Search

Summary In grape, MYBA1 and MYBA2 at the colour locus are the major genetic determinants of grape skin colour, and the mutation of two functional genes (VvMYBA1 and VvMYBA2) from these loci leads to white skin colour. This study aimed to elucidate the regulation of grape berry coloration by isolating and characterizing VvMYBA2w and VvMYBA2r alleles. The overexpression of VvMYBA2r up‐regulated the expression of anthocyanin biosynthetic genes and resulted in higher anthocyanin accumulation in transgenic tobacco than wild‐type (WT) plants, especially in flowers. However, the ectopic expression of VvMYBA2w inactivated the expression of anthocyanin biosynthetic genes and could not cause obvious phenotypic modulation in transgenic tobacco. Unlike in VvMYBA2r, CA dinucleotide deletion shortened the C‐terminal transactivation region and disrupted the transcriptional activation activity of VvMYBA2w. The results indicated that VvMYBA2r positively regulated anthocyanin biosynthesis by forming the VvMYBA2r‐VvMYCA1‐VvWDR1 complex, and VvWDR1 enhanced anthocyanin accumulation by interacting with the VvMYBA2r‐VvMYCA1 complex; however, R44L substitution abolished the interaction of VvMYBA2w with VvMYCA1. Meanwhile, both R44L substitution and CA dinucleotide deletion seriously affected the efficacy of VvMYBA2w to regulate anthocyanin biosynthesis, and the two non‐synonymous mutations were additive in their effects. Investigation of the colour density and MYB haplotypes of 213 grape germplasms revealed that dark‐skinned varieties tended to contain HapC‐N and HapE2, whereas red‐skinned varieties contained high frequencies of HapB and HapC‐Rs. Regarding ploidy, the higher the number of functional alleles present in a variety, the darker was the skin colour. In summary, this study provides insight into the roles of VvMYBA2r and VvMYBA2w alleles and lays the foundation for the molecular breeding of grape varieties with different skin colour.

TIGIT is a lymphocyte surface receptor, which is mainly expressed on the surface of CD8+T cells. The role of TIGIT in colorectal cancer and its expression pattern in colorectal cancer infiltrating lymphocytes are still controversial. This study aimed at identifying the function of TIGIT in colorectal cancer. Patients with colorectal cancer showed significantly higher TIGIT+CD8+T cell infiltration in tumor tissues, metastases compared with paired PBMC and normal tissues through flow cytometry. TIGIT+CD8+T cells showed an exhausted phenotype and expressed low levels of killer cytokines IFN-γ, IL-2, TNF-α. In addition, more inhibitory receptors such as PD-1, LAG-3, and TIM-3 were expressed on the surface of TIGIT+CD8+T cells. TGF-β1 could promote the expression of TIGIT and inhibit CD8+T cell function in vitro. Moreover, the accumulation of TIGIT+T cells in tumors was associated with advanced disease, predicted early recurrence, and reduced survival rates in colorectal cancer patients. Our results indicate that TIGIT can be a biological marker for the prognosis of colorectal cancer, and TIGIT can be used as a potential target for treatment.

Purpose: Fumarate hydratase–deficient renal cell carcinoma (FH-deficient RCC) is a rare but lethal subtype of RCC. Little is known about the genomic profile of FH-deficient RCC, and the therapeutic options for advanced disease are limited. To this end, we performed a comprehensive genomics study to characterize the genomic and epigenomic features of FH-deficient RCC. Experimental Design: Integrated genomic, epigenomic, and molecular analyses were performed on 25 untreated primary FH-deficient RCCs. Complete clinicopathologic and follow-up data of these patients were recorded. Results: We identified that FH-deficient RCC manifested low somatic mutation burden (median 0.58 mutations per megabase), but with frequent somatic copy-number alterations. The majority of FH-deficient RCCs were characterized by a CpG sites island methylator phenotype, displaying concerted hypermethylation at numerous CpG sites in genes of transcription factors, tumor suppressors, and tumor hallmark pathways. However, a few cases (20%) with low metastatic potential showed relatively low DNA methylation levels, indicating the heterogeneity of methylation pattern in FH-deficient RCC. Moreover, FH-deficient RCC is potentially highly immunogenic, characterized by increased tumor T-cell infiltration but high expression of immune checkpoint molecules in tumors. Clinical data further demonstrated that patients receiving immune checkpoint blockade–based treatment achieved improved progression-free survival over those treated with antiangiogenic monotherapy (median, 13.3 vs. 5.1 months; P = 0.03). Conclusions: These results reveal the genomic features and provide new insight into potential therapeutic strategies for FH-deficient RCC.

The rapid development and remarkable success of checkpoint inhibitors have provided significant breakthroughs in cancer treatment, including hepatocellular carcinoma (HCC). However, only 15-20% of HCC patients can benefit from checkpoint inhibitors. Cancer stem cells (CSCs) are responsible for recurrence, metastasis, and local and systemic therapy resistance in HCC. Accumulating evidence has suggested that HCC CSCs can create an immunosuppressive microenvironment through certain intrinsic and extrinsic mechanisms, resulting in immune evasion. Intrinsic evasion mechanisms mainly include activation of immune-related CSC signaling pathways, low-level expression of antigen presenting molecules, and high-level expression of immunosuppressive molecules. External evasion mechanisms are mainly related to HBV/HCV infection, alcoholic/nonalcoholic steatohepatitis, hypoxia stimulation, abnormal angiogenesis, and crosstalk between CSCs and immune cells. A better understanding of the complex mechanisms of CSCs involved in immune evasion will contribute to therapies for HCC. Here we will outline the detailed mechanisms of immune evasion for CSCs, and provide an overview of the current immunotherapies targeting CSCs in HCC.

Two branching strategies are exhibited in crops: enhanced apical dominance, as in maize; or weak apical dominance, as in rice. However, the underlying mechanism of weak apical dominance remains elusive. OsWUS, an ortholog of Arabidopsis WUSCHEL (WUS) in rice, is required for tiller development. In this study, we identified and functionally characterized a low-tillering mutant decreased culm number 1 (dc1) that resulted from loss-of-function of OsWUS. The dc1 tiller buds are viable but repressed by the main culm apex, leading to stronger apical dominance than that of the wild-type (WT). Auxin response is enhanced in the dc1 mutant, and knocking out the auxin action-associated gene ABERRANT SPIKELET AND PANICLE 1 (ASP1) de-repressed growth of the tiller buds in the dc1 mutant, suggesting that OsWUS and ASP1 are both involved in outgrowth of the rice tiller bud. Decapitation triggers higher contents of cytokinins in the shoot base of the dc1 mutant compared with those in the WT, and exogenous application of cytokinin is not sufficient for sustained growth of the dc1 tiller bud. Transcriptome analysis indicated that expression levels of transcription factors putatively bound by ORYZA SATIVA HOMEOBOX 1 (OSH1) are changed in response to decapitation and display a greater fold change in the dc1 mutant than that in the WT. Collectively, these findings reveal an important role of OsWUS in tiller bud growth by influencing apical dominance, and provide the basis for an improved understanding of tiller bud development in rice.

Purpose: To characterize the role of fibrous sheath interacting protein 2 (FSIP2) in the survival outcomes and prognosis of clear cell renal cell carcinoma (ccRCC) patients, which is currently not well understood. Methods: The Oncomine and CCLE databases were used to investigate the differential expression of FSIP2 in ccRCC versus other cancer types. Levels of FSIP2 in 85 ccRCC patients were assessed by immunohistochemical analysis; clinicopathological features related to FSIP2 expression were examined in these patients finally, disease-free survival and overall survival were estimated by survival analysis to elucidate the impact of FSIP2 expression in ccRCC patients. Results: Analysis using the Oncomine database revealed significant upregulation of the FSIP2 gene in papillary RCC, compared to that in normal tissues. Additionally, FSIP2 expression was found to be significantly associated with abnormal platelet count, positive distant metastasis, and death as the incidence of distant metastasis and death were higher in patients with FSIP2 expression compared to those without FSIP2 expression. Survival analysis revealed that FSIP2 expression was significantly related to shorter disease-free survival and overall survival. Meanwhile, patients with FSIP2 expression had worse prognosis than those without FSIP2 expression. Conclusions: FSIP2 expression is associated with poor survival outcomes and poor prognosis in ccRCC patients. FSIP2 may therefore serve as a potential predictive biomarker of ccRCC prognosis.

