Search

The rise in the global population has increased the demand for dietary food protein. Strategies to maximize agricultural and livestock outputs could strain land and freshwater supply and contribute to substantial negative environmental impacts. Consequently, there has been an emphasis on identifying alternative sources of edible proteins that are more sustainable, sustainable, ethical, and healthy. This review provides a critical report on future food protein sources including: plant, cultured meat, insect, and microbial, as alternative sources to traditional animal-based sources. The technical challenges associated with the production process of alternative protein sources are discussed. The most important quality parameters of alternative proteins, such as: protein composition and digestibility, allergenicity, functional and sensory attributes, and safety regulations have been documented. Lastly, future direction and conclusion have been made on future protein trends. However, further regulatory norms need to develop for safe consumption and distribution around the world. [ABSTRACT FROM AUTHOR]

Aim: Oral squamous cell carcinoma (OSCC) exhibits dysregulation of cell death pathways, including necroptosis. miR-140 closely regulates the pathogenesis of OSCC and also interferes with different steps of the necroptotic pathway. This study investigates the molecular interaction between platelet-derived growth factor receptor A (PDGFRA)-associated miR-140 and necroptotic proteins (receptor-interacting protein kinase 3 [RIPK3] and mixed lineage kinase domain like pseudokinase [MLKL]) using computational docking. Materials and Methods: This is an in silico docking analysis performed to elucidate the involvement of PDGFRA-related microRNAs in necroptosis in OSCC. TargetScanHuman 8.0 was used to identify the micro ribonucleic acids (miRNAs) and obtain their sequence related to PDGFRA. The secondary structure of miRNA was predicted using the RNAfold web server, and the 3D structure was constructed using the RNAComposer (ibch.poznan.pl). The protein structures of RIPK3 and MLKL were retrieved from RCSB PDB: Homepage and molecular docking between the necroptotic proteins and miRNA was performed with HDOCK Server. Results: The docking analysis revealed that hsa-miR-140-5p binds to position 59-65 of PDGFRA 3' UTR. The sequence of hsa-miR-140-5p was determined as 23| CAGUGGUUUUACCCUAUGGUAG |44, and its secondary structure was predicted as CAGUGGUUUUACCCUAUGGUAG. HDOCK Server revealed molecular interactions between miR-140 and the necroptotic proteins. The docking analysis between miRNA and its target proteins, MLKL and RIPK3, yielded binding scores of -262.88 and -350.92, respectively. Conclusion: Our findings demonstrate that miR-140 binds to specific regions of RIPK3 and MLKL, potentially modulating necroptosis and influencing cancer progression. These insights could pave the way for miRNA-based therapeutic strategies targeting regulated cell death in OSCC. [ABSTRACT FROM AUTHOR]

Odontogenic keratocyst (OKC) is an uncommon developmental cyst with a high recurrence rate. Epithelial dysplasia is a rarely recognized phenomenon in OKCs, with only a few acceptable cases reported in the literature. The exact pathogenesis of dysplastic changes in epithelial lining is difficult to explain, in the absence of molecular analyses. Here, we report a rare case of maxillary OKC with multiple cystic compartments displaying epithelial dysplasia in a 62-year-old man with immunohistochemical analyses and a comprehensive review of the literature. It may be prudent to believe that the aggressive behaviour in the epithelial lining of OKC is an inherent property of all OKCs, which is only dictated by the epithelium but is also determined by the stromal cells of the cyst wall; the dysplastic changes, however, could be resultant to chronic inflammatory reaction and inflammation-mediated carcinogenesis mechanism. It is recommended that the dysplastic features in the epithelial lining of all odontogenic cysts must be addressed in all pathology reports along with close clinical follow-up. [ABSTRACT FROM AUTHOR]

Introduction: Medicinal plants and their substances are used as adjunctive therapies for a range of acute and chronic inflammatory diseases. Syzygium aromaticum and Persea americana, in particular, have demonstrated beneficial effects, including anti-inflammatory and antioxidant properties, in the management of inflammation. Although the extracts from these plants have been assessed in research, the possibility of combining them to synthesise a mouthwash and evaluate its effectiveness has not yet been investigated. Aim: To evaluate the combined anti-inflammatory and antioxidant properties of a mouthwash formulation based on the extensively nutritious avocado fruit (Persea americana) and clove (Syzygium aromaticum). Materials and Methods: This in-vitro investigation was carried out in the Oral Pathology and Microbiology Department at Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, Tamil Nadu, India, between December 2021 and July 2022. A mouthwash was formulated with extracts from clove and avocado fruit, and its anti-inflammatory and antioxidant properties were evaluated using Bovine Serum Albumin (BSA) denaturation and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays, respectively. Microsoft Excel was utilised for data collection, and Statistical Package for the Social Sciences (SPSS) version 23.0 with independent t-tests was used for statistical analysis. A p-value of 0.05 was considered statistically significant. Results: The anti-inflammatory activity of the prepared mouthwash based on P. americana and Syzygium aromaticum at a concentration of 50 µL (86.62% inhibition) was comparable to that of the standard drug (diclofenac sodium) (84.82% inhibition); however, its antioxidant properties were significantly lower. Conclusion: The mouthwash synthesised from the edible part of P. americana in conjunction with Syzygium aromaticum exhibited superior anti-inflammatory properties, with the highest activity observed at a concentration of 50 µL. Therefore, the prepared formulation could be used for managing minor inflammatory conditions. [ABSTRACT FROM AUTHOR]

