusions) with repeated courses every 6–12 months (2–4 infusions) according to disease activity, B-cell depletion, and IgG levels. The dynamics of clinical and laboratory data, the activity of the disease by SLEDAI, and corticosteroid doses were assessed at the onset and during the rituximab trial. Results: The main patient's characteristics were: Pre-rituximab non-biologic conventional treatment included: cyclophosphamide 15 (60%), MMF 8 (32%), azathioprine 3 (12%), hydroxychloroquine 12 (48%), and pulse therapy of methylprednisolone followed by oral methylprednisolone 25 (100%). The time before rituximab was 7.0 (3.0–24.0) months, and the whole observation period was 7.0 (0; 24) months. The initial pre-rituximab treatment slightly reduced SLEDAI levels and the proportion of patients with LN. A significant reduction of SLEDAI, the anti-dsDNA level, proteinuria, hematuria, C4 complement, ESR, and the median corticosteroid dose by 80% from the initial value, as well as the proportion of patients without corticosteroids, was observed after rituximab administration. Two deaths were observed due to catastrophic SLE with macrophage activation syndrome, accompanied by a severe infection (invasive aspergillosis, n = 2). Three patients developed serious adverse events: pneumonia (n = 2), transient agranulocytosis (n = 1) after the third rituximab infusion, and meningitis, caused by Listeria monocytosis, after the first rituximab infusion. Eight patients received antibacterial treatment for different respiratory infections without hospital admissions. Conclusions: Rituximab biosimilar BCD020 showed effectiveness in LN, whereas previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of rituximab and evaluate the benefits when compared with conventional SLE treatment. [ABSTRACT FROM AUTHOR]

Background: Several cases of skin and central nervous system vasculopathy associated with COVID-19 in children have been published, but the information is rather limited. Our study aimed to describe these cases of vasculitis associated with COVID-19 in children. Methods: In the retrospective-prospective case series study we included information regarding four children with COVID-19-associated vasculitis. In every case, we had a morphological description and the etiology was confirmed via real-time polymerase chain reaction during a tissue biopsy. Results: The most involved systems were skin (4/4), respiratory (3/4), cardiovascular (2/4), nervous (1/4), eye (1/4), kidney (1/4), and inner year (1/4). All patients had increased inflammatory markers and thrombotic parameters (D-dimer). No patient met the criteria for multisystem inflammatory syndrome in children. Two patients met polyarteritis nodosa criteria, one met Henoch–Schonlein purpura criteria, and one met unclassified vasculitis criteria. All patients were treated with systemic glucocorticosteroids (two-pulse therapy). Non-biologic DMARDs were prescribed in all cases; 1/4 patients (25%) was treated with intravenous immunoglobuline, and 3/4 (75%) were treated with biologics (etanercept, tocilizumab, and adalimumab). Conclusions: Vasculitis associated with COVID-19 could be a life-threatening condition; SARS-CoV-2 might be a new trigger or etiological agent for vasculitis and other immune-mediated diseases. Further research and collection of similar cases are required. [ABSTRACT FROM AUTHOR]

Objective: We aimed to evaluate the clinical and laboratory features and MEFV allele distribution in Crimean Tatar familial Mediterranean fever patients and to compare them with Turkish familial Mediterranean fever patients and healthy controls. Materials and Methods: All newly diagnosed familial Mediterranean fever patients with Crimean Tatar nationality (n = 18) in Children's Regional Hospital in Simferopol were enrolled in the study and were compared to 40 familial Mediterranean fever cases followed up at Hacettepe University, Ankara, Turkey. The distribution of MEFV alleles was assessed in the 127 unrelated healthy Crimean Tatar adults aged 20 years or more from different parts of the Crimea peninsula. Results: Age and gender distribution, the frequency of colchicine resistance, and colchicine intolerance were similar between Turkish and Crimean Tatar children with familial Mediterranean fever. The duration of familial Mediterranean fever attack was shorter in Turkish patients than in Crimean Tatar (2.0 vs. 3.0 days, P < .001). Chest pain was more frequent in Turkish familial Mediterranean fever patients, whereas arthralgia, arthritis, and erysipeloid rash were more common in Crimean TatarT. MEFV allele distribution in Crimean Tatar was M694V-81%, M680I and V726A 9.5% both, and 68.6%, 14.3%, and 12.9% in Turkish, consequently. Homozygous carriers were 11%, compound-heterozygous was 6%, and heterozygous was 83%, compared to Turkish being 45%, 30%, and 25%, respectively. The allele distribution in healthy Crimean Tatar and Turkish was 10.2% and M694V was 7.1%, M680I was 1.6%, and V726A was 1.6%. Conclusion: The similar MEFV allele prevalence in both populations suggests the high prevalence of familial Mediterranean fever and the high number of undiagnosed patients in the Crimea peninsula. Younger age at onset, shorter duration of attacks, the prevalence of articular involvement, and erysipeloid rash were distinctive features of familial Mediterranean fever in Crimean Tatar. [ABSTRACT FROM AUTHOR]

Objective: Utilizing data obtained from a prospective, international, juvenile systemic sclerosis (SSc) cohort, the present study was undertaken to determine if pulmonary screening with forced vital capacity (FVC) and diffusing capacity for carbon monoxide (DLco) is sufficient to assess the presence of interstitial lung disease (ILD) in comparison to high‐resolution computed tomography (HRCT) in juvenile SSc. Methods: The juvenile SSc cohort database was queried for patients enrolled from January 2008 to January 2020 with recorded pulmonary function tests (PFTs) parameters and HRCT to determine the discriminatory properties of PFT parameters, FVC, and DLco in detecting ILD. Results: Eighty‐six juvenile SSc patients had both computed tomography imaging and FVC values for direct comparison. Using findings on HRCT as the standard measure of ILD presence, the sensitivity of FVC in detecting ILD in juvenile SSc was only 40%, the specificity was 77%, and area under the curve (AUC) was 0.58. Fifty‐eight juvenile SSc patients had both CT imaging and DLco values for comparison. The sensitivity of DLco in detecting ILD was 76%, the specificity was 70%, and AUC was 0.73. Conclusion: The performance of PFTs in juvenile SSc to detect underlying ILD was quite limited. Specifically, the FVC, which is one of the main clinical parameters in adult SSc to detect and monitor ILD, would miss ~60% of children who had ILD changes on their accompanying HRCT. The DLco was more sensitive in detecting potential abnormalities on HRCT, but with less specificity than the FVC. These results support the use of HRCT in tandem with PFTs for the screening of ILD in juvenile SSc. [ABSTRACT FROM AUTHOR]