Chitinases (Chi), an important resistance-related protein, act against fungal pathogens by catalyzing the fungal cell wall, whereas are involved in different biological pathways in grape. In this study, we found 42 Chi family genes in Vitis vinifera L. (VvChis) and evaluated their expression levels after Botrytis infection, stress hormones like ethylene (ETH) and methyl-jasmonate (MeJA), and abiotic stresses like salinity and temperature changes in ripened fruits. VvChis were categorized into five groups including A, B, C, D, and E belonged to glycoside hydrolase family 18 and 19 (GH18 and GH19) according to genes structure, which expression analysis showed distinct temporal and spatial expression patterns changed in different tissues and various development stages. Different responsive elements to biotic and abiotic stresses were determined in the promoter regions of VvChis, specially elicitor-responsive element that was conserved among all VvChis genes. The expression levels of VvChis in groups A, B, and E increased after Botrytis cinerea infection in leaves and berries. Meanwhile, VvChis in glycoside hydrolase family 18 (GH18) were up-regulated under MeJA and ETH treatment, although the induction of VvChis by low temperature was more significant than high temperature. The expression of VvChis was also positively correlated with the concentration of NaCl treatment. Furthermore, differential gene-overexpression of VvChi5, VvChi17, VvChi22, VvChi26, and VvChi31 in strawberry and tomato fruits demonstrated the involvement of various isoforms in resistance to Botrytis infection through antioxidant system and lignin accumulation, which led to a reduction of damage. Among different isoforms of VvChis, we confirmed the interaction of Chi17 with Metallothionein (MTL) as oxidative stress protection, which suggests VvChis can modulate oxidative stress during postharvest storage in ripened fruits.

Background The role of lipid metabolic status in tyrosine kinase inhibitors-treated patients with metastatic renal cell carcinoma is insufficient. Objective To analyse the influence of dynamic changes of lipid metabolism on survival outcomes in tyrosine kinase inhibitors-treated metastatic renal cell carcinoma. Patients and methods Serum levels of triglycerides, total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol and non-high-density lipoprotein cholesterol were collected, both before tyrosine kinase inhibitors therapy and at different time points of tyrosine kinase inhibitors treatment duration. Other clinicopathological and survival data were retrospectively reviewed. The clinical outcomes, including tumour response, progression-free survival and overall survival, were analysed. Kaplan–Meier survival curves were plotted and the log-rank test was used to analyse statistical significance. Results A total of 127 patients with metastatic renal cell carcinoma, initially treated with tyrosine kinase inhibitors as first-line systemic therapy, were included. In the whole cohort, the serum levels of triglycerides, total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol and non-high-density lipoprotein cholesterol fluctuated but gradually increased during tyrosine kinase inhibitors treatment. In survival analysis, the higher serum level of lipid metabolism, the longer progression-free survival was observed. In terms of overall survival, all post-treatment lipid metabolism, including the percentages of increasing change, were correlated with better survival. Further multivariate analysis showed that patients with five components of treatment-related dysfunction of lipid metabolism had superior survival to those with less than five components. However, lipid metabolism was not correlated with tumour response. Conclusion Increasing parameters of lipid metabolism indicated improvement of survival in tyrosine kinase inhibitors-treated metastatic renal cell carcinoma, especially the increasing percentages.

Lipase member H (LIPH), a novel member of the triglyceride lipase family. The clinical implications of its expression in breast cancer are still unclear. Therefore, in this study, we investigated the associations between LIPH and the tumorigenic behaviours of 144 triple‐negative breast cancer (TNBC) patients. The ratio and mammosphere‐forming ability of CD44+/CD24− stem‐like cells were tested. The role of LIPH in breast cancer cell migration and invasion was also evaluated. In addition, the effect of LIPH silencing on mitochondrial respiration was determined using the Seahorse assay. Finally, the effect of LIPH silencing on protein expression was determined via tandem mass tag‐based spectrometry and Western blotting. We found that LIPH expression was associated with metastasis in lymph nodes and distant organs (P = 0.025), resulting in poor survival among breast cancer patients (P = 0.027). LIPH knockdown significantly decreased both the ratio of CD44+/CD24− stem‐like cells and their mammosphere‐forming ability. LIPH silencing promoted apoptosis, arrested cell cycle in the G2/M phase, mitigated the oxidation‐related oxygen consumption rate in the mitochondria, and reduced metabolism. LIPH inhibited adhesion between tumour cells and enhanced the epithelial‐mesenchymal transition. Tandem mass spectrometric analysis presented 68 proteins were differentially expressed in LIPH‐silenced cells and LIPH‐mediated modulation of tumour cell adhesion depended on integrin‐related CAPN2 and paxillin signalling. Overall, our findings provided strong evidence that LIPH up‐regulation promoted metastasis and the stemness of TNBC cells. Therefore, targeting LIPH is a potentially viable strategy for preventing metastasis in TNBC.

Grape (Vitis vinifera L.), a commercial fruit crop, is profoundly sensitive to gibberellic acid (GA), however exogenous application can significantly induce seedless grape berries. Nevertheless, the underlying molecular mechanism of grape leafy cotyledon 1 (LEC1) on seedless induction remains intangible. Herein, the morphological changes of ‘Wink’ grape cultivar during berry development in response to GA treatments were recorded. To better comprehend the function of VvLEC1 in grape seedless berry induced by GA, the gene and protein sequence were determined by bioinformatics methods, of which motif elements analysis intimates the potential function in seed development. The expression level of VvLEC1 which was repressed by GA treatment, determined by RT PCR, exhibited highest up-regulation at four weeks after flowering in the seed. Furthermore, VvLEC1, a member of the nuclear factor Y subunit B (NF-YB-type) transcription factor, interacts with five proteins which belong to the NF-YC-type transcription factor by the prediction of protein interaction network, thus indicating their collective effects on the development of grape seed. Our research findings elucidate a novel molecular insight into the role of VvLEC1 responsive to GA in accentuating grapevine seed development, which is crucial for the molecular breeding of high-quality seedless grapes.

Background and purpose The B-type natriuretic peptide (BNP1-32) exerts vasorelaxing and cardioprotective activity. BNP is used as a biomarker for the diagnosis of cardiopathological conditions and recombinant BNP1-32 as a drug for the treatment of such. BNP1-32 has a short half-life and thus, similar to other vasoactive peptides like angiotensin II and bradykinin, can be enzymatically truncated forming bioactive metabolites. We aimed to investigate the metabolism of BNP1-32 in the mouse lung, to identify potential new BNP metabolites and to disclose their biological activity compared to the BNP1-32, in vitro and in vivo. Experimental approach Using HPLC and MS, we identified a new BNP metabolite, BNP1-30, in the lung being generated by endothelin-converting enzyme-1. Key results BNP1-30 is more efficient in stimulating the guanylyl cyclase (GC) receptor A and, in contrast to BNP1-32, is also able to profoundly stimulate the GC-B. In vivo, BNP1-30 reduced the mean arterial BP of normotensive mice after acute infusion significantly more than BNP1-32. In a model of severe hypertension, a 3-day infusion of BNP1-30 was able to reduce systolic BP by 30 mmHg and to improve markers of heart failure, while BNP1-32 was without significant effect. Conclusions and implications Our results suggest that BNP1-32 is the precursor for the biologically more active BNP1-30 leading to a fundamental extension of the natriuretic peptide system. Due to expanded activity, BNP1-30 might be a promising treatment option for cardiovascular diseases. Furthermore, its potency as a new diagnostic marker of specific cardiac diseases should be evaluated.