Introduction: Decalcification is a technique used to remove calcium salts from hard tissue specimens, such as bone or teeth, to make them suitable for sectioning. X-rays, physical methods, and chemical methods are commonly used to determine the endpoint of decalcification. However, these procedures can be cumbersome, may deteriorate the specimen, and are often subjective. Aim: To determine the endpoint of decalcification of hard tissue specimens using a colour palette. Materials and Methods: A cross-sectional study was conducted in the Department of Oral Pathology at Saveetha Dental College and Hospitals in Chennai, Tamil Nadu, India, over a period of 5 months. A total of 25 hard tissue specimens (10 bone and 15 teeth) were subjected to decalcification in 20% formic acid. To evaluate the endpoint of decalcification, silver nitrate solution was added to the formic acid, and the colour change was noted. The resulting colour was compared with a previously patented colour palette (Patent number: 202241047215). Once a lighter colour was obtained, the specimen was processed, sectioned, and stained using Haematoxylin and Eosin (H&E). The slides were then evaluated by two pathologists. Results: A total of 8 (80%) bone samples exhibited excellent staining, while 2 (20%) samples showed a good staining score. Regarding the tooth samples, 14 (93.3%) showed excellent staining, and one (6.66%) tooth displayed a good staining score. Conclusion: The present method is a simple and safe way to determine the endpoint of decalcification for a specimen. It does not damage the tissue, thus preserving the integrity of the hard tissue specimen. [ABSTRACT FROM AUTHOR]

Introduction: Basaloid squamous cell carcinoma (BSCC) is a rare aggressive variant of oral squamous cell carcinoma (OSCC) with a high propensity for distant metastasis. In this article, we present clinicopathological and survival data of eight cases of BSCC and further analyse the behaviour of these tumours with the help of E-cadherin, CD34, CD105 and B cell lymphoma-2 (Bcl-2) immunoexpression. Materials and Methods: Histopathologically confirmed cases of BSCC were retrieved from the department archives. Clinicopathological details and survival data of these patients were collected. Immunohistochemical analysis was performed with Bcl-2, E-cadherin, CD34 and CD105 on these cases and compared with different grades of OSCC (well differentiated, moderately differentiated and poorly differentiated). The statistical analysis was done using IBM SPSS software version 23. Results: BSCC was seen commonly in males of age group 49–71 years and predominantly reported in the retromolar trigone. Bcl-2 expression was significantly lower in BSCCs when compared to the conventional OSCC groups (P < 0.05). E-cadherin expression showed no significant difference between BSCC and well-differentiated OSCC group (P = 0.487). The overall mean survival for patients with BSCC was 6.37 months. Discussion: BSCCs of the oral cavity show increased CD105, CD34, E-cadherin and low Bcl-2 labelling. A substantial relationship between the tumour neo-angiogenesis, collective cell migration and apoptotic property could be related to the aggressive nature of this tumour and its poor overall survival rate. BSCCs are common in middle to older aged male and show increased expression of CD105, CD34 and E-cadherin. [ABSTRACT FROM AUTHOR]

Background: Oral mucoceles (OMs) are common cystic lesions seen mainly on the lower lip in young males. Histologically, OMs show variegated features such as clear cell changes, myxoglobulosis, calcifications, and papillary synovial metaplasia (PSM)‐like changes. The aim of the present paper is to morphometrically analyze PSM‐like changes seen in OMs. Methodology: Seventy‐two cases of histologically proven OMs were retrospectively retrieved and divided into two groups: group I without PSM‐like changes and group II with PSM‐like changes. The internal area was measured using Image J software. SPSS version 26 was used to analyze the data. Results: There were 50 cases in group I (mean age 19.23 years) and 22 cases in group II (mean age 30.25 years). The lower lip was the most commonly affected site for both groups. The mean age in group II was significantly higher than group I. In contrast, the mean internal area was significantly higher in group I. Conclusion: We speculate that PSM‐like changes in OMs represent an incomplete repair phenomenon. Knowledge of such an innocuous process is essential for differentiation from malignant histopathological mimickers. [ABSTRACT FROM AUTHOR]