Context: Glucocorticoids (GCs) prescribed for chronic pediatric illnesses are associated with osteoporotic fractures.Objective: This study aims to determine the efficacy and safety of intravenous (IV) zoledronic acid (ZA) compared with placebo to treat pediatric GC-induced osteoporosis (GIO).Methods: Children aged 5 to 17 years with GIO were enrolled in this multinational, randomized, double-blind, placebo-controlled phase 3 trial (ClinicalTrials.gov NCT00799266). Eligible children were randomly assigned 1:1 to 6 monthly IV ZA 0.05 mg/kg or IV placebo. The primary end point was the change in lumbar spine bone mineral density z score (LSBMDZ) from baseline to month 12. Incident fractures and safety were assessed.Results: Thirty-four children were enrolled (mean age 12.6 ± 3.4 years [18 on ZA, 16 on placebo]), all with low-trauma vertebral fractures (VFs). LSBMDZ increased from -2.13 ± 0.79 to -1.49 ± 1.05 on ZA, compared with -2.38 ± 0.90 to -2.27 ± 1.03 on placebo (least squares means difference 0.41 [95% CI, 0.02-0.81; P = .04]); when corrected for height z score, the least squares means difference in LBMDZ was 0.75 [95% CI, 0.27-1.22; P = .004]. Two children on placebo had new low-trauma VF vs none on ZA. Adverse events (AEs) were reported in 15 of 18 children (83%) on ZA, and in 12 of 16 (75%) on placebo, most frequently within 10 days after the first infusion. There were no deaths or treatment discontinuations due to treatment-emergent AEs.Conclusion: LSBMDZ increased significantly on ZA compared with placebo over 1 year in children with GIO. Most AEs occurred after the first infusion. [ABSTRACT FROM AUTHOR]

Abstract Background The glucocorticoid receptor gene (NR3C1) has been suggested as a candidate gene affecting juvenile idiopathic arthritis (JIA) course and prognosis. The purpose of this study is to investigate the glucocorticoid receptor gene BclI polymorphism (rs41423247) in JIA patients, the gene's role in susceptibility to juvenile idiopathic arthritis, and its associations with JIA activity, course and bone mineralization. Methods One hundred twenty-two Caucasian children with JIA and 143 healthy ethnically matched controls were studied. We checked markers of clinical and laboratory activity: morning stiffness, Ritchie Articular Index (RAI), swollen joint count (SJC), tender joint count (TJC), physician's visual analog scale (VAS), hemoglobin level (Hb), leukocyte count (L), platelet count (Pl), Westergren erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), albumin, DAS and DAS28. Bone mineralization was measured by dual-energy X-ray absorptiometry (DXA) of lumbar spine L1-L4. Assessments of bone metabolism included osteocalcin, C-terminal telopeptide (CTT), parathyroid hormone (PTH), total and ionized calcium, inorganic phosphate and total alkaline phosphatase (TAP). BclI polymorphism was genotyped by polymerase chain reaction restriction fragment length polymorphism. Results No association was observed between glucocorticoid receptor gene polymorphism and the presence or absence of JIA. In girls with JIA, the presence of the G allele was associated with an unfavorable arthritis course, a younger age of onset of arthritis (p = 0.0017), and higher inflammatory activity. The higher inflammatory activity was demonstrated by the following: increased time of morning stiffness (p = 0.02), VAS (p = 0.014), RAI (p = 0.048), DAS (p = 0.035), DAS28 (p = 0.05), Pl (p = 0.003), L (p = 0.046), CRP (p = 0.01). In addition, these patients had bone metabolism disturbances as follows: decreased BA (p = 0.0001), BMC (p = 0.00007), BMD (0.005) and Z score (p = 0.002); and higher levels of osteocalcin (p = 0.03), CTT (p = 0.036), TAP activity (p = 0.01) and ionized calcium (p = 0.017). In boys with JIA, no significant differences were observed related to the polymorphic alleles or genotypes. Conclusions We suggest that G allele and the GG genotype of the glucocorticoid receptor gene BclI polymorphism contribute to an unfavorable course and low bone mineral density in girls with JIA.

The article describes the case of a 10-year-old boy with fever and stormatitis and developed gradual muscle weakness and myalgia, followed by the complaint of dark spots in front of the eyes. Topics discussed include findings on physical examination and laboratory tests, his diagnosis with enterovirus infection with polymyositis (PM) and necrotizing retinovasculitis, and key points requiring differential diagnosis.

Chronic nonbacterial osteomyelitis (CNО) and tuberculous osteomyelitis (TBO) are both primarily chronic inflammatory bone diseases with similar clinical and radiological findings, but entirely different in aetiology, pathogenesis, treatment, and outcomes. Our study aimed to evaluate the clinical and laboratory features which could discriminate the CNO and TBO. The study included 124 patients—91 with CNO and 33 with TBO. All patients underwent routine blood tests: WBC, platelets, ESR, C-reactive protein, haemoglobin, and imaging. The ability of each variable to discriminate CNO from TBO was evaluated with sensitivity and specificity analysis, AUC-ROC analysis, and calculating the odds ratio. Patients with TBO had less number of bone foci (p = 0.0000001), onset age (p = 0.00001), rarely articular involvement (p = 0.01), lower haemoglobin level (p = 0.02), higher incidence of TBO in the male subjects (p = 0.002), and higher leukocyte bands (p = 0.0000001). TBO is rarely characterized by spine (p = 0.0009), foot (p = 0.01), and clavicula (p = 0.047) involvement. The diagnostic rule: criteria allowing to differentiate NBO from TBO are negative bone microbiota tests (sensitivity—100.0%, specificity—100.0%) or major discriminative criteria or clavicula involvement alone (sensitivity—11.0%, specificity—100.0%) and at least four from the five additional criteria: number of foci > 1.0 (p = 0.00002), WBC ≤ 11.0 (p = 0.004), neutrophil bands ≤ 120.0 × 106/l (p = 0.002), lymphocytes ≤ 52% (p = 0.0005), and CRP > 0.2 mg/l (p = 0.003). All patients with monofocal CNO required bone biopsy with microbiology assessment. The created provisional criteria may help to discriminate TBO and CNO and should be used only with other known diagnostic tools. Key Points • Nonbacterial osteomyelitis and tuberculous osteomyelitis are both primarily chronic inflammatory bone diseases with similar presentations. • Nonbacterial osteomyelitis and tuberculous osteomyelitis may be associated with other immune-mediated diseases. • Only bone biopsy can confirm and discriminate both conditions. All patients with monofocal CNO required bone biopsy with microbiology assessment. [ABSTRACT FROM AUTHOR]

Primary immune deficiencies are usually attributed to genetic defects and, therefore, frequently referred to as inborn errors of immunity (IEI). We subjected the genomic DNA of 333 patients with clinical signs of IEI to next generation sequencing (NGS) analysis of 344 immunity‐related genes and, in some instances, additional genetic techniques. Genetic causes of the disease were identified in 69/333 (21%) of subjects, including 11/18 (61%) of children with syndrome‐associated IEIs, 45/202 (22%) of nonsyndromic patients with Jeffrey Modell Foundation (JMF) warning signs, 9/56 (16%) of subjects with periodic fever, 3/30 (10%) of cases of autoimmune cytopenia, 1/21 (5%) of patients with unusually severe infections and 0/6 (0%) of individuals with isolated elevation of IgE level. There were unusual clinical observations: twins with severe immunodeficiency carried a de novo CHARGE syndrome‐associated SEMA3E c.2108C>T (p.S703L) allele; however, they lacked clinical features of CHARGE syndrome. Additionally, there were genetically proven instances of Netherton syndrome, Х‐linked agammaglobulinemia, severe combined immune deficiency (SCID), IPEX and APECED syndromes, among others. Some patients carried recurrent pathogenic alleles, such as AIRE c.769C>T (p.R257*), NBN c.657del5, DCLRE1C c.103C>G (p.H35D), NLRP12 c.1054C>T (p.R352C) and c.910C>T (p.H304Y). NGS is a powerful tool for high‐throughput examination of patients with malfunction of immunity. [ABSTRACT FROM AUTHOR]