Purpose To assess the association between body fat components and survival status and tumor response for metastatic renal cell carcinoma (mRCC) patients treated with tyrosine kinase inhibitors (TKIs). Patients and Methods Patients with pathologically diagnosed and radiologically indicated mRCC were enrolled into the retrospective study. Three body fat components: total fat accumulation (TFA), visceral fat accumulation (VFA) and subcutaneous fat accumulation (SFA) were measured using standard CT scans. The clinical outcomes included progression-free survival (PFS), overall survival (OS), and tumor response rates. Univariate analysis and multivariate Cox proportion hazard regression models were used to find associated parameters and to calculate the adjusted hazard ratio (HR). Results A total of 146 patients were enrolled and the average age of patients was 56.5 years old. According to the univariate analysis, patients with an increased SFA and TFA had a longer PFS and OS. A similar phenomenon was observed among patients with ≥2 increasing body fat components about PFS and OS. As for multivariate analysis, SFA change (p=0.014) or the number of increasing body fat components (p=0.040) were independent indicators to predict PFS. In addition, SFA change (p=0.022) or the number of increasing body fat components (p=0.008) could independently predict OS. Moreover, a better disease control rate (p=0.028) was founded in patients with ≥2 increasing components. In the subgroup of patients with ≥2 metastasis sites, improved OS (p=0.017) and PFS (p=0.027) were found compared to those with

Background The optimal treatment for patients with high-risk prostate cancer (PCa) remains a debate and selection of patients to receive proper therapy is still an unsettled question. This systematic review was conducted to compare the effectiveness of prostatectomy (RP) and radiotherapy (RT) in patients with high-risk PCa and to select candidates for optimal treatment. Methods PubMed, EMBASE, and Cochrane Central Register of Controlled Trials were searched for eligible studies. We extracted hazard ratios (HRs) and 95% confidence interval (CI) of all included studies. The primary outcomes were overall survival (OS) and cancer-specific survival (CSS); the secondary outcomes were biochemical recurrence-free survival (BRFS), metastasis-free survival (MFS) and clinical recurrence-free survival (CRFS). The meta-analysis was performed using Review Manager 5.3. Subgroup analyses were conducted according to Gleason score (GS), T stage and RT types. Quality of life (QoL) was compared with these two treatments. Results A total of 25 studies were included in this meta-analysis. Overall, RP showed more survival benefits than RT on CSS (P = 0.003) and OS (P = 0.002); while RT was associated with better BRFS (P = 0.002) and MFS (P = 0.004). Subgroup analyses showed RT was associated with similar or even better survival outcomes compared to RP in patients with high GS, high T stage or received external beam radiotherapy plus brachytherapy (EBRT + BT). As for QoL, RP was associated with poorer urinary and sexual function but better performance in the bowel domain. Conclusion RP could prolong the survival time of patients with high-risk PCa; however, RT could delay the disease progression, and combined RT (EBRT + BT) even brought preferable CSS and similar OS compared to RP. RT might be the prior choice for patients with high T stage or high GS. RP could lead to poorer urinary and sexual function, while bringing better performance in the bowel domain.

The role of HCK expression in the prognosis of breast cancer patients is unclear. Thus, this study aimed to explore the clinical implications of HCK expression in breast cancer. We assessed HCK expression and genetic variations in breast cancer using Oncomine, GEPIA, UALCAN, and cBioPortal databases. Then, immunochemistry was used to analyze HCK expression in breast cancer specimens, non-cancer tissues and metastatic cancer tissues. Consequently, we evaluated the effect of HCK expression on survival outcomes set as disease-free survival (DFS) and overall survival (OS). Finally, STRING, Coexpedia, and TISIDB database were explored to identify the molecular functions and regulation pathways of HCK. We found that breast cancer tissues have more HCK mRNA transcripts than non-cancer tissues. Patients with HCK expression had significantly shorter DFS and OS. The ratio of HCK expression was higher in cancer tissues than in non-cancer tissues. These results from STRING database, FunRich software, and TISIDB database showed that HCK was involved in mediating multiple biological processes including immune response-regulating signaling pathway, cell growth and maintenance through multiple signaling pathways including epithelial to mesenchymal transition, PI3K/AKT signaling pathway, and focal adhesion. Overall, HCK may be an oncogene in the development of breast cancer and thus may as a novel biomarker and therapeutic target for breast cancer.

HOXA10 is an important regulator of embryo adhesion. Reduced expression may contribute to embryo implantation failure. The expression of Nur77 and HOXA10 has been shown to be reduced in the endometrium of patients with recurrent implantation failure. In this study, we found that Nur77 was directly bound to the HOXA10 promoter and promoted HOXA10 protein expression in a dose-dependent manner in Ishikawa cells. Furthermore, the promoting effect of Nur77 on embryo adhesion was significantly blocked when endogenous HOXA10 expression was knocked down in Ishikawa cells. Moreover, the Nur77 agonist 6-MP was also confirmed to promote embryo adhesion. This study is the first to show that Nur77 promotes embryo adhesion by transcriptionally regulating HOXA10 expression. Nur77 and 6-MP may provide a basis to develop a new treatment for patients who suffer from embryo adhesion dysfunction.Abbreviations: HB-EGF: heparin-binding epidermal growth factor-like growth factor; HOXA10: homeobox A10; NGFI-B: nerve growth factor-induced gene B; RIF: recurrent implantation failure; RPL: recurrent pregnancy loss; 6-MP: 6-mercaptopurine; IGFBP-1: insulin-like growth factor binding protein-1; LIF: leukemia inhibitory factor; IL-1β: Interleukin - 1β; CRISPR/Cas9: Clustered Regularly Interspaced Short Palindromic Repeats; AF-1: activation function-1 domain; HIF-1α: hypoxia-inducible factor 1α; CREB: cAMP response element binding.

Remarkable progress in ageing research has been achieved over the past decades. General perceptions and experimental evidence pinpoint that the decline of physical function often initiates by cell senescence and organ ageing. Epigenetic dynamics and immunometabolic reprogramming link to the alterations of cellular response to intrinsic and extrinsic stimuli, representing current hotspots as they not only (re-)shape the individual cell identity, but also involve in cell fate decision. This review focuses on the present findings and emerging concepts in epigenetic, inflammatory, and metabolic regulations and the consequences of the ageing process. Potential therapeutic interventions targeting cell senescence and regulatory mechanisms, using state-of-the-art techniques are also discussed.

Cryptococcus neoformans and Cryptococcus deneoformans are opportunistic fungal pathogens found worldwide that are utilized to reveal mechanisms of fungal pathogenesis. However, their low homologous recombination frequency has greatly encumbered genetic studies. In preliminary work, we described a ‘suicide’ CRISPR-Cas9 system for use in the efficient gene editing of C. deneoformans, but this has not yet been used in the C. neoformans strain. The procedures involved in constructing vectors are time-consuming, whether they involve restriction enzyme-based cloning of donor DNA or the introduction of a target sequence into the gRNA expression cassette via overlap PCR, as are sophisticated, thus impeding their widespread application. Here, we report the optimized and simplified construction method for all-in-one CRISPR-Cas9 vectors that can be used in C. neoformans and C. deneoformans strains respectively, named pNK003 (Genbank: MW938321) and pRH003 (Genbank: KX977486). Taking several gene manipulations as examples, we also demonstrate the accuracy and efficiency of the new simplified all-in-one CRISPR-Cas9 genome editing tools in both Serotype A and Serotype D strains, as well as their ability to eliminate Cas9 and gDNA cassettes after gene editing. We anticipate that the availability of new vectors that can simplify and streamline the technical steps for all-in-one CRISPR-Cas9 construction could accelerate genetic studies of the Cryptococcus species.

Rationale: PGC1α (peroxisome proliferator-activated receptor gamma coactivator 1α) represents an attractive target interfering bioenergetics and mitochondrial homeostasis, yet multiple attempts have failed to upregulate PGC1α expression as a therapy, for instance, causing cardiomyopathy. Objective: To determine whether a fine-tuning of PGC1α expression is essential for cardiac homeostasis in a context-dependent manner. Methods and Results: Moderate cardiac-specific PGC1α overexpression through a ROSA26 locus knock-in strategy was utilized in WT (wild type) mice and in G3Terc −/− (third generation of telomerase deficient; hereafter as G3) mouse model, respectively. Ultrastructure, mitochondrial stress, echocardiographic, and a variety of biological approaches were applied to assess mitochondrial physiology and cardiac function. While WT mice showed a relatively consistent PGC1α expression from 3 to 12 months old, age-matched G3 mice exhibited declined PGC1α expression and compromised mitochondrial function. Cardiac-specific overexpression of PGC1α (PGC1α OE ) promoted mitochondrial and cardiac function in 3-month-old WT mice but accelerated cardiac aging and significantly shortened life span in 12-month-old WT mice because of increased mitochondrial damage and reactive oxygen species insult. In contrast, cardiac-specific PGC1α knock in in G3 (G3 PGC1α OE ) mice restored mitochondrial homeostasis and attenuated senescence-associated secretory phenotypes, thereby preserving cardiac performance with age and extending health span. Mechanistically, age-dependent defect in mitophagy is associated with accumulation of damaged mitochondria that leads to cardiac impairment and premature death in 12-month-old WT PGC1α OE mice. In the context of telomere dysfunction, PGC1α induction replenished energy supply through restoring the compromised mitochondrial biogenesis and thus is beneficial to old G3 heart. Conclusions: Fine-tuning the expression of PGC1α is crucial for the cardiac homeostasis because the balance between mitochondrial biogenesis and clearance is vital for regulating mitochondrial function and homeostasis. These results reinforce the importance of carefully evaluating the PGC1α-boosting strategies in a context-dependent manner to facilitate clinical translation of novel cardioprotective therapies.