Introduction: Oral cancer poses a serious health challenge globally, particularly for nations undergoing economic transition. The number and size of lymph nodes obtained, along with nodal involvements, are crucial for proper diagnosis, treatment, and prognosis. Aim: To assess the number of lymph nodes obtained before and after treating the specimens with the Lymph Node Revealing Solution (LNRS) along with staining characteristics. Materials and Methods: The present prospective observational study was conducted at the Department of Oral Pathology and Microbiology, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Chennai, Tamil Nadu, India, over a period of six months from January 2023 to June 2023 in a tertiary oral healthcare centre in Chennai. Six histologically confirmed Oral Squamous Cell Carcinoma (OSCC) cases with neck dissection were included in the study, involving 32 lymph node levels. Lymph nodes were grossed using both routine procedures of palpation and visualisation and after treatment with LNRS for two days. The number of nodes obtained through both methods was compared along with the staining characteristics. The data were analysed using Statistical Package for Social Sciences (SPSS) software version 26.0. Chi-square and paired t-tests were used to compare the two groups, and any value less than or equal to 0.05 was considered statistically significant. Results: Out of 134 lymph nodes, 21 were positive with conventional fixation, whereas after the application of LNRS, an additional 41 lymph nodes were retrieved. Two nodes showed metastatic deposits; fortunately, the additional positive nodes did not affect the staging. No statistically significant difference was found before and after immersion in LNRS regarding staining characteristics. The mean area of the yielded nodes was 84.71±4.85 mm2. There was a statistically significant difference between the size of lymph nodes between the manual grossing method and after immersion in LNRS (p-value <0.001). Conclusion: The study confirmed that the LNRS technique identified very small lymph nodes in oral cancer patients, which may contain metastatic deposits. This might change the stage of the disease and influence the mode of treatment. [ABSTRACT FROM AUTHOR]

AbstractPorous starch (PS), a modified form of starch with unique properties, is attracting substantial attention for its diverse advantages and applications. Its intricate porous structure, crystalline and amorphous characteristics, and hydrophilic–hydrophobic properties stem from pore formation via physical, chemical, enzymatic, and combined synergistic methods. Porous starch offers benefits like improved gelatinization temperature, water absorption, increased surface area, tunable crystallinity, and enhanced functional properties, making it appealing for diverse food industry applications. To optimize its properties, determining the parameters governing porous structure formation is crucial. Factors such as processing conditions, starch source, and modification methods substantially impact porosity and the overall characteristics of the material. Understanding and controlling these parameters allows customization for specific applications, from pharmaceutical drug delivery systems to enhancing texture and moisture retention in food products. To date, studies shedding light on how porosity formation can be fine-tuned for specific applications are fewer. This review critically assesses the existing reports on porous starch, focusing on how preparation methods affect porosity formation, thereby influencing the product’s crystallinity/hydrophilic-hydrophobic nature and overall applicability. [ABSTRACT FROM AUTHOR]

Introduction: Human teeth serve many crucial functions, and aesthetics is one of these. Aesthetics and beauty are often correlated with the Golden Divine Ratio (GDR), a unique proportion hypothesised to exist in individuals or things with a harmonious appearance. Aim: To estimate the crown length, root length, and GDR in extracted human permanent maxillary and mandibular Central Incisors (CI) in the population of Tamil ethnicity from South India. Materials and Methods: This in-vitro cross-sectional study was conducted in the Department of Oral Pathology and Microbiology at Saveetha Dental College and Hospitals, Chennai, Tamil Nadu, India, from January 2023 to October 2023. The study included a total of 90 extracted human teeth from the Institutional tooth repository, out of which 27 were upper permanent CIs and the remaining 63 were mandibular CIs. Crown length and root length were measured using digital vernier calipers, and golden ratios were derived. Statistical Package for Social Sciences (SPSS) software version 26.0. was used for descriptive analysis and deriving means and standard deviation. Results: The average crown length, root length, and total length of upper CIs were 8.06±0.09 mm, 13.01±1.47 mm, and 21.06±2.36 mm, respectively. For the remaining 63 extracted permanent mandibular CIs, the mean crown length, root length, and total length were 7.85±0.66 mm, 12.6±0.97 mm, and 20.45±1.49 mm, respectively. The Root-to-Crown (R/C) ratio and Total Length to Root Length (T/R) ratio approximated 1.618 for both sets of teeth. Conclusion: The crown length of maxillary and mandibular CIs from the Tamil population followed the golden ratio in the present study. [ABSTRACT FROM AUTHOR]

Aim: The aim of this study was to present and analyze detailed clinicopathological data of periapical cysts (PCs) and periapical granuloma (PG) in a cohort of 135 cases from the South Indian Population. Methodology: The present study included 135 cases of PC and PG out of 2696 biopsies submitted over 3 years. The clinicodemographic data which included age, gender, location, radiographic appearance, and treatment were collected along with the histopathological examination of the biopsied specimen. Data were entered in a Microsoft Excel spreadsheet, 2021, and analyzed using SPSS software ver. 26. Results: There were 71 cases of PG and 64 cases of PC. The mean age of occurrence in PG was slightly lower than cases in PC. Irrespective of the group, there was a clear male preponderance, and maxillary permanent central incisors were most commonly affected. However, no significant difference was noted. Radiographically, PC significantly showed more well-defined corticated radiolucent lesions compared to PG where most cases were ill-defined (69.01%). Histologically, all cases showed classic features for diagnosis with additional histological characteristics which may aid in diagnosis. Conclusion: PG was more common than PC. There was a predilection for the male gender in both lesions. The actual incidence of these lesions would be actually high, as some cases are lost to private practitioners, and not all the lesions are submitted for histopathological examination. [ABSTRACT FROM AUTHOR]