Chronic non-bacterial osteomyelitis (CNO) is a group of immune-mediated diseases which appears in bone inflammation, destruction and some orthopaedic consequences, especially in the cases of spinal involvement. This study is to compare characteristics and treatment outcomes of CNO patients with spinal involvement. The retrospective cohort study included data from 91 pediatric patients with CNO. The diagnosis is based on Jannson's criteria with morphological confirmation (nonspecific chronic inflammation). Spine involvement detected by X-ray, computed tomography, magnetic resonance imaging, and bone scan in 29 (31.9%) patients. No differences in the family history, concomitant immune-mediated diseases between spinal (SpCNO) and peripheral (pCNO) forms of CNO have been revealed. Only 5 (10.2%) SpCNO patients (10.2%) had monofocal monovertebral involvement. The main risk factors of spinal involvement were female sex: RR = 2.0 (1.1; 3.9), sensitivity (Se) = 0.66, specificity (Sp) = 0.6; multifocal involvement: RR = 2.1 (0.9; 5.0), Se = 0.83, Sp = 0.37; no foot bones involvement: RR = 3.1 (1.3; 7.5), Se = 0.83, Sp = 0.5; sternum involvement RR = 2.3 (1.3; 4.1), Se = 0.24, Sp = 0.94. In the linear regression analysis only female sex (p = 0.005), multifocal involvement (p = 0.000001) and absence of foot bones involvement (p = 0.000001) were independent risk factors of spinal involvement (p = 0.000001). The response rate on bisphosphonates and tumor necrosis factor-a inhibitors was 90.9% and 66.7%, consequently. Only 4/29 (13.8%) SpCNO patients underwent surgery due to severe spinal instability or deformities. The spinal involvement is frequent in CNO and could be crucial for choosing a treatment strategy. Bisphosphonates and TNFa-inhibitors could be effective treatment options for severe SpCNO. [ABSTRACT FROM AUTHOR]

Objective: To assess performance of the 2016 macrophage activation syndrome (MAS) classification criteria for patients with systemic juvenile idiopathic arthritis (JIA) who develop MAS while treated with biologic medications.Methods: A systematic literature review was performed to identify patients with MAS while being treated with interleukin (IL)-1 and IL-6 blocking agents. Clinical and laboratory information was compared to a large previously compiled historical cohort.Results: Eighteen publications were identified, and after removing duplicates, 35 patients treated with canakinumab and 49 patients with tocilizumab were available for analysis; 5 anakinra-treated patients were excluded due to limited numbers. MAS classification criteria were less likely to classify tocilizumab-treated patients as having MAS compared to the historical cohort or canakinumab-treated patients (56.7%, 78.5%, and 84%, respectively; P < 0.01). Patients who developed MAS while treated with canakinumab trended towards lower ferritin at MAS onset than the historical cohort (4,050 versus 5,353 ng/ml; P = 0.18) but had no differences in other cardinal clinical or laboratory features. In comparison, patients who developed MAS while treated with tocilizumab were less likely febrile and had notably lower ferritin levels (1,152 versus 5,353 ng/ml; P < 0.001). Other features of MAS were more pronounced in patients treated with tocilizumab, including lower platelet counts, lower fibrinogen, and higher aspartate aminotransferase levels. Mortality rates for patients with MAS treated with tocilizumab or canakinumab were not significantly different from the historical cohort.Conclusion: These findings show substantial alterations in MAS features that may limit utility of defined criteria for diagnosis of systemic JIA patients treated with biologic agents. [ABSTRACT FROM AUTHOR]

Objective To characterize the early disease course in childhood-onset antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) and the 12-month outcomes in children with AAV. Methods Eligible subjects were children entered into the Pediatric Vasculitis Initiative study who were diagnosed before their eighteenth birthday as having granulomatosis with polyangiitis (Wegener's), microscopic polyangiitis, eosinophilic granulomatosis with polyangiitis (Churg-Strauss), or ANCA-positive pauci-immune glomerulonephritis. The primary outcome measure was achievement of disease remission (Pediatric Vasculitis Activity Score [PVAS] of 0) at 12 months with a corticosteroid dosage of <0.2 mg/kg/day. Secondary outcome measures included the rates of inactive disease (PVAS of 0, with any corticosteroid dosage) and rates of improvement at postinduction (4-6 months after diagnosis) and at 12 months, presence of damage at 12 months (measured by a modified Pediatric Vasculitis Damage Index [PVDI]; score 0 = no damage, score 1 = one damage item present), and relapse rates at 12 months. Results In total, 105 children with AAV were included in the study. The median age at diagnosis was 13.8 years (interquartile range 10.9-15.8 years). Among the study cohort, 42% of patients achieved remission at 12 months, 49% had inactive disease at postinduction (4-6 months), and 61% had inactive disease at 12 months. The majority of patients improved, even if they did not achieve inactive disease. An improvement in the PVAS score of at least 50% from time of diagnosis to postinduction was seen in 92% of patients. Minor relapses occurred in 12 (24%) of 51 patients after inactive disease had been achieved postinduction. The median PVDI damage score at 12 months was 1 (range 0-6), and 63% of patients had ≥1 PVDI damage item scored as present at 12 months. Conclusion This is the largest study to date to assess disease outcomes in pediatric AAV. Although the study showed that a significant proportion of patients did not achieve remission, the majority of patients responded to treatment. Unfortunately, more than one-half of this patient cohort experienced damage to various organ systems early in their disease course. [ABSTRACT FROM AUTHOR]