The survival of patients diagnosed with metastatic renal cell carcinoma (RCC) is still limited and the current targeted therapies are only partially effective. Herein, we investigated the clinical value and functions of adiponectin receptors (AdipoR1 and AdipoR2) in metastatic renal cell carcinoma (RCC) patients treated with tyrosine kinase inhibitors (TKIs). A total of 127 mRCC patients treated with first-line TKIs between 2008 and 2017 at a single institution were collected. AdipoR1 and AdipoR2 expression was assessed by immunohistochemistry. AdipoR1 was positively expressed in 87.4% (111/127) of tumors, especially, highly expressed in pulmonary and bone lesions. Patients with low-AdipoR1 expression in primary tumor tissues were more likely to suffer from progressive disease during TKIs treatment (40.0% vs. 11.1%, P = 0 .02), and with decreased progression-free survival (PFS: 19.5 vs. 37.8 mo, P = .001) and overall survival (OS: 62.3 vs 101.1 mo, P = .004) compared to those with high-AdipoR1 expression. Moreover, low-AdipoR1 expression in metastatic tissues was also associated with poor PFS (P = .006) and OS (P = .037). In contrast, AdipoR2 expression was neither associated with sunitinib response nor patient survival. In vitro, we found that adiponectin inhibited migration, invasion and sensitized RCC cells to sunitinib though interacting with AdipoR1, but not AdipoR2. Furthermore, we demonstrated that adiponentin-AdipoR1 axis inhibits tumor cells migration and invasion by blocking the GSK3β/β-Catenin pathway and enhances sunitinib sensitivity via abrogating PI3K/AKT/NF-κB signaling. Our results suggest that adiponentin-AdipoR1 axis may serve as a predictor of TKIs response and could be a potential therapeutic target in the future treatment for metastatic RCC.

BACKGROUND The prognostic value of ductal adenocarcinoma of the prostate (DA) in nonmetastatic prostate cancer (PCa) has been identified in many studies. However, it remains unknown whether DA is an adverse prognostic factor in metastatic PCa (mPCa). METHOD Data from 634 mPCa patients histopathologically documented with DA or/and acinar adenocarcinoma of the prostate in our center between 2012 and 2018 were retrospectively analyzed. Propensity score matching (PSM) was used to balance the baseline features. Data from the Surveillance, Epidemiology, and End Results (SEER) database were utilized to validate our findings. Castration-resistant PCa-free survival (CFS), overall survival (OS), and cancer-specific survival (CSS) were set as endpoints. RESULTS DA was confirmed in 35 of 634 (5.5%) patients. Among the DA-positive patients, 7 of 35 (20%) and 28 of 35 (80%) harbored high (DA ≥ 50%) and low (DA

The xylem sap of fruit trees ensures the survival during the dormant period, and its flow during the bleeding period is correlated with the start of a new life cycle. Though the simple exploration on ingredients in the sap was carried out in the early years, the specific life activities and physiology functions of the sap during bleeding period have not been reported yet and the bleeding period is still a fruit tree development period worthy of attention. In this study, the microbial community composition during bleeding period were revealed by metatranscriptome and transcriptomic data. For the first time, the microorganism genome and grape genome in xylem sap were analyzed on transcriptional level, based on which the main physiological functions of the sap were also determined. The genomic RNA in the sap was isolated and sequenced. Kyoto Encyclopedia of Gene and Genome (KEGG), Evolutionary genealogy of genes: Non-supervised Orthologous Groups (eggNOG) and Carbohydrate-Active enzymes Database (CAZy) functional annotation were used to analysis the function of micro-organisms in xylem sap. DEGs were analyzed by gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). The genes responsive to biotic and abiotic stresses were finally screened by transcriptome screening, stress data analysis and vitro validation experiments. The analysis exhibited 36,144,564 micro-related clean reads and 244,213 unigene. KEGG, eggNOG and CAZy functional annotation analysis indicated that signal transduction and material metabolism were the most important function of xylem sap. DEGs analysis were mainly about disease resistance, carbon source metabolism and hormone signal transduction, especially in P3 vs P1, enriched in the plant-pathogen interaction pathway. Analysis on grape genome information revealed xylem sap had little RNA with weak life activity. Metabolic pathways, biosynthesis of secondary metabolites, plant hormone signal transduction and plant-pathogen interaction were the four pathways with the largest number of enriched genes. Moreover, 16 genes responsive to biotic and abiotic stresses were screened out. Promoting plant growth and resisting pathogens were the most important function of xylem sap during the bleeding period, and the function of microbial community were closely related to microorganisms growth and disease resistance. The 16 stress-related genes might be used for the future grape resistance research.

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5' end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.

This study aimed to compare breast symmetry and patient satisfaction with breast appearance between implant-based breast reconstruction using TiLoop Bra mesh combined with pectoralis major disconnection (IMR) and conventional implant reconstruction (IR), and to analyze differences in complications.This retrospective study included 59 patients administered IMR or IR in 2016 to 2018. Three-dimensional scanning was performed to objectively evaluate breast symmetry. The BREAST-Q scale was used to survey satisfaction with breast appearance, social psychosocial health, physical health, and sexual well-being.There were no significant differences in age, TNM stage, and chemotherapy between the 2 groups (all P0.05). In 3-dimensional scanning data, patients who underwent IMR had better bilateral breast symmetry compared with those administered IR (all P0.001). Based on the BREAST-Q survey, the satisfaction rate was significantly higher for IMR compared with IR (P = 0.0368), whereas psychosocial health, physical health, and sexual well-being showed no significant differences between the 2 groups (all P0.05). The IMR model showed no obvious advantages in common complications, including hematoma, incision site infection, skin flap necrosis, and prosthesis exposure and rupture compared with IR; loss of skin and nipple sensations was evident in both groups. The IMR model was associated with reduced incidence of fibrous capsule contracture compared with IR (0% vs 18.75%, P = 0.0267). The incidence rates of pectoralis major disconnection syndrome after IMR and IR were 18.50% and 0%, respectively (P = 0.0161).Patients administered IMR have better breast symmetry and greater satisfaction with breast appearance compared with those treated by IR; however, IMR has unique complications, including pectoralis major disconnection syndrome.

Intraductal carcinoma of the prostate is an adverse prognosticator of prostate cancer. However, the roles of proportion and architectural patterns of intraductal prostate carcinoma in patient outcomes remain unclear.We retrospectively analyzed data on 644 patients with de novo metastatic prostate cancer between 2010 and 2017. Intraductal carcinoma of the prostate was identified from 12-core prostate biopsy. We calculated the proportion of intraductal prostate carcinoma and identified patterns according to the 2016 WHO classification. Propensity score matching was performed to balance baseline characteristics between patients with and without intraductal prostate carcinoma. Kaplan-Meier curves and Cox regression were used for survival analyses. The end points were castration resistant prostate cancer-free survival and overall survival.Of the 644 patients 180 (28.0%) harbored intraductal carcinoma of the prostate. A 10% or greater incidence of the carcinoma was independently associated with worse prognosis (castration resistant prostate cancer-free survival HR 2.06, 95% CI 1.51-2.81, p0.001, and overall survival HR 2.52, 95% CI 1.52-4.16, p0.001), as was pattern 2 intraductal carcinoma of the prostate (HR 1.86, 95% CI 1.40-2.49, p0.001, and HR 2.12, 95% CI 1.29-3.46, p = 0.003, respectively). Based on these 2 risk factors all men were classified into 5 groups. Patients in group 0 (no intraductal carcinoma of the prostate) and prostate intraductal carcinoma group 1 (less than 10% intraductal carcinoma, pattern 1) had favorable median castration resistant prostate cancer-free survival (18.0 vs 16.9 months, p = 0.871) and median overall survival (neither reached, p = 0.698). Men in intraductal carcinoma of the prostate group 4 (10% or greater intraductal carcinoma, pattern 2) harbored the worst outcomes (median castration resistant prostate cancer-free and overall survival 8.4 and 29.9 months, respectively). Group 2 (less than 10% intraductal carcinoma, pattern 2, with median castration resistant prostate cancer-free and overall survival 14.2 and 45.9 months) and group 3 (10% or less prostate intraductal carcinoma, pattern 1, with median castration resistant prostate cancer-free and overall survival 11.9 and 39.7 months, respectively) had an intermediate prognosis.A 10% or greater proportion of intraductal carcinoma of the prostate and pattern 2 were 2 unfavorable prognosticators of metastatic prostate cancer. Pathological reporting criteria based on intraductal carcinoma of the prostate could improve the prediction of patient outcomes and optimize treatment decisions.