Objectives: This study aimed to quantify the vascularity in histological grades of oral submucous fibrosis (OSMF) and to determine if there is any connection between vasculogenesis and malignisation. Recent studies show no significant change in vascularity as the stage advances as opposed to the conventional concept. Methods: A comprehensive database search until December 2022 was conducted for published articles on vascularity in OSMF following preferred reporting items for systematic reviews and meta-analyses guidelines. Results: A total of 98 articles were screened of which 13 were included for systematic evaluation. The study included 607 cases, with a definite predilection for the male gender. Of the 13 studies, 11 evaluated mean vascular density. In more than half of the studies, the vascularity decreased as the stage advanced. Similar results were obtained for endothelial cells/μm2, mean vascular area percentage and mean vascular area. Conclusion: The present review supports the prevailing concept that vascularity decreases with the advancement of the OSMF stage. This denies the systemic absorption of carcinogens into the circulation with resultant longer exposure of compromised epithelium and malignisation. [ABSTRACT FROM AUTHOR]

Background: Forensic odontology plays an important role in mass disasters, house fires, criminal deaths, identification of missing persons, and child abuse cases. Teeth are the most stable part of the human body and are resistant to thermal, mechanical, and chemical insults. The aim of this study was to evaluate the effectiveness of mandibular intercanine distance and mesiodistal width of mandibular first molar in gender determination. Materials and Methods: The study comprised 100 participants (50 males and 50 females) in the age group of 18-23 years. The mandibular impressions were made, and casts were prepared using dental stone. The intercanine distance and mesiodistal width of the right mandibular first molar were measured using digital vernier callipers. The data obtained was statistically analysed using SPSS software version 23. Results: The mean mandibular intercanine distance was found to be 27.2 ± 2.3 in males and 25.94 ± 1.76 in females (P = 0.03). There was no statistical difference in the mesiodistal width of the mandibular molar between males and females (P = 0.166). However, the mean mesiodistal width of males was higher when compared to females. Conclusion: Males have a greater intercanine width and mesiodistal dimension when compared to females. This result will be helpful in forensic medicine, anthropology, orthodontic treatments, and clinical dentistry. [ABSTRACT FROM AUTHOR]

Background: Nodal involvement in squamous cell carcinoma is an important feature directly associated with the poor prognosis in patients with head and neck squamous cell carcinoma (HNSCC). There are no clear cut indicators available currently to identify the lymph node metastases and overall prognosis in HNSCC. Thus, the current study was conducted to correlate the immunoexpression of cytokeratins (CK) 8, 10, and 14 with lymph node metastases and tumour differentiation in patients with HNSCC. Material and Methods: The study population included 61 retrospective cases of HNSCC with lymph node metastases (n = 31) and without lymph node metastases (n = 30). Expression of CK 8, 10, and 14 was assessed by immunohistochemical staining procedure. Using Pearson's Chi-square test and Spearman's correlation coefficient, the correlation of these markers with lymph node metastases and tumour differentiation was statistically analysed. Results: The expression of CKs in HNSCC cases was higher than in controls. In nodal metastasis cases, CK 8 expression was noted in >50% of the tumour cells at the invasive tumour front (ITF) (P value 0.008), and in cases without nodal metastasis, <1% or negative expression was noted. CK 10 expression gradually decreased as the tumour grade increased. Association of CK 10 expression and tumour differentiation exhibited statistically significant results (P value 0.03). CK 14 expression was noted in the entire epithelium and at the ITF, strongly in most cases; however, CK 14 did not correlate with the lymph node metastasis and tumour differentiation as well. Conclusion: We found a strong correlation of CK 8 expression with nodal metastasis in HNSCC, and it can be utilised as a reliable prognostic indicator. [ABSTRACT FROM AUTHOR]

Adenomatoid Odontogenic Tumour (AOT) constitutes about 5% of all odontogenic tumours and is most commonly seen in young females, in association with impacted maxillary canines in a Dentigerous Cyst (DC) like relationship. Extrafollicular AOT is an uncommon variant seen unassociated with impacted teeth. Rare cystic presentation is reported with most cases seen arising from or in association with DC. Here, the authors present a case of extrafollicular AOT in a 29-year-old Dravidian male, who reported with a chief complaint of swelling of lower anterior jaw region. Radiographically, a well-defined radiolucent lesion was noted extending from mesial aspect of the roots of right mandibular second molar, crossing the midline to involve the body of mandible till mesial aspect of lower left canine. There was evidence of cortical perforation. The lesion was excised and sent for histopathological evaluation. Histopathologically, the lesion was diagnosed as cystic AOT-extrafollicular variant. There was adequate healing and no signs of recurrence or residual disease were noted 18 months after the surgery. The present case is a unique presentation of cystic extrafollicular AOT with pictorial demonstration and detailed explanation of its pathogenesis. [ABSTRACT FROM AUTHOR]

