Search

Herein, we described the synthesis of two L-phenylalanines α-derivatized with a terminal alkyne moiety whose structures differed by phenyl ring halogen substitution (two o-Cl in 1 vs. one p-Br in 2) and investigated their effect on biological macromolecules and living cells. We explored their interaction with quadruplex DNA (G4 DNA), using tel 26 and c-myc as models, and bovine serum albumin (BSA). By CD spectroscopy, we found that 1 caused minor tel26 secondary structure changes, leading also to a slight thermal stabilization of this hybrid antiparallel/parallel G4 structure, while the c-myc parallel topology remained essentially unchanged upon 1 binding. Other CD evidences showed the ability of 1 to bind BSA, while molecular docking studies suggested that the same molecule could be housed into the hydrophobic cavity between sub-domains IIA, IIB, and IIIA of the protein. Furthermore, preliminary aggregation studies, based on concentration-dependent spectroscopic experiments, suggested the ability of 1 to aggregate forming noncovalent polymeric systems in aqueous solution. Differently from 1, the bromine-modified compound was able to bind Cu(II) ion, likely with the formation of a CuL 2 complex, as found by UV spectroscopy. Finally, cell tests excluded any cytotoxic effect of both compounds toward normal cells, but showed slight antiproliferative effects of 2 on PC3 cancerous cells at 24 h, and of 1 on both T98G and MDA-MB-231 cancer cells at 48 h.

Herein, we present a spectroscopic (CD and UV) and SEM study of a phenylalanine derivative carrying a terminal alkyne moiety and indicated by us CF3IIIPhe, with particular attention to its interaction with Cu(II) cation and some biological macromolecules, as well as a preliminary evaluation of its effect on cancerous cells. CD spectroscopy evidenced the ability of CF3IIIPhe to interact with tel 26 and c-myc, two quadruplex DNA (G4 DNA) models explored in this study. Other CD and UV studies revealed the ability of the unnatural amino acid to form aggregates in aqueous solution, to bind Cu(II) cation, and to interact with bovine serum albumin (BSA). Cellular studies demonstrated CF3IIIPhe antiproliferative activity on PC3 cells. Its ability to bind telomeric DNA was verified with tel 26 by CD investigation and SEM analysis, that revealed a noteworthy change in DNA morphology (mainly based on nanosphere structures) by CF3IIIPhe, confirming its G4-DNA binding ability already evidenced by spectroscopy., Competing Interests: Declaration of competing interest There are no conflicts to declare., (Copyright © 2018 Elsevier B.V. All rights reserved.)

An artificial alanine-based amino acid {(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoic acid, here named TioxAla}, bearing a substituted triazolyl-thione group on the side chain and able to bind RNA biomedical targets, was here chosen as a valuable scaffold for the synthesis of new platinum complexes with potential dual action owing to the concomitant presence of the metal centre and the amino acid moiety. Three new platinum complexes, obtained from the reaction of TioxAla with K 2 PtCl 4 , were characterized by mass spectrometry, nuclear magnetic resonance and UV-vis spectroscopy: one compound (Pt1, bis-{(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoate-O,S} platinum(II)) consisted of two amino acid units coordinating the Pt(II) ion; the other two, Pt2 [potassium dichloro-{(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoate (O,S)} platinum(II)] and Pt3 [potassium dichloro-{(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoate (O,N)} platinum(II)], were isomers bearing one TioxAla unit, and two chlorides as Pt-ligands. Pt coordination involved preferentially the amino, carboxylic and thione functions of TioxAla. By preliminary antiproliferative assays, a moderate cytotoxic activity on cancer cells was observed only for Pt2 and Pt3, while no anticancer activity was found for both the chloride-free complex (Pt1) and TioxAla. This cytotoxicity, however lower than that of cisplatin, well correlated with the marked ability, here found only for Pt2 and Pt3 complexes, to bind DNA sequences either in random coil or in structured forms (duplex and G-quadruplex), as verified by spectroscopic and spectrometric analysis., (Copyright © 2019. Published by Elsevier Inc.)