Macrophage-orchestrated, low-grade chronic inflammation plays a pivotal role in obesity and atherogenesis. However, the underlying regulatory mechanisms remain incompletely understood. Here, we identify major vault protein (MVP), the main component of unique cellular ribonucleoprotein particles, as a suppressor for NF-κB signaling in macrophages. Both global and myeloid-specific MVP gene knockout aggravates high-fat diet induced obesity, insulin resistance, hepatic steatosis and atherosclerosis in mice. The exacerbated metabolic disorders caused by MVP deficiency are accompanied with increased macrophage infiltration and heightened inflammatory responses in the microenvironments. In vitro studies reveal that MVP interacts with TRAF6 preventing its recruitment to IRAK1 and subsequent oligomerization and ubiquitination. Overexpression of MVP and its α-helical domain inhibits the activity of TRAF6 and suppresses macrophage inflammation. Our results demonstrate that macrophage MVP constitutes a key constraint of NF-κB signaling thereby suppressing metabolic diseases., Metabolic diseases are associated with chronic, low-grade inflammation. Here the authors show that major vault protein (MVP) suppresses NF-κB signalling in macrophages via an IRAK1–TRAF6 axis and that loss of MVP in myeloid cells exacerbates the inflammatory response in mice fed a high fat diet.

Background In clinical practice, the detection of biomarkers is mostly based on primary tumors for its convenience in acquisition. However, immune checkpoints may express differently between primary and metastatic tumor. Therefore, we aimed to compare the differential expressions of PD-1, PD-L1 and PD-L2 between the primary and metastatic sites of renal cell carcinoma (RCC). Methods Patients diagnosed with RCC by resection or fine needle aspiration of metastasis were included. Immunohistochemistry (IHC) was applied to detect PD-1, PD-L1 and PD-L2 expressions. SPSS 22.0 was applied to conduct Chi-square, consistency tests and Cox’s proportional hazards regression models. GraphPad Prism 6 was used to plot survival curves and R software was used to calculate Predictive accuracy (PA). Results In the whole cohort (N = 163), IHC results suggested a higher detection rate of PD-L1 in the metastasis than that of the primary site (χ2 = 4.66, p = 0.03), with a low consistent rate of 32.5%. Among different metastatic tumors, PD-1 was highly expressed in the lung/lymph node (65.3%) and poorly expressed in the brain (10.5%) and visceral metastases (12.5%). PD-L1 was highly expressed in lung/lymph node (37.5%) and the bone metastases (12.2%) on the contrary. In terms of survival analysis, patients with PD-1 expression either in the primary or metastasis had a shorter overall survival (OS) (HR: 1.59, 95% CI 1.08–2.36, p = 0.02). Also, PD-L1 expression in the primary was associated with a shorter OS (HR 2.55, 95% CI 1.06–6.15, p = 0.04). In the multivariate analysis, the predictive accuracy of the whole model for PFS was increased from 0.683 to 0.699 after adding PD-1. Conclusion PD-1, PD-L1 and PD-L2 were differentially expressed between primary and metastatic tumors. Histopathological examination of these immune check points in metastatic lesions of mRCC should be noticed, and its accurate diagnosis may be one of the effective ways to realize the individualized treatment. Electronic supplementary material The online version of this article (10.1186/s12885-019-5578-4) contains supplementary material, which is available to authorized users.

Unilateral breast reconstruction is different from bilateral breast reconstruction and breast augmentation, as it requires more consideration of the symmetry between the reconstructed breast and the contralateral breast. However, there are currently no implants specifically targeted to unilateral breast reconstruction, nor is there is objective classification criteria for breast appearance type. A total of 212 breasts from 153 patients were measured. Breast measurements, breast surface curvature distributions, and elliptic Fourier coefficients were used to describe breast features. We objectively classified the appearance of breasts using machine learning and used the resulting cluster centers to construct the most adaptive implants for each type of breast. All of the breasts clustered into 4 types. The implants corresponding to each type of breast were constructed using cluster centers. The resulting cluster centers were then used to choose a suitable implant for patients requiring unilateral breast reconstruction. Contour coefficients were used to evaluate the clustering results, with an average score of 0.53. The two breasts that develop normally in the same person were treated as the same class. The score obtained after statistical classification was 0.47. These results demonstrate that our proposed method can improve the classification of breasts of different shapes. This method provides a foundation for improving the symmetry of unilateral breast reconstruction and the construction and selection of implants.

The sequence and structure of grape SBP-box-like18 (VvSPL18) were identified and characterized to explore its regulatory roles during grape berry development and ripening. Homologous conservation across diverse plant species was observed, and its potential function and modulated roles in grapes were investigated. The results showed that VvSPL18 has an ORF sequence of 1,137 bp, encodes 378 amino acids, and is located on chromosome 14 of grapevine. VvSPL18 has the closest relationship with its homolog in soybeans. The promoter of VvSPL18 contains cis-elements responsive to gibberellins (GA) and salicylic acid (SA), indicating that this gene might respond to these hormones involved in the modulation of grape berry. VvSPL18 is mainly distributed in the nucleus. Expression profiles showed that VvSPL18 is highly expressed only at the veraison stage of the grape berry and is slightly expressed in other phases. RNA-seq data also revealed that VvSPL18 might participate in the modulation of grape berry development and ripening. Treatment with diverse hormones demonstrated that abscisic acid (ABA) had almost no effect on its expression, whereas naphthalene acetic acid (NAA) significantly upregulated its expression at the veraison stage. We also found that VvSPL18 has a GA-responsive cis-element but no NAA-responsive cis-element. GA could promote the expression of VvSPL18 with a peak at an earlier stage than NAA, suggesting that VvSPL18 responds faster to GA than to NAA. This result indicates that VvSPL18 might modulate berry development at this phase through an ABA-independent pathway, and it might directly respond to GA, but indirectly to NAA. Our findings provide insights into the functions of VvSPL18 in mediating grape berry development and ripening.

Insulin is a key regulator of metabolism and inflammation in the body. However, the mechanism of the anti-inflammatory effect of insulin is not fully understood. In the present study, we investigated the role of the class A1 scavenger receptor (SR-A1), a prototypic member of the pattern recognition receptor family, in the insulin-mediated suppression of inflammatory responses in macrophages. Our murine in vivo studies show that insulin can attenuate lipopolysaccharide (LPS)-induced endotoxemia in a SR-A1-dependent manner, and this was consistent with our in vitro results which demonstrate that the SR-A1 is necessary for insulin to antagonize the LPS-induced inflammatory responses in macrophages. The effect of SR-A1 on the anti-inflammatory action of insulin might be associated with the activation of the extracellular signal-regulated kinases (ERK) signaling pathway in macrophages. Insulin could inhibit macrophage polarization to a pro-inflammatory phenotype via the SR-A1/ERK cascade. Collectively, our results suggest that SR-A1 may be a pivotal element for the anti-inflammation effect of insulin in macrophages.

Background The canonical heterotrimeric G protein-cAMP/PKA pathway regulates numerous cellular processes in filamentous fungi. Chaetomium globosum, a saprophytic fungus, is known for producing many secondary metabolites, including cytotoxic chaetoglobosin A (ChA), as well as abundant cellulase and xylanase. Results Here we report on the functional characterization of this signaling pathway in C. globosum. We blocked the pathway by knocking down the putative Gα-encoding gene gna1 (in the pG14 mutant). This led to impaired cellulase production and significantly decreased transcription of the major cellulase and xylanase genes. Almost all the glycohydrolase family genes involved in cellulose degradation were downregulated, including the major cellulase genes, cel7a, cel6a, egl1, and egl2. Importantly, the expression of transcription factors was also found to be regulated by gna1, especially Ace1, Clr1/2 and Hap2/3/5 complex. Additionally, carbon metabolic processes including the starch and sucrose metabolism pathway were substantially diminished, as evidenced by RNA-Seq profiling and quantitative reverse transcription (qRT)-PCR. Interestingly, these defects could be restored by simultaneous knockdown of the pkaR gene encoding the regulatory subunit of cAMP-dependent PKA (in the pGP6 mutant) or supplement of the cAMP analog, 8-Br-cAMP. Moreover, the Gα-cAMP/PKA pathway regulating cellulase production is modulated by environmental signals including carbon sources and light, in which VelB/VeA/LaeA complex and ENVOY probably work as downstream effectors. Conclusion These results revealed, for the first time, the positive role of the heterotrimeric Gα-cAMP/PKA pathway in the regulation of cellulase and xylanase utilization in C. globosum. Electronic supplementary material The online version of this article (10.1186/s12934-018-1008-6) contains supplementary material, which is available to authorized users.