Background: Intraosseous rhabdomyosarcoma (I-RMS) with unique unique TFCP2 mutation is a recently described entity with an aggressive clinical course. The present review aimed to summarize and analyse the available data on head and neck I-RMS with TFCP2 mutation to update the current cognizance about the pathology for nobler diagnostic and therapeutic purposes. Methodology: Electronic databases were searched, and data were extracted for age, gender, location, histopathology of primary lesion, tumor cell type, necrosis and mitosis, immunohistochemical markers, mutation, follow-up and overall survival. Results: 27 cases were included and showed a mean age of 28.1±16.84 years (median- 22.5 years; Range 11-74 years). There was no definitive gender preponderance. Undisputedly, mandible was the most common affected site. Histologically, I-RMS show predominantly spindle and epithelioid morphology with rare rhabdoid differentiation. CK, desmin, MyoD1 and ALK are useful immunohistochemical markers. The fusion partner does not seem to affect the survival in I-RMS Conclusion: I-RMS is rare malignancy with limited information available in literature. Molecular characterization should be done for all cases with adequate follow-up. TPCP2 could also be an attractive target for therapies. [ABSTRACT FROM AUTHOR]

Gingival diseases are commonly observed in children and young adults. However, Giant Cell Fibroma (GCF) is a rare occurrence in children, accounting for only 2.2-7.3% of oral fibrous tumour cases. Clinically, these lesions often resemble squamous papillomas, and a definitive diagnosis can only be confirmed through histopathological {Haematoxylin and Eosin (H&E)} examination. Hereby, the authors present a rare case of gingival GCF in a three-year-old boy who presented with a pebbly growth on the mandibular gingiva. Initially, the lesion was clinically diagnosed as a papilloma and subsequently excised. The final diagnosis of GCF was established through histological examination. It is crucial for paediatric dentists to consider GCF as a differential diagnosis for lesions, particularly those with a papillary surface. Additionally, submitting all excised specimens for histopathological examination is recommended. [ABSTRACT FROM AUTHOR]

Background: Post-stroke spasticity is common and an early predictor of the severity of spasticity can help track recovery trajectory helping to modify rehabilitation plans. Objectives: We explored the utility of the Alberta Stroke Program Early CT Score (ASPECTS) to predict functional motor capacity in patients after acute ischemic stroke. Methods: One hundred and one patients (mean age of 58.6 ± 7.6 years; M:F = 72: 29) with the first documented acute ischemic stroke were followed up for three to twelve months after the stroke. Cerebral lesions within the territory of the middle cerebral artery were evaluated using the ASPECTS. Spasticity was assessed using the Modified Ashworth Score (MAS) and walking with Timed Up and Go test (TUG). The associations between severity of spasticity and size/extent of infarct as derived from ASPECTS and between spasticity and functional walking in post-stroke survivors were analyzed. Results: Among the patients studied, 61.3% (n = 62) had infarct in the region of supply of the left middle cerebral artery (MCA) and 38.7% (n = 39) had infarct in the region supplied by the right MCA. Three percent (n = 3) had a low ASPECTS, 53.6% (n = 54) had an intermediate score and 44.4% (n = 44) had a high score. The majority of patients with no to mild spasticity had high ASPECTS. Worse spasticity was significantly associated with low ASPECTS (P = 0.001). High scores in Timed Up and Go test (TUG) were associated with low ASPECTS (P < 0.001). Patients with high ASPECTS had the propensity to have subcortical infarcts (P < 0.001) when compared to those with moderate ASPECTS, who had a mix of cortical and subcortical infarcts. Conclusion: ASPECTS at admission in patients with acute ischemic stroke is a good predictor of post-stroke spasticity and functional walking. Low ASPECTS is associated with higher spasticity and lower functional walking status on follow-up after stroke. [ABSTRACT FROM AUTHOR]

Dentinogenic ghost cell tumor (DGCT) is a rare tumor of odontogenic origin. A locally invasive lesion can be described by the presence of ameloblast-like epithelial islands, ghost cells, and dentinoid material. It is one of the few lesions with a predilection for the Asian population. The available literature has revealed that only 131 cases to date have been reported and published from 1968 to 2022. The following is a case report of a 25-year-old male with a tumor in the left lower back teeth region for the past 1 month. Orthopantomogram (OPG) reveals a well-defined unilocular radiolucency extending anteroposteriorly and crossing the midline. Histopathology revealed basal ameloblast-like cells and central stellate reticulum-like cells with the characteristic presence of ghost cells. The diagnosis was made based on the clinical, radiographical, and histopathological correlation and was confirmed using immunohistochemical analysis as a DGCT. [ABSTRACT FROM AUTHOR]