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Four 4-nitrophenyl-functionalized benzofuran (BF1, BF2) and benzodifuran (BDF1, BDF2) compounds were synthesized by a convenient route based on the Craven reaction. All the compounds underwent a detailed chemical-physical characterization to evaluate their structural, thermal and optical properties. An investigation on the therapeutic potential of the reported compounds was performed by analyzing their antiproliferative activity on prostatic tumour cells (PC-3). In both classes of compounds, anticancer potential is in direct correlation with the lipophilicity. From our study it emerged that antiproliferative activity was higher for benzofuran derivatives as compared to benzodifuran systems. Moreover, we report a mechanistic study relative to the most promising molecule, i.e. the apolar benzofuran BF1, that relates the antiproliferative properties found in our investigation to its ability to bind telomeric DNA (proven by CD and fluorescence techniques on tel 22 G4 DNA), and highlights its unexpected impact on cell cycle progression., (Copyright © 2018 Elsevier B.V. All rights reserved.)

Background: trans-Resveratrol (tRES) is a polyphenolic stilbene found in plant products which has attracted great attention because of its antioxidant, anti-inflammatory and anticancer properties., Methods: The possible correlation between tRES-induced suppression of melanoma cell growth and its influence on telomerase expression has been investigated by biological assays. Moreover, in order to gain new knowledge about possible mechanisms of action of tRES as antineoplastic agent, its interaction with biologically relevant secondary structure-forming DNA sequences, its aggregation properties and copper-binding activity have been studied by CD, UV and fluorescence spectroscopies., Results: Biological assays have confirmed that growth inhibitory properties of tRES well correlate with the reduction of telomerase activity and hTERT gene transcript levels in human melanoma cells. Biophysical studies in solution have proved that tRES binds all the studied DNA model systems with low affinity, however showing high ability to discriminate G-quadruplex vs. duplex DNA. In addition, tRES has shown no propensity to form aggregates in the explored concentration range and has been found able to bind Cu 2+ ions with a 2:1 stoichiometry., Conclusions: From these biological and biophysical analyses it has emerged that tRES produces cytotoxic effects on human melanoma cells and, at a molecular level, is able to bind Cu 2+ and cancer-involved G-quadruplexes, suggesting that multiple mechanisms of action could be involved in its antineoplastic activity., General Significance: Expanding the knowledge on the putative mechanisms of action of tRES as antitumour agent can help to develop novel, effective tRES-based anticancer drugs., (Copyright © 2017 Elsevier B.V. All rights reserved.)

Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione L-alanine (Lac-L-TTA). This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.

Nucleic acid aptamers are single-stranded DNA or RNA molecules identified to recognize with high affinity specific targets including proteins, small molecules, ions, whole cells and even entire organisms, such as viruses or bacteria. They can be identified from combinatorial libraries of DNA or RNA oligonucleotides by SELEX technology, an in vitro iterative selection procedure consisting of binding (capture), partitioning and amplification steps. Remarkably, many of the aptamers selected against biologically relevant protein targets are G-rich sequences that can fold into stable G-quadruplex (G4) structures. Aiming at disseminating novel inspiring ideas within the scientific community in the field of G4-structures, the emphasis of this review is placed on: 1) recent advancements in SELEX technology for the efficient and rapid identification of new candidate aptamers (introduction of microfluidic systems and next generation sequencing); 2) recurrence of G4 structures in aptamers selected by SELEX against biologically relevant protein targets; 3) discovery of several G4-forming motifs in important regulatory regions of the human or viral genome bound by endogenous proteins, which per se can result into potential aptamers; 4) an updated overview of G4-based aptamers with therapeutic potential and 5) a discussion on the most attractive G4-based aptamers for diagnostic applications. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Here, we report the synthesis, purification, ESI MS and NMR characterization, as well as the SEM analysis of a fructosyl thiophenyl-substituted triazolyl-thione L-alanine (denominated Fru-L-TTA). This novel fructosyl derivative was obtained by solution synthesis using the Amadori reaction, in analogy to other natural fructosyl-amino acids, and fully characterized. In particular, we report an accurate NMR/MS/SEM characterization of Fru-L-TTA alongside some biological properties, and investigated to compare the properties of the artificial derivative of this work with the natural counterparts. In particular, Fru-L-TTA shares with natural fructosyl-amino acids the possibility to inhibit the colony formation of prostate cancer cells and additionally decreases their migration.