Introduction Recent recommendations suppose temporomandibular joint (TMJ) involvement in juvenile idiopathic arthritis (JIA) is a risk factor of poor outcomes and severe disease course. Objectives To compare the clinical characteristics of patients with juvenile idiopathic arthritis with and without TMJ involvement. Methods We analyzed the data of 753 patients with juvenile idiopathic arthritis aged 2–17 years, depending on TMJ arthritis (n  = 43; 5.7%) or no TMJ arthritis (n  = 710; 94.3%). Clinical, laboratory characteristics and treatment regimens were compared. Odds ratio (OR) analysis of sensitivity (Se) and specificity (Sp) was performed to obtained the predictors of TMJ involvement. Results Despite the similar age of onset, TMJ arthritis was associated with longer course of the disease, polyarticular JIA category, use of systemic corticosteroids and longer achievement of remission with similar rate of biologic administration. TMJ arthritis was associated with involvement of cervical spine, hip and shoulder arthritis. The main risk factors, associated with TMJ involvement in JIA were active joints > 8 (OR = 14.9 (5.8; 38.3), P  = 0.0000001), delayed remission > 7 years (OR = 3.1 (1.6; 5.8), P  = 0.0004), delayed hip involvement (OR = 4.6 (0.9; 22.6), P  = 0.041), hip osteoarthritis (OR = 4.0 (1.2; 13.0), P  = 0.014), and avascular necrosis of the hip. Cervical spine arthritis (OR = 10.3 (5.4; 19.8), P  = 0.000001), and corticosteroid treatment (OR = 2.3 (1.2; 4.4), P  = 0.0007) were associated with TMJ arthritis. Patients with TMJ arthritis required more biologics (OR-3.2 (1.6; 6.2), P  = 0.0006). Oligoarticular JIA category and uveitis were protective against TMJ involvement. Data are in the table. E10 Table 1. Parameters.  TMJ arthritis, yes.  TMJ arthritis, no.  P -value.  JIA duration, years  5.5 (2.7; 11.7)  4.2 (1.9; 7.4)  0.058  JIA category        Oligoarthritis  1 (2.3)  203 (28.6)  0.0006  Polyarthritis  25 (58.1)  240 (33.8)    Psoriatic arthritis  2 (4.7)  38 (5.4)    Enthesitis-related arthritis  9 (20.9)  177 (24.9)    Systemic arthritis  6 (14)  52 (7.3)    Active joints, n (%)  17(10; 42)  6,0 (3,0; 11,0)  0,000  Hip osteoarthritis  8/13 (61.5)  40/140 (28.6)  0.014  Delayed hip involvement  8/10 (80.0)  58/125 (46.4)  0.041  Oral corticosteroids, n (%)  17/42 (40.5)  135/710 (19.0)  0.0007  Corticosteroids pulse-therapy, n (%)  13/43 (30.2)  122/707 (17.3)  0.032  Time before biologic, years  3.9 (1.0; 9.7)  4.2(1.9; 7.6)  0.912  Time before remission  4.2 (1.7; 10.8)  3.1 (1.5; 6.3)  0.042  Parameters.  TMJ arthritis, yes.  TMJ arthritis, no.  P -value.  JIA duration, years  5.5 (2.7; 11.7)  4.2 (1.9; 7.4)  0.058  JIA category        Oligoarthritis  1 (2.3)  203 (28.6)  0.0006  Polyarthritis  25 (58.1)  240 (33.8)    Psoriatic arthritis  2 (4.7)  38 (5.4)    Enthesitis-related arthritis  9 (20.9)  177 (24.9)    Systemic arthritis  6 (14)  52 (7.3)    Active joints, n (%)  17(10; 42)  6,0 (3,0; 11,0)  0,000  Hip osteoarthritis  8/13 (61.5)  40/140 (28.6)  0.014  Delayed hip involvement  8/10 (80.0)  58/125 (46.4)  0.041  Oral corticosteroids, n (%)  17/42 (40.5)  135/710 (19.0)  0.0007  Corticosteroids pulse-therapy, n (%)  13/43 (30.2)  122/707 (17.3)  0.032  Time before biologic, years  3.9 (1.0; 9.7)  4.2(1.9; 7.6)  0.912  Time before remission  4.2 (1.7; 10.8)  3.1 (1.5; 6.3)  0.042  Open in new tab E10 Table 1. Parameters.  TMJ arthritis, yes.  TMJ arthritis, no.  P -value.  JIA duration, years  5.5 (2.7; 11.7)  4.2 (1.9; 7.4)  0.058  JIA category        Oligoarthritis  1 (2.3)  203 (28.6)  0.0006  Polyarthritis  25 (58.1)  240 (33.8)    Psoriatic arthritis  2 (4.7)  38 (5.4)    Enthesitis-related arthritis  9 (20.9)  177 (24.9)    Systemic arthritis  6 (14)  52 (7.3)    Active joints, n (%)  17(10; 42)  6,0 (3,0; 11,0)  0,000  Hip osteoarthritis  8/13 (61.5)  40/140 (28.6)  0.014  Delayed hip involvement  8/10 (80.0)  58/125 (46.4)  0.041  Oral corticosteroids, n (%)  17/42 (40.5)  135/710 (19.0)  0.0007  Corticosteroids pulse-therapy, n (%)  13/43 (30.2)  122/707 (17.3)  0.032  Time before biologic, years  3.9 (1.0; 9.7)  4.2(1.9; 7.6)  0.912  Time before remission  4.2 (1.7; 10.8)  3.1 (1.5; 6.3)  0.042  Parameters.  TMJ arthritis, yes.  TMJ arthritis, no.  P -value.  JIA duration, years  5.5 (2.7; 11.7)  4.2 (1.9; 7.4)  0.058  JIA category        Oligoarthritis  1 (2.3)  203 (28.6)  0.0006  Polyarthritis  25 (58.1)  240 (33.8)    Psoriatic arthritis  2 (4.7)  38 (5.4)    Enthesitis-related arthritis  9 (20.9)  177 (24.9)    Systemic arthritis  6 (14)  52 (7.3)    Active joints, n (%)  17(10; 42)  6,0 (3,0; 11,0)  0,000  Hip osteoarthritis  8/13 (61.5)  40/140 (28.6)  0.014  Delayed hip involvement  8/10 (80.0)  58/125 (46.4)  0.041  Oral corticosteroids, n (%)  17/42 (40.5)  135/710 (19.0)  0.0007  Corticosteroids pulse-therapy, n (%)  13/43 (30.2)  122/707 (17.3)  0.032  Time before biologic, years  3.9 (1.0; 9.7)  4.2(1.9; 7.6)  0.912  Time before remission  4.2 (1.7; 10.8)  3.1 (1.5; 6.3)  0.042  Open in new tab Conclusion TMJ involvement is marker of poor disease prognosis. Early initiation of biologics and avoidance of corticosteroids might improve the risk of TMJ involvement. Ethics Written consent was obtained according to the declaration of Helsinki. This retrospective study's protocol was approved by the local Ethical Committee of Saint Petersburg State Pediatric Medical University (protocol number 11/10 from 23.11.2020). [ABSTRACT FROM AUTHOR]