Rationale: Sclerosing variant of adenoid cystic carcinoma (SACC) is a rare variant of adenoid cystic carcinoma (ACC) with only two cases in the literature. In this article, we report two cases of SACCs and attempt to explain the reason for sclerosis and its association with the disease outcome. Patient Concerns: The first patient is a 43-year-old Dravidian Indian female with a chief complaint of pain and swelling in the right posterior cheek region of four months' duration. The second patient is an 8-year-old boy with a well-defined swelling in the left cheek region. Diagnosis: Both these cases were diagnosed as sclerosing variants of ACC. Treatment: The tumour was surgically excised for both patients. Outcomes: Both the patients had no signs of residual disease/recurrence. Take-away Lessons: We opine that the dense sclerotic stroma may have a preventing role in tumour cell growth and progression. [ABSTRACT FROM AUTHOR]

Introduction: Oral submucous fibrosis (OSMF) is a potentially malignant disorder of the oral cavity. The malignant transformation rate of OSMF is 7.6%, with a mean transformation rate of 4.7 years. It is characterized by epithelial atrophy and progressive accumulation of collagen fibers in lamina propria and submucosa of the oral mucosa. Increased collagen synthesis and decreased collagen breakdown play a major role in OSMF pathogenesis. In such fibrotic disorders, mediators such as growth factors, hormones, cytokines, and lymphokines primarily affect the production of extracellular matrix and collagen. PDGF-BB plays a major role in stimulating the replication, survival, and migration of myofibroblasts during the pathogenesis of fibrotic diseases. Aim: The main objective of this study is to assess the correlation between clinicopathological parameters and serum expression of PDGF-BB in OSMF and healthy controls. Materials and methods: A cross-sectional study, including fifteen patients with OSMF and fifteen healthy controls, was conducted. All cases had complete clinical and histopathological investigations. The PDGF-BB serum was assessed using an enzyme-linked immunosorbent assay. Results and discussion: The mean serum PDGF-BB expression values for stages I, II, and III are 1238.3±165.3 pg/ml, 1437.7±134.6 pg/ ml, and 1739.2±143.3 pg/ml, respectively. There was a correlation between the mean difference between the OSMF and control, and the clinical staging subgroups. (p-value<0.05) The mean serum expression of PDGF-BB in subgroups of histopathological grade I, II, and III was 1654.42±187.3 pg/ml, 1873.7±276.3 pg/ml,1739.2±143.3 pg/ml, with an insignificant p-value>0.05. Conclusions: The mean serum PDGF-BB level was significantly elevated in OSMF patients. There was a positive correlation between the clinical stages, compared to the control groups. Therefore, evaluation of PDGF-BB can be used as an adjunctive serological biomarker in monitoring and predicting OSMF progression as, by inhibiting it, this protein PDGF BB could provide a unique therapeutic approach to combat fibrosis, and may also aid in an effective treatment of this precancerous condition. [ABSTRACT FROM AUTHOR]

Oral Verruciform Xanthoma (VX) is a verrucopapillary lesion seen as a cauliflower-like/papillary growth in the oral cavity. The aetiopathophysiology of VX is explained by several pathogenic processes. The presence of xanthoma cells or foamy macrophages is considered a characteristic feature of this lesion however there is disagreement about the origin of these cells. In this case report, the authors described a case of VX with concomitant candidal infection in a 31 years old male patient. Although not fully explored, a hypothesis is constructed to understand the relationship between Candida albicans and VX, combining the current literature and present findings. Presumably, an initiation event varies from patient to patient and site to site, additionally, the candidal infection may also play an important role in the pathogenesis of VX. [ABSTRACT FROM AUTHOR]

Introduction: Oral intravascular papillary endothelial hyperplasia (IPEH) is a rare entity with only 105 cases reported so far. Labial and buccal mucosa are the commonly affected sites. These sites are coincidently subjected to continuous minor trauma, which led the researchers to opine that IPEH could have a traumatic etiology with a further role of fibroblast growth factors. Clinical Presentation: We report a case of IPEH of right buccal mucosa in a 35 years old South Indian male who clinically presented as mucocele. Histopathologically, multiple lesions were found. Immunohistochemical and histochemical findings have also been presented. Discussion: The case is supported by a plausible mechanism involved in the pathogenesis. Thus, IPEH must be included in the clinical differential diagnosis of oral mucoceles and hemangioma. Take-away Lessons: Being a reactive lesion, it does not require extensive treatment. Clinicians and histopathologists must be aware of this uncommon yet benign condition for appropriate therapy. [ABSTRACT FROM AUTHOR]