The antidiabetic drug metformin exerts pleiotropic effects on multiple organs, including the cardiovascular system. Evidence has shown that metformin improves healthspan and lifespan in male mice, yet its lifespan lengthening effect in females remains elusive. We herein demonstrated that metformin fails to extend the lifespan in female mice. Compared to 2-month-old young controls, 20-month-old female mice showed a spectrum of degenerative cardiac phenotypes alongside significant alterations in the extracellular matrix composition. Despite lowered reactive oxygen species production, long-term metformin treatment did not improve cardiac function in the aged female mice. In contrast, RNA sequencing analyses demonstrated that metformin treatment elevated the extracellular matrix-related gene while lowering oxidative phosphorylation-related gene expression in the heart. In addition, metformin treatment induced metabolic reprogramming that suppressed mitochondrial respiration but activated glycolysis (i.e., Warburg effect) in cultured primary cardiomyocytes and macrophages, thereby sustaining an inflammatory status and lowering ATP production. These findings suggest the unexpected detrimental effects of metformin on the regulation of cardiac homeostasis and longevity in female mice, reinforcing the significance of comprehensive testing prior to the translation of metformin-based novel therapies.

Purpose: It remained unclear whether tyrosine kinase inhibitors (TKIs) related renal impairment had impact on the survival of patients with metastatic renal cell carcinoma (mRCC). Methods: Clinicopathological parameters of patients with mRCC treated with TKIs were retrospectively reviewed. Blood urea nitrogen (BUN), proteinuria and estimated glomerular filtration rate (eGFR) at baseline and during TKIs treatment were recorded. BUN > 7.1mol/L, eGFR 2 and/or proteinuria level > 0.3 g/L were defined as renal impairment. eGFR and proteinuria were furtherly classified into different levels. Treatment outcomes were defined as progression-free survival (PFS) and overall survival (OS). Results: At baseline, the presence of abnormal BUN, eGFR and proteinuria level were observed in 25 (22.7%), 27 (25.5%) and 30 (27.3%) patients, which increased to 46 (41.8%), 55 (50.0%) and 64 (58.2%) respectively after TKIs treatment. In the whole cohort (N = 110), survival analysis suggested that only post-treatment renal impairment was related to survival outcomes. Interestingly, sub-analysis showed that post-treatment eGFR level (p = 0.004), proteinuria (p = 0.014) and eGFR decrease >10% (p = 0.012) and elevated proteinuria compared with baseline (p = 0.006) were statistically correlated with OS among patients without RI at baseline (N = 51). On the contrary, deterioration of renal impairment after TKIs treatment in patients with renal impairment at baseline (N = 59) had no relationship with either PFS or OS. Furthermore, eGFR (p = 0.020) and eGFR decrease >10% (p = 0.016) within 1 year after TKIs therapy were potential biomarkers for OS. Conclusion: Dynamic changes of TKI-induced RI during TKIs treatment, especially eGFR and proteinuria level, could be considered as potential biomarkers predicting survival outcomes of mRCC patients.

PurposeWe aimed to compare the efficacy of radical prostatectomy (RP) + extended pelvic lymph node dissection (ePLND) and radiotherapy (RT) in localized prostate cancer (PCa) patients with a risk of lymph node invasion (LNI) over 5%.MethodsThe Surveillance, Epidemiology, and End Results (SEER) databases were used to identify patients with PCa from 2010 to 2014. Propensity score matching (PSM) was performed to balance baseline characteristics between patients in different treatment groups. Kaplan-Meier curves and Cox regression were used to assess the effects of treatments on cancer-specific survival (CSS) and overall survival (OS).ResultsOverall 20584 patients were included in this study, with 4,057 and 16,527 patients receiving RP + ePLND and RT, respectively. After PSM, patients with RP + ePLND had similar CSS (5-year CSS rate: 97.8% vs. 97.2%, P=0.310) but longer OS (5-year OS rate: 96.0% vs. 90.8%, PConclusionRP + ePLND and EBRT + BT were associated with better survival outcomes compared to EBRT alone in PCa patients with a probability of LNI over 5%. However, no survival difference was observed between RP + ePLND and EBRT + BT.

Epigenetic marks or post-translational modifications on histones have important regulatory roles in gene expression in eukaryotic organisms. The epigenetic regulation of gene expression in the pathogenic yeast Cryptococcus deneoformans remains largely undetermined. The YEATS domain proteins are readers of crotonylated lysine residues in histones. Here, we reported the identification of a single-copy gene putatively coding for a YEATS domain protein (Yst1) in C. deneoformans. To define its function, we created a mutant strain, yst1Δ, using CRISPR-Cas9 editing. yst1Δ exhibited defects in phenotype, for instance, it was hypersensitive to osmotic stress in the presence of 1.3 M NaCl or KCl. Furthermore, it was hypersensitive to 1% Congo red, suggesting defects in the cell wall. Interestingly, RNA-seq data revealed that Yst1p was critical for the expression of genes encoding the ribosomal proteins, that is, most were expressed with significantly lower levels of mRNA in yst1Δ than in the wild-type strain. The mutant strain was hypersensitive to low temperature and anti-ribosomal drugs, which we putatively attribute to the impairment in ribosomal function. In addition, the yst1Δ strain was less virulent to Galleria mellonella. These results generally suggest that Yst1, as a histone modification reader, might be a key coordinator of the transcriptome of this human pathogen. Yst1 could be a potential target for novel antifungal drugs, which might lead to significant developments in the clinical treatment of cryptococcosis.

A conserved open reading frame, dps, is described in Pestalotiopsis microspora, sharing a remarkable similarity with fungal diterpene synthases whose function is less studied. Loss-of-function approach manifested that dps was necessary for the growth and the development of the fungus. A deletion strain, dpsΔ, showed a fundamental retardation in growth, which could deliberately be restored by the addition of exogenous sterols to the media. Gas chromatography–mass spectrometry analysis confirmed the loss of the ability to produce certain sterols. Thus, the tolerance and the resistance of dpsΔ to several stress conditions were impaired. Secondary metabolites, such as the polyketide derivative dibenzodioxocinones, were significantly diminished. At the molecular level, the deletion of dps even affected the expression of genes in the mevalonate pathway. This report adds knowledge about fungal diterpene synthases in Pestalitiopsis microspora.

Early diagnosis and complete resection of the tumor is an important way to improve the quality of life of patients with gastric cancer. In recent years, near-infrared (NIR) materials show great potential in fluorescence-based imaging of the tumors. To realize a satisfying intraoperative fluorescence tumor imaging, there are two pre-requirements. One is to obtain a stable agent with a relatively longer circulation time. The second is to make it good biocompatible and specific targeting to the tumor. Here, we developed an RGD-modified Distearyl acylphosphatidyl ethanolamine-polyethylene glycol micelle (DSPE-PEG-RGD) to encapsulate indocyanine green (ICG) for targeting fluorescence imaging of gastric cancer, aimed at realizing tumor-targeted accumulation and NIR imaging. 1H NMR spectroscopy confirmed its molecular structure. The characteristics and stability results indicated that the DSPE-PEG-RGD@ICG had a relatively uniform size of

Rationale: Doxorubicin-induced cardiomyopathy (DiCM) is a primary cause of heart failure and mortality in cancer patients, in which macrophage-orchestrated inflammation serves as an essential pathological mechanism. However, the specific roles of tissue-resident and monocyte-derived macrophages in DiCM remain poorly understood. Objective: Uncovering the origins, phenotypes, and functions of proliferative cardiac resident macrophages and mechanistic insights into the self-maintenance of cardiac macrophage during DiCM progression. Methods and Results: Mice were administrated with doxorubicin to induce cardiomyopathy. Dynamic changes of resident and monocyte-derived macrophages were examined by lineage tracing, parabiosis, and bone marrow transplantation. We found that the monocyte-derived macrophages primarily exhibited a proinflammatory phenotype that dominated the whole DiCM pathological process and impaired cardiac function. In contrast, cardiac resident macrophages were vulnerable to doxorubicin insult. The survived resident macrophages exhibited enhanced proliferation and conferred a reparative role. Global or myeloid specifically ablation of SR-A1 (class A1 scavenger receptor) inhibited proliferation of cardiac resident reparative macrophages and, therefore, exacerbated cardiomyopathy in DiCM mice. Importantly, the detrimental effect of macrophage SR-A1 deficiency was confirmed by transplantation of bone marrow. At the mechanistic level, we show that c-Myc (Avian myelocytomatosis virus oncogene cellular homolog), a key transcriptional factor for the SR-A1-P38-SIRT1 (Sirtuin 1) pathway, mediated the effect of SR-A1 in reparative macrophage proliferation in DiCM. Conclusions: The SR-A1-c-Myc axis may represent a promising target to treat DiCM through augmentation of cardiac resident reparative macrophage proliferation.