Background Juvenile systemic lupus erythematosus (JSLE) is a severe life-threatening disease. The place of rituximab in JSLE management is still undefined. The early biologic intervention might improve disease's outcomes. Aim of study To assess the advantages of early rituximab administration compared with late. Material and methods In the retrospective cohort study the information about 36 JSLE patients, whom rituximab biosimilar BCD020 was initiated were included. All patients were divided in two groups: early start of rituximab (less than six months from onset) and late start (more than one year). We compared initial disease characteristics at onset, on the baseline (BL)—start of rituximab and end of the study—(EOS) - 12 months, and treatment characteristics. Results The time gap between early and late rituximab administration was 19 months. There were no differences in disease profile at onset, except higher SLEDAI and MAS frequency in early rituximab group. Baseline differences were: lower C3, C4, higher SLEDAI and oral daily corticosteroids dosage. At the end of the study, patient whom rituximab was prescribed early had more impressive changes in SLEDAI, e.g. 100% of patients decreased SLEDAI, compared with 79% in late rituximab group. The detailed information about disease activity and treatment outcomes in both groups are in the table. There were no differences in adverse events between groups, except more impressive signs of corticosteroid toxicity in group of late rituximab administration. Conclusion Early administration of rituximab biosimilar made it possible to control the JSLE activity faster and reduce the dose of corticosteroids effectively. There were no differences in adverse events, except signs of corticosteroid toxicity in group of late rituximab initiation. This work was financially supported by the Ministry of Science and Higher Education of the Russian Federation (Agreement No. 075–15-2022–301). Ethics The study was approved by the Ethical Committee of the Saint-Petersburg State Pediatric Medical University (Protocol No1/3 from 11/Jan/2021). There were no violations of patient's rights according to the Declaration of Helsinki. OA03 Table 1. Parameter.  Early start of rituximab (n = 16).  Late start of rituximab (n = 19).  P -value.  Time before rituximab, months  3 (2; 6)  22 (14; 36)  0.00001  SLEDAI, BL, points  22 (15; 26)  10 (6; 16)  0.003  SLEDAI, EOS, points  2 (0; 4)  2 (0; 6)  1.0  SLEDAI changes from BL, points  -18 (-13; -24)  -6 (-14 -14)  0.0006  Patients, improved SLEDAI, %  16 (100)  15 (79)  0.05  SLEDAI changes from BL, %  85 (81; 100)  64 (14; 100)  0.099  Daily corticosteroids, BL, mg/kg  1.0 (0.6; 0.1)  0.3 (0.2; 0.8)  0.027  Daily corticosteroids, EOS, mg/kg  0.1 (0.08; 0.16)  0.1 (0.06; 0.2)  0.842  Median daily corticosteroids change from BL, %  85 (60; 88)  68 (33; 90)  0.436  Improvement in SLEDAI from BL        SLEDAI30  16 (100)  14 (74)  0.027  SLEDAI50  16 (100)  13 (68)  0.014  SLEDAI70  15 (94)  9 (47)  0.004  SLEDAI 90  7 (44)  7 (37)  0.678  SLEDAI100  5 (31)  6 (32)  0.984  Parameter.  Early start of rituximab (n = 16).  Late start of rituximab (n = 19).  P -value.  Time before rituximab, months  3 (2; 6)  22 (14; 36)  0.00001  SLEDAI, BL, points  22 (15; 26)  10 (6; 16)  0.003  SLEDAI, EOS, points  2 (0; 4)  2 (0; 6)  1.0  SLEDAI changes from BL, points  -18 (-13; -24)  -6 (-14 -14)  0.0006  Patients, improved SLEDAI, %  16 (100)  15 (79)  0.05  SLEDAI changes from BL, %  85 (81; 100)  64 (14; 100)  0.099  Daily corticosteroids, BL, mg/kg  1.0 (0.6; 0.1)  0.3 (0.2; 0.8)  0.027  Daily corticosteroids, EOS, mg/kg  0.1 (0.08; 0.16)  0.1 (0.06; 0.2)  0.842  Median daily corticosteroids change from BL, %  85 (60; 88)  68 (33; 90)  0.436  Improvement in SLEDAI from BL        SLEDAI30  16 (100)  14 (74)  0.027  SLEDAI50  16 (100)  13 (68)  0.014  SLEDAI70  15 (94)  9 (47)  0.004  SLEDAI 90  7 (44)  7 (37)  0.678  SLEDAI100  5 (31)  6 (32)  0.984  Open in new tab OA03 Table 1. Parameter.  Early start of rituximab (n = 16).  Late start of rituximab (n = 19).  P -value.  Time before rituximab, months  3 (2; 6)  22 (14; 36)  0.00001  SLEDAI, BL, points  22 (15; 26)  10 (6; 16)  0.003  SLEDAI, EOS, points  2 (0; 4)  2 (0; 6)  1.0  SLEDAI changes from BL, points  -18 (-13; -24)  -6 (-14 -14)  0.0006  Patients, improved SLEDAI, %  16 (100)  15 (79)  0.05  SLEDAI changes from BL, %  85 (81; 100)  64 (14; 100)  0.099  Daily corticosteroids, BL, mg/kg  1.0 (0.6; 0.1)  0.3 (0.2; 0.8)  0.027  Daily corticosteroids, EOS, mg/kg  0.1 (0.08; 0.16)  0.1 (0.06; 0.2)  0.842  Median daily corticosteroids change from BL, %  85 (60; 88)  68 (33; 90)  0.436  Improvement in SLEDAI from BL        SLEDAI30  16 (100)  14 (74)  0.027  SLEDAI50  16 (100)  13 (68)  0.014  SLEDAI70  15 (94)  9 (47)  0.004  SLEDAI 90  7 (44)  7 (37)  0.678  SLEDAI100  5 (31)  6 (32)  0.984  Parameter.  Early start of rituximab (n = 16).  Late start of rituximab (n = 19).  P -value.  Time before rituximab, months  3 (2; 6)  22 (14; 36)  0.00001  SLEDAI, BL, points  22 (15; 26)  10 (6; 16)  0.003  SLEDAI, EOS, points  2 (0; 4)  2 (0; 6)  1.0  SLEDAI changes from BL, points  -18 (-13; -24)  -6 (-14 -14)  0.0006  Patients, improved SLEDAI, %  16 (100)  15 (79)  0.05  SLEDAI changes from BL, %  85 (81; 100)  64 (14; 100)  0.099  Daily corticosteroids, BL, mg/kg  1.0 (0.6; 0.1)  0.3 (0.2; 0.8)  0.027  Daily corticosteroids, EOS, mg/kg  0.1 (0.08; 0.16)  0.1 (0.06; 0.2)  0.842  Median daily corticosteroids change from BL, %  85 (60; 88)  68 (33; 90)  0.436  Improvement in SLEDAI from BL        SLEDAI30  16 (100)  14 (74)  0.027  SLEDAI50  16 (100)  13 (68)  0.014  SLEDAI70  15 (94)  9 (47)  0.004  SLEDAI 90  7 (44)  7 (37)  0.678  SLEDAI100  5 (31)  6 (32)  0.984  Open in new tab [ABSTRACT FROM AUTHOR]