Intraductal carcinoma (IDC) of salivary gland is an extremely rare malignancy affecting mainly the parotid glands. Intraoral occurrence is seen mainly on the palate where the tumour arises from the minor salivary glands. No previous case has been described in parapharyngeal space. We report a case of low-grade IDC of the anterior compartment of the right parapharyngeal space that clinically resembled a lesion of vascular origin. Due to the extreme rarity of intraductal carcinoma, it may not be considered by dentists and dental specialists in clinical differential diagnoses, leading to delay in treatment. Intraductal carcinoma must be differentiated from its close histological but high-grade mimickers to avoid unnecessary overtreatment and better patient outcome. [ABSTRACT FROM AUTHOR]

Introduction: Aspergillus fumigatus is the most prevalent fungal pathogen reported to cause diseases such as aspergilloma or aspergillosis in humans. Aspergillomas are commonly seen in a poorly drained and avascular cavitary space. Paranasal sinuses are most commonly involved, especially maxillary sinus. In the past two decades, the incidence of aspergillosis has increased substantially. Aims: To evaluate cases reported as aspergilloma of the maxillary sinus and to determine the percentage of cases involving aspergilloma of the maxillary sinus in healthy individuals. Materials and Methods: After the final full-text review, 16 articles were included in this systematic review. Data extracted from these full-text articles was reviewed. Results: 83 % of cases had a history of dental procedures, with 42 % of those being due to infection from previous extraction sockets and 41 % due to root canal therapy (RCT). About 43% of the patients were immunocompromised, while 56% were healthy without any predisposing conditions. Conclusion: Aspergillus fungal infections of the paranasal sinuses are common and can occur in apparently healthy as well as immunocompromised individuals. Aspergilloma is the most common fungal infection involving the maxillary sinus with iatrogenic-dentogenic factors being predominant for initiation and progression of the infection. About 43% of the patients in this review were immunocompromised patients whereas 56% of the patients were healthy without any known predisposing conditions. The progression and prognosis of this disease depends on the location and immunologic status of the patient. So, it is very important for dentists to be cautious while performing any dental procedures so as not to initiate any iatrogenic infections. [ABSTRACT FROM AUTHOR]

Pemphigus vulgaris is an autoimmune blistering disease with an increased potential for mortality. The epithelium is key in understanding the pathobiology as it is specialized to perform functions like mechanical protection, immunological defense, and proprioception. In order to perform these array of functions, epithelial integrity is important. This integrity is maintained by a host of molecules which orchestrate the ability of the keratinocytes to function as a single unit. Desmoglein 3 antibodies formed in genetically susceptible individuals are known to cause the disruption of the intact oral mucosa leading to the formation of blisters in pemphigus vulgaris patients. However, there are underlying complex triggering pathways leading to the clinical disease. The aim of the review is to congregate and critically appraise the various triggering pathways which contribute toward the pathobiology of pemphigus vulgaris. Articles relevant to the pathobiology of pemphigus vulgaris were identified from various search databases till the year 2020. The pathogenesis of pemphigus vulgaris is complex, and it involves an in‐depth understanding of the various predisposing factors, provoking factors, and progression mechanisms. Congregation of the various triggering pathways will open our minds to understand pemphigus vulgaris better and in turn develop a reliable treatment in the near future. [ABSTRACT FROM AUTHOR]

Pemphigus Vulgaris (PV) is a severe autoimmune disease characterized by supra-basal blisters in the skin and mucous membranes of a wide range of mammals, including humans. It not only affects the skin but also has severe oral manifestations. It has been stated that auto-antibodies are produced, for unknown reasons, which are directed against desmogleins present on the epithelium and thus leads to acantholysis and intraepithelial blistering. But the exact mechanism is still not completely understood. Here we would like to shed light on a new pathologic mechanism i.e., apoptolysis, which emphasizes that apoptotic enzymes contribute to acantholysis development both in terms of molecular events and chronologic sequence. A possible role of apoptolysis has been discussed in purview of PV. [ABSTRACT FROM AUTHOR]

Rationale: COVID-19 patients, especially immunocompromised or severely ill, have a higher probability of suffering from invasive fungal infections. Patient Concerns: A 41-years-old male reported with pain and heaviness in the face for the past 20 days. Patient had tested COVID-19 positive 20 days back and was recently diagnosed with diabetes mellitus. On histopathological examination numerous hyphae resembling mucor and asper fungi were evident. Diagnosis: Chronic invasive aspergillosis with fulminant mucormycosis sparing palate. Treatment: Since the lesion was spreading very rapidly the patient was referred to an isolation facility for further management. Outcomes: We have postulated few hypothesis for the coinfection of aspergillosis and mucormycosis in our patient. Take-away Lessons: It is important for the clinicians to systematically screen post COVID-19 patients for fungal infections, especially in immunocompromised and severely ill patients. [ABSTRACT FROM AUTHOR]