Staphylococcal nuclease domain-containing 1 (SND1) expression is crucial for breast cancer metastasis; however, the clinical implications of SND1 expression in breast cancer remain unclear. This study investigated the relationship of SND1 protein expression both with metastasis and the prognoses of 144 breast cancer patients over a 10-year follow-up. Chi-square tests revealed that the percentages of positive SND1 expression in breast cancer tumors were significantly associated with larger tumor size (>2 cm, P = 0.043), higher clinical TNM stage (P = 0.003), and positive lymph node metastasis (P = 0.001). Breast cancer patients with positive SND1 expression had a significantly shorter overall survival and disease-free survival than those with negative SND1 expression (P < 0.01). Multiple Cox regression analysis indicated that SND1 expression is an independent risk factor for shorter disease-free survival (hazard ratio = 1.97, P = 0.014). The percentages of SND1 expression in metastatic breast cancers were significantly higher than that in primary tumors in 30 patients with advanced breast cancer (P = 0.016). Therefore, SND1 protein expression is significantly associated with breast cancer metastasis and may serve as a biomarker for prognosis of breast cancer patients.

Inflammatory bowel disease is characterized by chronic intestinal inflammatory disorders associated with increased risk of developing colorectal cancer. However, the detailed mechanisms are not fully understood. The aim of this study was to determine the effect of macrophage scavenger receptor class A1 (SR-A1), a pattern recognition receptor primarily expressed in macrophages, on colitis and clarify the underlying mechanisms. We found that SR-A1-/- mice had an aggravating dextran sodium sulfate-induced acute and recurring colitis. This action was associated with a robust activation of both canonical and noncanonical NF-κB signaling in the colon. Suppression of the noncanonical NF-κB signaling by SR-A1 may be via its interaction with TRAF3 in macrophages. Furthermore, the anti-inflammation effect of SR-A1 could inhibit occurrence of colitis-associated cancer in mice. These results, for the first time, demonstrate that SR-A1 as a suppressor for inflammatory bowel disease.

Inflammatory responses are pivotal incidences in hepatic metabolic derangements. However, the underlying mechanism remains elusive. The present study aimed to evaluate the role of peroxisome proliferator-activated receptor-gamma, coactivator 1 alpha (PGC1α) in IL10-mediated anti-inflammatory response, and its role in hepatic steatosis and insulin resistance. Hepatocyte-specific PGC1α knock-in (LivPGC1α) mice and the control mice were fed high-fat diet (HFD) for 8 weeks. IL-10 neutralizing antibody was injected into the liver of PGC1α mice. A variety of biological and histological approaches were applied to assess hepatic function. We demonstrated that hepatic PGC1α expression was significantly reduced in mice fed HFD. LivPGC1α livers exhibited enhanced gene expressions involving mitochondrial function, and favored an accelerated lipid metabolism upon HFD. Meanwhile, LivPGC1α mice revealed improved hepatic steatosis and insulin resistance. Mechanistically, PGC1α bound and activated the promotor region of IL-10, thereby attenuating inflammatory response in the liver. Administration of IL10 neutralizing antibody to LivPGC1α mice abolished PGC1α-mediated anti-inflammatory effects in mice. Further, IL-10 neutralizing antibody intervention aggravated hepatic steatosis and insulin resistance in LivPGC1α mice. Taken together, our data indicated that hepatic-specific overexpression of PGC1α exerts a beneficial role in the regulation of hepatic steatosis and insulin resistance via enhancing IL10-mediated anti-inflammatory response. Pharmacological activation of PGC1α-IL10 axis may be promising for the treatment of fatty liver diseases.

Summary: Immune and inflammation dysregulation have been associated with the aging process and contribute to age-related disorders, but the underlying mechanism remains elusive. Here, we employed late-generation Terc knockout (Terc−/−) mice to investigate the impact of telomere dysfunction on the host defense and function of innate immune cells. Terc−/− mice displayed exaggerated lung inflammation and increased mortality upon respiratory staphylococcal infection, although their pathogen-clearing capacity was uncompromised. Mechanistically, we found that telomere dysfunction caused macrophage mitochondrial abnormality, oxidative stress, and hyperactivation of the NLRP3 inflammasome. The ubiquitin-editing enzyme TNFAIP3, together with PGC-1α, was critically involved in the regulation of mitochondrial and inflammatory gene expression and essential for the homeostatic role of telomeres. Together, the study reveals a regulatory paradigm that connects telomeres to mitochondrial metabolism, innate immunity, and inflammation, shedding light on age-related pathologies. : Kang et al. show that dysfunctional telomeres cause macrophage mitochondrial distress, metabolic imbalance, and hyperactivation of the NLRP3 inflammasome. They identify the PGC1α/TNFAIP3 axis as a mechanism responsible for the homeostatic role of the telomere, the disturbance of which leads to inflammatory Terc−/− macrophages and severe bacterial pneumonia in Terc−/− mice. Keywords: telomere, macrophages, inflammasome, mitochondria

Land plants protect themselves from ultraviolet-B (UV-B) by accumulating UV-absorbing metabolites, which may also function as anti-insect toxins. Previous studies have shown that UV-B enhances the resistance of different plant species to pierce-sucking pests; however, whether and how UV-B influences plant defense against chewing caterpillars are not well understood. Here we show that UV-B treatment increased Spodoptera litura herbivory-induced jasmonic acid (JA) production in Arabidopsis and thereby Arabidopsis exhibited elevated resistance to S. litura. Using mutants impaired in the biosynthesis of JA and the defensive metabolites glucosinolates (GSs), we show that the UV-B-induced resistance to S. litura is dependent on the JA-regulated GSs and an unidentified anti-insect metabolite(s). Similarly, UV-B treatment also enhanced the levels of JA-isoleucine conjugate and defense-related secondary metabolites in tobacco, rice, and maize after these plants were treated with simulated herbivory of lepidopteran insects; consistently, these plants showed elevated resistance to insect larvae. Using transgenic plants impaired in JA biosynthesis or signaling, we further demonstrate that the UV-B-enhanced defense responses also require the JA pathway in tobacco and rice. Our findings reveal a likely conserved JA-dependent mechanism by which UV-B enhances plant defense against lepidopteran insects.

Aims: The aims of this study were to evaluate the clinical application of planar puncture template (PPT) in computed tomography (CT)-guided percutaneous needle lung biopsy. Subjects and Methods: A total of 56 patients with small pulmonary nodules who received CT-guided percutaneous lung biopsy assisted by PPT were included in the study. Five steps were included in the study: fixing position, CT scanning and designing needle pathway, installing navigation system and template, puncturing fixation needle, and performing biopsy needle insertion and biopsy. The success rate of puncture, pathological results, and complications were analyzed. In addition, the factors that influenced the success rate and complications were analyzed. Results: Biopsy was successfully completed in all 56 patients. The nodule diameter was 0.45–3 cm. The fixation needle technique was applied in 47 cases. Biopsy was performed 1 time in 50% of patients and 2 times in 38% of patients. For pathology, only one case showed no positive result, with a puncture success rate of 98%. The diagnostic rate of malignant tumor was 73%. For complications, the incidence of needle tract bleeding was 68%, the incidence of pneumothorax was 30%, and the thoracic drainage was required in two patients. Hemoptysis was observed in two cases. Univariate analysis: The nodule size was related to both the rate of 1-time biopsy and incidence of complications. Smaller nodule was relevant to lower rate of 1-time biopsy (P = 0.01) and higher incidence of complications (P < 0.05). The fixation needle was related to 1-time biopsy rate. The 1-time biopsy rate was significantly higher in patients with fixation needle than those without fixation needle (P = 0.001). Meanwhile, no significant difference was observed in the incidence of complications in different number of fixation needles (P > 0.05). Conclusions: PPT-assisted lung biopsy technology can provide high success rate and low complication incidence. It would be helpful to make the puncture procedures more standard for better clinical applications.