Objective To uniquely classify children with microscopic polyangiitis (MPA), to describe their demographic characteristics, presenting clinical features, and initial treatments in comparison to patients with granulomatosis with polyangiitis (Wegener's) (GPA). Methods The European Medicines Agency (EMA) classification algorithm was applied by computation to categorical data from patients recruited to the ARChiVe (A Registry for Childhood Vasculitis: e-entry) cohort, with the data censored to November 2015. The EMA algorithm was used to uniquely distinguish children with MPA from children with GPA, whose diagnoses had been classified according to both adult- and pediatric-specific criteria. Descriptive statistics were used for comparisons. Results In total, 231 of 440 patients (64% female) fulfilled the classification criteria for either MPA (n = 48) or GPA (n = 183). The median time to diagnosis was 1.6 months in the MPA group and 2.1 months in the GPA group (ranging to 39 and 73 months, respectively). Patients with MPA were significantly younger than those with GPA (median age 11 years versus 14 years). Constitutional features were equally common between the groups. In patients with MPA compared to those with GPA, pulmonary manifestations were less frequent (44% versus 74%) and less severe (primarily, hemorrhage, requirement for supplemental oxygen, and pulmonary failure). Renal pathologic features were frequently found in both groups (75% of patients with MPA versus 83% of patients with GPA) but tended toward greater severity in those with MPA (primarily, nephrotic-range proteinuria, requirement for dialysis, and end-stage renal disease). Airway/eye involvement was absent among patients with MPA, because these GPA-defining features preclude a diagnosis of MPA within the EMA algorithm. Similar proportions of patients with MPA and those with GPA received combination therapy with corticosteroids plus cyclophosphamide (69% and 78%, respectively) or both drugs in combination with plasmapheresis (19% and 22%, respectively). Other treatments administered, ranging in decreasing frequency from 13% to 3%, were rituximab, methotrexate, azathioprine, and mycophenolate mofetil. Conclusion Younger age at disease onset and, perhaps, both gastrointestinal manifestations and more severe kidney disease seem to characterize the clinical profile in children with MPA compared to those with GPA. Delay in diagnosis suggests that recognition of these systemic vasculitides is suboptimal. Compared with adults, initial treatment regimens in children were comparable, but the complete reversal of female-to-male disease prevalence ratios is a provocative finding. [ABSTRACT FROM AUTHOR]

Background: Systemic juvenile idiopathic arthritis (SoJIA) is the most striking form of juvenile idiopathic arthritis. The aim of our study was to evaluate the clinical responses and outcomes of children with SoJIA to IL-6 blockade using two different tocilizumab (TCZ) treatment protocols designed for milder and more severe SoJIA patient groups, and evaluate the possibility of achieving biologic-free remission. Methods: Thirty-seven active SoJIA children who have failed treatment with corticosteroids and other DMARDs were included in our retrospective study. TCZ doses were prescribed in two treatment approaches: every 2 weeks TCZ dosing (Q2W) and every 4 weeks TCZ dosing (Q4W). The patients were assigned to these two groups by the study physicians depending on the severity of the SoJIA disease as judged by each clinician. Results: Thirty-three of the 37 children successfully completed the trial. TCZ was discontinued in 11patients during the trial. Seven children achieved inactive disease and were allowed to stop the TCZ and 4 had severe adverse events requiring drug cessation. Currently 7 patients continue to have TCZ-free remission [4/7 remission off-medication, 3/7still on methotrexate (MTX)]. This mixed group had a median treatment duration of 1002 days. The children in remission off of all medications, TCZ and MTX, had a median remission duration of 1162 days (ranged 932-1301 days). Compared to the patients assigned to the Q2W TCZ treatment group, the patients assigned to the Q4W TCZ group had a milder SoJIA course. The patients had higher levels of hemoglobin, total proteins, and serum albumins. They had lower white blood cell counts (WBC), % granulocytes, CRP, ESR, ferritins, and LDH. These children had a lower frequency of internal organ involvement, fewer relapses during TCZ treatment, and no macrophage activation syndrome episodes. Conclusions: Our experience with TCZ for SoJIA supports the excellent result of other studies. What may be novel is our finding that thisIL-6 blockade with TCZ may be able to be utilized at a less frequent dosing schedule in mild SoJIA compared to severe SoJIA. We discuss other factors that may increase the probability of a patient reaching TCZ-free remission. [ABSTRACT FROM AUTHOR]

Objective: Despite well-known evidence of association of caries with bone metabolic diseases, there are only a small number of studies about caries and bone mineral density (BMD) on pediatric population. We evaluated the possibility of bone mineralization and metabolism disturbances in children with caries and compared them with healthy individuals. Materials and methods: A total of 123 patients with caries (63 boys and 60 girls), aged 12-15 years, were included. The children were divided according caries stage: the decayed, missing, and filled tooth (DMFT) group (n=73) and the initial caries (IC) group (n=50), which have clinically active initial caries lesions on the enamel ('white spots'). Caries-free (CF) children (n=42) were the healthy controls. Bone mineralization was measured in all children with caries and healthy controls by dual-energy X-ray absorptiometry of the lumbar spine (L1-L4). For the assessment of bone metabolism, osteocalcin, carboxy terminal telopeptide of type I collagen (CTX), parathyroid hormone, Ca2+, inorganic phosphate, and total alkaline phosphatase were used. Results: Children with DMFT have low BMD and BMD Z score in association with low osteocalcin and high CTX levels, compared with IC (p=0.008 and p=0.0001, respectively) and CF children (p<0.0000 and p=0.0001, respectively). In DMFT, Ca2+ was significantly higher compared with IC (p=0.01) and CF (p=0.003). Caries stages negatively correlated with BMD (r=-0.86, p<0.001). A differently directed correlation between CTX and osteocalcin was detected: CTX was negatively related to osteocalcin in the DMFT group (r=-0.22, p=0.043) and positively related in the IC (r=0.42, p=0.002) and CF children (r=0.58, p=0.0000). Conclusions: Children with any caries stage have decreased BMD accompanied with increased bone resorption. We consider that caries could be a marker of impact bone mineralization and metabolism. [ABSTRACT FROM AUTHOR]

Objective To investigate the outcome and predicting factors of multiple intraarticular corticosteroid (IAC) injections in children with juvenile idiopathic arthritis (JIA). Methods The clinical charts of patients who received their first IAC injection in ≥3 joints between January 2002 and December 2011 were reviewed. The corticosteroid used was triamcinolone hexacetonide for large joints and methylprednisolone acetate for small or difficult to access joints. In each patient, the followup period after IAC injection was censored in case of synovitis flare or at the last visit with continued remission. Predictors included sex, age at disease onset, JIA category, antinuclear antibody (ANA) status, age and disease duration, disease course, general anesthesia, number and type of injected joints, acute-phase reactants, and concomitant systemic medications. Results A total of 220 patients who had 1,096 joints injected were included. Following IAC therapy, 66.4% of patients had synovitis flare after a median of 0.5 years, whereas 33.6% of patients had sustained remission after a median of 0.9 years. The cumulative probability of survival without synovitis flare was 50.0%, 31.5%, and 19.5% at 1, 2, and 3 years, respectively. On Cox regression analysis, positive C-reactive protein value, negative ANA, lack of concomitant methotrexate administration, and a polyarticular (versus an oligoarticular) disease course were the strongest predictors for synovitis flare. Conclusion Multiple IAC injection therapy induced sustained remission of joint synovitis in a substantial proportion of patients. A controlled trial comparing multiple IAC injection therapy and methotrexate versus methotrexate and a tumor necrosis factor antagonist is worthy of consideration. [ABSTRACT FROM AUTHOR]