Lichen planus (LP) is an autoimmune, mucocutaneous, T-cell mediated chronic inflammatory disease that involves the oral mucosa. The prevalence of LP is 0.04–2% in general population with a female predilection. Patients with skin lesions also manifest oral lesions predominantly and about 25% present with only oral lesions. The aim of the systematic review is to analyze the serum cortisol levels in LP patients to elucidate the role of cortisol in pathogenesis of the lesion. A comprehensive search was done using electronic data bases such as PUBMED, EMBASE, SCIENCE DIRECT, COCHRANE, GOOGLE, manual search, and back references of the articles were extracted. A total of seven relevant articles were reviewed and analyzed. Electronic database and manual search identified 55 articles. Out of which, 33 were excluded after reading titles and removing duplication and 23 studies were evaluated in detail after reading the abstract and full text. A final of seven studies were included based on the inclusion criteria to meet the research question. All the studies analyzed the serum cortisol levels in LP patients and also in healthy subjects. Within the limitations of this review, it can be inferred that Cortisol is an established stress hormone and Serum cortisol estimation could be an important indicator in identifying susceptible oral lichen planus patients. [ABSTRACT FROM AUTHOR]

Background: Workplace violence is a multi-causal, multifaceted, public health, legal and social problem faced by all occupations worldwide. Recently, there has been an increase in the prevalence of workplace violence against doctors. Even though the government has attempted to address these problems in India, doctors are still experiencing violence in their workplaces.Aim: The aim of this survey was to determine the prevalence and awareness of workplace violence among dental surgeons.Methodology: This cross-sectional study was conducted among the dental surgeons. A self-administered questionnaire containing 15 questions was made and validated. A Web-based questionnaire was developed using Google forms and was circulated. A total of 112 responses were obtained. Questions were answered with "yes" "no" or by marking the correct responses. Frequency analysis and percentage analysis were done with the obtained results.Results: Our study showed that 74.1% of the participants heard about the workplace violence and 30.4% faced violence in their clinic. The nature of the violence was physical in 0.9%, verbal in 39.3%, and sexual in 0.9% among the participants who faced violence. A total of 92.9% of the participants reported that they require policies and guidelines against this workplace violence.Conclusion: Dental surgeons should have proper knowledge about the work-related violence and methods to control this violence. Policies, procedures, and intervention strategies should be undertaken to manage this alarming issues. [ABSTRACT FROM AUTHOR]

Introduction: Human papillomavirus (HPV) are now being increasingly associated as a cause of oral squamous cell carcinomas (OSCC). This study was designed to evaluate the prevalence of HPV in Pelizaeus-Merzbacher disease (PMD) and OSCC using polymerase chain reaction that might help in better understanding of the role played by this virus in the oncogenic process even from its evolution stage. Materials and Methods: Formalin-fixed paraffin-embedded tissue samples (n = 40) of OSCC and mild, moderate, and severe dysplasia were used for this study. DNA was quantified and checked for purity spectrophotometrically. Statistical analysis was performed using SPSS software and statistical significance was assessed using Fischer's exact test (p < 0.05 was considered significant). Results: High-risk (HR)-HPV-16 was found to be positive in 35% of OSCC cases which showed a statistically significant association of HPV 16 with OSCC. Verrucous carcinoma had predominant HPV 16 infection (60%), followed by SCC with 40%. However, this association was not statistically significant. None of the OSCC samples were infected with HPV 18. Among the PMD, we found only 5% showing HR-HPV 16 infection which was not significant. Discussion: Although OSCC is attributed to tobacco and alcohol consumption, a significant proportion of OSCC cases have been demonstrated to contain HPV types. The high-risk HPV type 16 tends to be the most predominant type detected in cases of OSCC. [ABSTRACT FROM AUTHOR]

Ameloblastic fibrosarcoma (AFS) now designated as odontogenic sarcoma is a malignant odontogenic tumor characteristically composed of a benign epithelium and a malignant mesenchymal component. It can arise de novo without any preexisting lesion or it can result from the malignant transformation of ameloblastic fibroma (AF). Hereby, we report an extremely rare case of odontogenic sarcoma which was transformed from AF over a period of about 2 years. This is the first case to be reported after it has been reclassified as odontogenic sarcoma. A systematic review was also done to evaluate the studies that reported AFS arising de novo and AFS arising from AF. The objective of this study is to systematically review the studies that reported AFS arising de novo and AFS arising from AF. Articles that reported AFS arising de novo and AFS arising from AF were collected from PubMed, Medline, Embase, Cochrane, Google search and manual search. The results of the systematic review showed that six studies (46.1%) reported AFS arised de novo with no previous history of AF. Seven studies (53.84%) reported that amelobastic fibrosarcoma arised from AF. A rare case of odontogenic sarcoma transformed from AF is reported here. This is the first case report to be published on odontogenic sarcoma after the World Health Organization reclassification. AF once diagnosed should be treated immediately without any delay to avoid the chances of its malignant transformation into odontogenic sarcoma. [ABSTRACT FROM AUTHOR]