Mutations in ATP8B1 or ATP11C (members of P4-type ATPases) cause progressive familial intrahepatic cholestasis type 1 in human or intrahepatic cholestasis in mice. Transmembrane protein 30A (TMEM30A), a β-subunit, is essential for the function of ATP8B1 and ATP11C. However, its role in the etiology of cholestasis remains poorly understood. To investigate the function of TMEM30A in bile salt (BS) homeostasis, we developed Tmem30a liver-specific knockout (LKO) mice. Tmem30a LKO mice experienced hyperbilirubinemia, hypercholanemia, inflammatory infiltration, ductular proliferation, and liver fibrosis. The expression and membrane localization of ATP8B1 and ATP11C were significantly reduced in Tmem30a LKO mice, which correlated with the impaired expression and localization of BS transporters, such as OATP1A4, OATP1B2, NTCP, BSEP, and MRP2. The proteasome inhibitor bortezomib partially restored total protein levels of BS transporters but not the localization of BS transporters in the membrane. Furthermore, the expression of nuclear receptors, including FXRα, RXRα, HNF4α, LRH-1, and SHP, was also down-regulated. A cholic acid–supplemented diet exacerbated the liver damage in Tmem30a LKO mice. TMEM30A deficiency led to intrahepatic cholestasis in mice by impairing the expression and localization of BS transporters and the expression of related nuclear receptors. Therefore, TMEM30A may be a novel genetic determinant of intrahepatic cholestasis.

Preslaughter transport has been reported to decrease the quality of breast meat but not thigh meat of broilers. However, tissue-specific difference in glycogen metabolism between breast and thigh muscles of transported broilers has not been well studied. We thus investigated the differences in meat quality, adenosine phosphates, glycolysis, and bound key enzymes associated with glycolysis metabolism in skeletal muscles with different fiber types of preslaughter transported broilers during summer. Compared to a 0.5 h transport, a 3 h transport during summer decreased ATP content, increased AMP content and AMP/ATP ratio, and accelerated glycolysis metabolism via the upregulation of glycogen phosphorylase expression accompanied by increased activities of bound glycolytic enzymes (hexokinase, pyruvate kinase, and lactate dehydrogenase) in pectoralis major muscle, which subsequently increased the likelihood of pale, soft, and exudative-like breast meat. On the other hand, a 3 h transport induced only a moderate glycolysis metabolism in tibialis anterior muscle, which did not cause any noticeable changes in the quality traits of the thigh meat.

G-protein-mediated signaling pathways regulate fungal morphogenesis, development and secondary metabolism. In this study, we report a gene, pgα1, that putatively encodes the α-subunit of a group I G protein in Pestalotiopsis microspora NK17, which is known to produce various secondary metabolites, including the antitumor drug taxol and pestalotiollide B (PB). Mutants of pgα1 showed retarded vegetative growth, aging of the mycelium, premature conidiation, deformed conidia, significantly increased melanin production, and a sharp decrease in PB production. The introduction of extra copies of pgα1 led to a different phenotype that was characterized by enhanced production of PB. qRT-PCR revealed that the expression of pks1, which encodes melanin polyketide synthase, an enzyme that is involved in 1, 8-dihydroxynaphthalene (DHN) melanin biosynthesis, was up regulated by 55-fold in the absence of pgα1. Changes in conidiation and PB production in pgα1 mutants were able to be restored by the addition of exogenous cAMP. The deficiencies of PB production and conidiation in Δpgα1 were not able to be rescued by deletion or overexpression of a previously reported histone deacetylase gene (hid1), suggesting that pgα1 is able to override the effect of hid1 on PB production and conidiation. Our results suggested that the G protein-cAMP pathway plays a critical role in vegetative growth as well as in asexual development of P. microspora.

Microbial mutation breeding has been widely used because it is one of the most efficient and practical breeding strategies in the fermentation industry. However, different mutagenesis methods cause various degrees of DNA damage to individual microorganisms, which lead to diverse characteristics of the mutants. In this study, the effects of four different mutagenesis methods on the mutation breeding of Streptomyces avermitilis for improving avermectin B1a production were investigated with an optimized liquid microtiter plate (MTP) culture system. First, an effective and feasible MTP system for mutant strain screening was evaluated through the optimization of the oxygen transfer rate and rapid titer determination. Then, high energy carbon heavy ion irradiation, diethyl sulfate, ultraviolet- (UV) irradiation combined with lithium chloride, and sodium nitrite were used as the mutagens for mutation breeding, respectively. Results showed that carbon heavy ion irradiation had the advantages of possessing the highest positive mutation rate and mean-production of positive mutant strains in the first generation. Sodium nitrite treatment resulted in mutant strains with better inherited stability than the other three methods. Through the combined treatment of carbon heavy ion irradiation and sodium nitrite treatment, an inheritstable mutant S. avermitilis S-233 with high avermectin B1a production was successfully obtained. The fermentation verification in a 500-liter (L) bioreactor demonstrated that the avermectin B1a produced by mutant S. avermitilis S-233 reached 6818 μg/mL, which was 23.8% higher than that of parent strains.

This study examined the influence of welded depth and CuCl2 pretreated dowels on wood dowel welding. In untreated group without pretreatment (group A), test results indicated that welded depth 40 mm exhibited higher pullout resistance than the other welded depths. In the same welded depth of 30 mm, specimens with dowels immersed in CuCl2 solution for 30 min (group B) exhibited the highest pullout resistance than the other specimens. According to the failure behavior, the pullout resistance of group B was considered to be the maximum theory pullout resistance in the welded depth of 30 mm. Weibull distribution could be applied reasonably to analyze pullout resistance of different welded depth. The linear simulation and Eckelman formula could not fit the relation of pullout resistance and welded depth. While the nonlinear simulation of sine function could fit the relation accurately. Based on the Weibull distribution, 95% reliability pullout resistance was calculated. The nonlinear simulation of sine function also existed between 95% reliability pullout resistance and welded depth. The temperature difference of group A-30 and group B was tested to study the reason of different pullout resistance. Both of the two groups, the temperature of point 1 was the highest, and the point 3 was the lowest. The pullout resistance was affected significantly by the temperature of point 2 and 3. For point 1, 260 °C was an excessive temperature, while 224.3 °C was the better choice for welding in this study.

The amyloid fibrils derived from protein and peptide self-assembly have been studied in many diseases. In the present study, in combination with Thioflavin T(ThT) assay, Congo red(CR),transmission electron microscopy and cell cytotoxicity assay, we investigated the influence of zinc ions on amyloid fibril formation using hen egg white lysozyme (HEWL) as a model protein under high temperature and acidic pH conditions. We observed that HEWL tended to form the amyloid fibrils at pH 2.0 and 60°C, which was consistent with the previous studies. However, as the concentrations of zinc ions increased, the amounts of amyloid fibrils of HWEL gradually reduced, but the overall morphology of individual amyloid fibril was not significantly altered whether or not zinc ions were present. Moreover, by using circular dichroism (CD), ANS and intrinsic fluorescence spectra, we illustrated that zinc ions inhibited the formation of β-sheet and exposure of hydrophobic regions of HEWL. This work would help to understand the molecular mechanism of amyloid fibril formation.

This study examined the mechanics and pyrolysis analyses of rotation welding with treated dowels. Test results indicated that welding specimens with dowels immersed in CuCl2 solution exhibited higher pullout resistance than untreated specimens. Scanning electron microscopy was used to observe and analyze the welding interface. Wood dowels immersed in CuCl2 solution provided more flowing molten polymer to obtain better connection than untreated wood dowels. Based on the chemical analyses of X-ray photoelectron spectroscopy, and thermogravimetric analyses, the hydrolysis of cellulose and hemicellulose was detected after immersion of the dowels in a CuCl2 solution. Pyrolysis of cellulose, hemicellulose and lignin occurred during the welding process. The hydrolysis of cellulose and hemicellulose may promote the pyrolysis and efficient connection of wood components during the welding process.