Background: The glucocorticoid receptor gene (NR3C1) has been suggested as a candidate gene affecting juvenile idiopathic arthritis (JIA) course and prognosis. The purpose of this study is to investigate the glucocorticoid receptor gene BclI polymorphism (rs41423247) in JIA patients, the gene's role in susceptibility to juvenile idiopathic arthritis, and its associations with JIA activity, course and bone mineralization. Methods: One hundred twenty-two Caucasian children with JIA and 143 healthy ethnically matched controls were studied. We checked markers of clinical and laboratory activity: morning stiffness, Ritchie Articular Index (RAI), swollen joint count (SJC), tender joint count (TJC), physician's visual analog scale (VAS), hemoglobin level (Hb), leukocyte count (L), platelet count (Pl), Westergren erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), albumin, DAS and DAS28. Bone mineralization was measured by dual-energy X-ray absorptiometry (DXA) of lumbar spine L1-L4. Assessments of bone metabolism included osteocalcin, C-terminal telopeptide (CTT), parathyroid hormone (PTH), total and ionized calcium, inorganic phosphate and total alkaline phosphatase (TAP). BclI polymorphism was genotyped by polymerase chain reaction restriction fragment length polymorphism. Results: No association was observed between glucocorticoid receptor gene polymorphism and the presence or absence of JIA. In girls with JIA, the presence of the G allele was associated with an unfavorable arthritis course, a younger age of onset of arthritis (p = 0.0017), and higher inflammatory activity. The higher inflammatory activity was demonstrated by the following: increased time of morning stiffness (p = 0.02), VAS (p = 0.014), RAI (p = 0.048), DAS (p = 0.035), DAS28 (p = 0.05), Pl (p = 0.003), L (p = 0.046), CRP (p = 0.01). In addition, these patients had bone metabolism disturbances as follows: decreased BA (p = 0.0001), BMC (p = 0.00007), BMD (0.005) and Z score (p = 0.002); and higher levels of osteocalcin (p = 0.03), CTT (p = 0.036), TAP activity (p = 0.01) and ionized calcium (p = 0.017). In boys with JIA, no significant differences were observed related to the polymorphic alleles or genotypes. Conclusions: We suggest that G allele and the GG genotype of the glucocorticoid receptor gene BclI polymorphism contribute to an unfavorable course and low bone mineral density in girls with JIA. [ABSTRACT FROM AUTHOR]

Background/Purpose: Systemic juvenile idiopathic arthritis (SJIA) is one of the most striking forms of juvenile arthritis, required biologics due to failure of corticosteroids (CS) and DMARDs. In Russia until March 2013 no Il-1 blockers were available. Since tocilizumab (TCZ) was approved in adults with rheumatoid arthritis we used it for treatment of SJIA. The aim of our study was to evaluate outcomes and to find possible criteria, related with different treatment TCZ protocols and achievement TCZ-off remission. Methods: our retrospective study was included 33 active SJIA children who fall CS, methotrexate (MTX), cyclosporine A (CsA) and their combination. We used TCZ in 2 branches in standard doses: every 2 (Q2W) or every 4 weeks (Q4W). The randomization was based on efficacy which was evaluated in 14th day. If patient had no signs of TCZ inefficacy during next 2 weeks (days 15-29) the patient was referred to Q4W group (n=24), if any clinical or laboratorial signs of inefficacy during first 4 weeks were occurred the patient was treated Q2W (n=9). The protocol of this trial was approved by local Ethic Committee of our University. The term 'efficacy' means at least ACR70 improvement and absence of systemic features. Results: The main demographic parameters (Me;IQR) included the age-10.2 (6.0-12.75) years and delay of TCZ-36.0 (11.2-97.0) months. Treatment before TCZ were CS-31 (93.9%), MTX-29 (87.9%), CsA-16 (48.5%) and their combination. The macrophage activation syndrome (MAS) before TCZ was in 8 (24.2%). During the trial CS successfully discontinued 19/31 (61.3), CsA 9/16 (56.3%), MTX 8/29 (27.6%) patients. In 5 children TCZ was discontinued due to stable remission with median duration 640 days (3/5 remission off-medication, 2/5 still on MTX). After TCZ initiation 4 children have experienced MAS, but all of them had MAS before TCZ, so no 'new cases' were observed on TCZ. 3 children early withdrew during the trial due to adverse events (infusion reaction, MAS) and 1 child died (severe uncontrolled MAS). Patients which were treated every 4 weeks had milder SJIA course compare with Q2W (table ). Factors, related with milder SJIA course and allowed to use Q4W TCZ were: Hb>10.3 g/dl (p=0.00001), WBC ≤12.6*109/l (p = 0.013), granulocytes ≤8556 cells/μl (p = 0.00037), CRP ≤82.2 mg/l (p = 0.002), ESR ≤26 mm/h (p = 0.02), ferritin ≤605 mg/ml (p = 0.0001) before start of TCZ and granulocytes in 1 week after 1st TCZ ≤8142 cells/μl (p = 0.014). Criteria, associated with TCZ-off remission were: absence of knee (p = 0.045) and cervical spine involvement (p = 0.03), number of active joints ≤12 (p = 0.05), ESR ≤40 mm/h (p = 0.05), total protein ≤6.6 g/dl (p = 0.04) at the moment of 1st TCZ infusion and granulocytes in 2 week ≤2907/μl (p = 0.038), WBC in 4 week ≤6300/μl (p = 0.026) after 1st TCZ. [ABSTRACT FROM AUTHOR]

Background/Purpose: macrophage activation syndrome (MAS) is a life-threatening complication of systemic juvenile idiopathic arthritis (SJIA). More than half cases of MAS are steroid-resistant and required to use second-line agents, such as cyclosporine A (CsA), intravenous immunoglobulin (IVIG) and biologic agents. Known interleukin-1 (IL-1) is the key cytokine in pathogenesis of MAS and SJIA, so anti-IL-1 treatment considered as potential effective treatment. There are several publication about efficacy of increased doses of anakinra during the MAS episodes. Data about efficacy others new IL-1 blockers (canakinumab and rilonacept) for MAS in SJIA are limited. There are only several cases of MAS during and after canakinumab (CNKB) treatment of SJIA in randomized controlled trials. Methods: a retrospective study of the clinical notes, reports of laboratory investigations and radiological images. We included 3 patients with SJIA who developed MAS. First patient (Pt#1) had the severe form of MAS, resistant to high doses of steroids, IVIG, CsA. After failure of previous treatment anakinra was added, and later changed on CNKB. Second patient (Pt#2) developed SJIA flare with severe MAS after 3rd CNKB injection, resistant to high doses steroids, IVIG, required Fresh Frozen Plasma, third patient (Pt#3) developed only mild MAS after 8th CNKB injection without signs of SJIA flare. Indications for increased doses of CNKB were inefficacy of previous anti IL-1 treatment in standard and increased doses and severity of MAS (Pt#1, Pt#2) according the manufacture's manual permitted to use the maximum dose of 300 mg per injection. The initial CNKB dose before MAS was 4 mg/kg every 4 weeks in Pt#2 and Pt#3. All patient during the MAS received one single injection of increased dose of CNKB: 15 mg/kg (Pt#1), 12.5 mg/kg (Pt#2) and 7.5 mg/kg (Pt#3). CNKB was injected every 4 weeks with gradually tapering dose up to 4 mg/kg every 4 weeks. All parents signed the inform consent. Institutional Review Board affirmed this kind of treatment. Results: in Pt#1 initial treatment with standard doses of anakinra was insufficient and dose was increased up to 20 mg/kg/day with good response. Later anakinra was changed on CNKB in 1st dose 15 mg/kg every 4 weeks with gradually tapering dose up to 6 mg/kg up to now. The switching from anakinra to CNKB did not loose the efficacy. In Pt#2 after initiation of increased dose of CNKB the flare of JIA and active MAS was dramatically abrupt up to 7th day after 1st injection. Total normalization of lab tests occurred in 2 weeks. After normalization we tapered corticosteroids. In Pt#3 MAS also quickly disappeared, the normalization of lab test also occurred in 10 days. No side and adverse effects were noticed during using of increased anakinra and CNKB doses. Conclusion: SJIA and MAS are both IL-1- dependent conditions. The SJIA flare and MAS usually associated with increased production of pro-inflammatory cytokines, especially IL-1β. So we suppose that increased levels of IL-1β require increased doses of IL-1 blockers. Our data shows the efficacy and safety of increased doses of IL-1 blockers. It is necessary to provide future trials to evaluate the efficacy and safety increased doses of IL-1 blockers for treatment MAS in SJIA. [ABSTRACT FROM AUTHOR]

Background/Purpose: Anemia of chronic disease (ACD), also referred to as anemia of inflammatory response, is an anemia seen in chronic illnesses, particularly-in JIA. Now it is suggested to be mostly the result of the hyperproduction of hepcidin which in turn is a result of influence of proinflammatory cytokines, primarily-IL-6 considered to be the primary cause of anemia in patients with JIA (Tanaka, Kishimoto, 2012). However, IL-6 blockers itself may provoke the onset of Macrophage Activation Syndrome (MAS) (Kobayashi et al., 2011), manifesting, particularly, also with anemia. In view of the fact that macrophages involved in MAS express CD163-a scavenger receptor that binds hemoglobin-haptoglobin complexes-and trigger the pathways which are important for adaptation to oxidative stress induced by free iron (Grom, Mellins, 2010) we can consider hepcidin as a welcome challenge to predict the development of MAS early in the course of the disease. Objective of this study was to assess the possibility to use the serum hepcidin level for predict development of MAS in children with JIA. Methods: 25 children with polyarticular and systemic onset JIA and ACD were studied. Laboratory tests (complete blood count, erythrocyte sedimentation rate, C-reactive protein, total serum iron, serum ferritin, and total iron binding capacity, soluble transferrin receptor and serum hepcidin) and standard clinical parameters were monitored at the beginning of treatment, and during its course. To evaluate the prognostic value of serum hepcidin level factorial regression was used with hemoglobin concentration and red blood cells count in blood as dependent variables and 26 sets of clinical and laboratory signs including serum hepcidin level as independent variables. Results: Combination of concentrations of hepcidin, ferritin and soluble transferrin receptor had the most prognostic value. The response surface analysis revealed a non-linear pattern with a ridge making possible to predict evolution of anemia to MAS under a combination: hepcidin <140 ng/mL and ferritin >160 μg/L. The following combinations were associated with high probability of evolution of ACD to a severe form, but not to MAS: 1. hepcidin >200 ng/mL and ferritin <140 μg/L; 2. hepcidin >140 ng/mL and soluble transferrin receptor <1.6 mg/L; 3. hepcidin >140 ng/mL and total iron binding capacity >46 mcmol/L. Mean corpuscular hemoglobin was a more sensitive predictor than the level of hemoglobin Conclusion: Identified risk zones for evolution of anemia to MAS or to a severe form of ACD have rather good explanations in terms of known theoretical concepts of iron metabolism. Attention should be paid to anemia associated with low levels of hepcidin in combination with high levels of ferritin, which can be regarded as a predictor of evolution to MAS in patients with JIA. The resulting numerical characteristics may be considered as indicative, and require verification on a larger sample. Better definition of MAS and more numerous study groups will help to calculate sensitivity and specificity of the prognostic accuracy. [ABSTRACT FROM AUTHOR]

Background/Purpose: Uveitis often is the only initial clinical manifestation of JIA for years. There are no reliable markers of JIA-associated uveitis and impossibility to overcome ocular barriers impede diagnosis and treatment leading to blindness. During the last years the number of proteins identified in tears increased from 200 (Herber et al., 2001) of only 17 (Zhou et al., 2003) different molecular weights (MW) to 491 (de Souza et al., 2006) with 80 chemokines, cytokines, and growth factors (Sack et al., 2005). Objective of the study is to reveal protein markers of JIA-associated uveitis in tears using high-resolution mass-spectrometry and hierarchical clustering methodology. Methods: Standard clinical protocol was used to diagnose uveitis and JIA. Tear samples drawn from 17 JIA-patients with uveitis, 4 JIA-patients without uveitis, 3 patients with systemic vasculitis, 4 patients with idiopathic uveitis and 3 healthy subjects were analyzed. Tears were collected on a filter paper, digested with trypsin and the peptides were purified on Zip tips. The samples were loaded to nano C18 column attached to Shimadzu nano LC coupled in-line to LTQ Orbitrap XL tandem mass spectrometer (Thermo Fischer Scientific, GA, USA). The mass spectra of the peptides were detected with a data-dependent 4-event scan method (a survey FT-MS parent scan followed by sequential datadependent FT-MS/MS scans on the three most abundant peptide ions from the parent scan). Proteins were identified from the mass spectra results with Proteome Discoverer software for protein database search using the International Protein Index (IPI) Human Protein Database (version 1.79). Quantification was conducted using SIEVE. Results: About 3000 proteins were detected in tears. Among those, 236 proteins (MW 7.4-466 kDa) were chosen as candidates for early diagnosis of the JIA-associated uveitis. Besides the rheumatoid factors RFET12, RF-IP14, RF-IP24, cytokines and T-cell receptor alpha-chain, we identified anti-CD40 single-chain antibody fragment A49, inhibiting protein CD40 which is a member of the TNF-receptor superfamily, lipocalin-1 precursor, associated with immune response and prostaglandin synthesis, clusterin inhibiting the cytolytic reaction of complement components, anti-TNF-alfa antibody light chain Fab fragment, protein phosphatase, regulatory subunit 15B, which plays a role in cell progression, apoptosis and regulation of membrane receptors and channels, DMBT/8kb.2 protein, which takes part in the interaction of tumor cells and the immune system. Conclusion: The result of our study demonstrates the benefits of high resolution mass- spectrometry for analysis and development of molecular signatures which can be used in diagnostics. Hierarchical clustering methodology allowed grouping according to expression profiles and the dendrogram construction procedure revealed clusters of proteins associated with iron metabolism as the most promising markers of JIA-associated uveitis. Earlier it was shown that induced anterior uveitis in the eyes of rats can be described in terms of proteins drawn from the anterior chamber (Sobn et al., 2000), which result is close to our terms of description. [ABSTRACT FROM AUTHOR]

Background/Purpose: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. Methods: 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5′CTTCATTACACCTGCAGTC3′, CCR5-Δ32-R: 5′TGAAGATAAGCCTCACAGCC3′ by following condition: 95°-5′×1; 95°-15″→55°-15″→72°-60″×40; 72°-10′×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus. Results: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [ABSTRACT FROM AUTHOR]