Search

The management of Pseudomonas aeruginosa ( P. aeruginosa ) infections presents a substantial challenge to clinics and public health, emphasizing the urgent need for innovative strategies to address this issue. Quorum sensing (QS) is an intercellular communication mechanism that coordinates bacterial activities involved in various virulence mechanisms, such as acquiring host nutrients, facilitating biofilm formation, enhancing motility, secreting virulence factors, and evading host immune responses, all of which play a crucial role in the colonization and infection of P. aeruginosa . The LasI/R and RhlI/R sub-systems dominate in the QS system of P. aeruginosa . Macrophages play a pivotal role in the host's innate immune response to P. aeruginosa invasion, particularly through phagocytosis as the initial host defense mechanism. This study investigated the effects of P. aeruginosa 's QS system on THP-1 macrophages. Mutants of PAO1 with lasI/rhlI deletion, as well as their corresponding complemented strains, were obtained, and significant downregulation of QS-related genes was observed in the mutants. Furthermore, the ΔlasI and ΔlasIΔrhlI mutants exhibited significantly attenuated virulence in terms of biofilm formation, extracellular polymeric substances synthesis, bacterial adhesion, motility, and virulence factors production. When infected with ΔlasI and ΔlasIΔrhlI mutants, THP-1 macrophages exhibited enhanced scavenging ability against the mutants and demonstrated resistance to cytotoxicity, oxidative stress, inflammatory response, and apoptosis induced by the culture supernatants of these mutant strains. These findings offer novel insights into the mechanisms underlying how the lasI/rhlI mutation attenuates cytotoxicity, oxidative stress, inflammation, and apoptosis in macrophages induced by P. aeruginosa .IMPORTANCE P. aeruginosa is classified as one of the ESKAPE pathogens and poses a global public health concern. The QS system of this versatile pathogen contributes to a broad spectrum of virulence, thereby constraining therapeutic options for serious infections. This study illustrated that the lasI/rhlI mutation of the QS system plays a prominent role in attenuating the virulence of P. aeruginosa by affecting bacterial adhesion, biofilm formation, extracellular polymeric substances synthesis, bacterial motility, and virulence factors' production. Notably, THP-1 macrophages infected with mutant strains exhibited increased phagocytic activity in eliminating intracellular bacteria and enhanced resistance to cytotoxicity, oxidative stress, inflammation, and apoptosis. These findings suggest that targeted intervention toward the QS system is anticipated to diminish the pathogenicity of P. aeruginosa to THP-1 macrophages., Competing Interests: The authors declare no conflict of interest.

Hearing loss positively links with cigarette smoking. However, the involved mechanism and treatment strategies are largely unrevealed. This study aimed to investigate the damaging effect of nicotine on cochlear hair cells, reveal the underlying mechanism and evaluate the therapeutic effect of melatonin on nicotine-induced injury. The results showed that nicotine induced cytotoxicity of House Ear Institute-Organ of Corti 1 (HEI-OC1) cochlear hair cells in a dose-dependent manner (0, 2.5, 5, 10, 20, 40 and 80 μM). Functional investigations showed that nicotine (10 μM) stimulation dramatically promoted apoptosis, inflammatory response, oxidative stress and endoplasmic reticulum stress in HEI-OC1 cells. Moreover, melatonin treatment dose-dependently alleviated the nicotine-induced cytotoxicity in HEI-OC1 cells (0, 10 25, 50 and 100 μM). Further investigation showed that melatonin (100 μM) effectively attenuated the nicotine-induced apoptosis, inflammation, oxidative stress and endoplasmic reticulum stress in HEI-OC1 cells. Collectively, we demonstrated that nicotine induced apoptosis, inflammation, oxidative stress and endoplasmic reticulum stress of cochlear hair cells in an in vitro cell model. Melatonin showed protective effect on these aspects, suggesting that melatonin may be a potential agent for treating smoking-induced hearing loss., (© 2021 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).)

MicroRNA-142-5p (miR-142-5p) has been found to be dysregulated in several neurodegenerative disorders. However, little is known about the involvement of miR-142-5p in Alzheimer's disease (AD). Brain angiogenesis inhibitor 3 (BAI3), which belongs to the adhesion-G protein-coupled receptor subgroup, contributes to a variety of neuropsychiatric disorders. Despite its very high expression in neurons, the role of BAI3 in AD remains elusive, and its mechanism at the cellular and molecular levels needs to be further elucidated. The current study sought to investigate whether miR-142-5p influenced BAI3 expression and neuronal synaptotoxicity induced by Aβ, both in APP/PS1 transgenic mice and a cellular model of Alzheimer's disease. Altered expression of miR-142-5p was found in the hippocampus of AD mice. Inhibition of miR-142 could upregulate BAI3 expression, enhance neuronal viability and prevent neurons from undergoing apoptosis. In addition, the reduction of phosphorylation of Synapsin I and calcium/calmodulin-dependent protein kinase II (CaMKII), as well as the expression of PSD-95 in the hippocampus of APP/PS1 transgenic mice, were significantly restored by inhibiting miR-142. Meanwhile, the levels of Aβ 1-42 , β-APP, BACE-1 and PS-1 in cultured neurons were detected, and the effects of inhibiting miR-142 on spatial learning and memory were also observed. Interestingly, we found that BAI3, an important regulator of excitatory synapses, was a potential target gene of miR-142-5p. Collectively, our findings suggest that miR-142 inhibition can alleviate the impairment of spatial learning and memory, reduce the level of apoptosis, and upregulate the expression of pCaMKII and BAI3 in the hippocampus of APP/PS1 transgenic mice; thus, appropriate interference of miR-142 may provide a potential therapeutic approach to rescue cognitive dysfunction in AD patients., (Copyright © 2021 Elsevier B.V. All rights reserved.)

Oxidative stress-mediated excessive apoptosis and senescence of chondrocytes are the main pathological alterations in the osteoarthritis (OA) development. The protective effects of theaflavin (TF), a common group of polyphenols in black tea, against many degenerative diseases by attenuating oxidative stress are well reported. Nevertheless, its role in the OA treatment is still scantily understood. In the current research, by applying enzyme-linked immunosorbent assay (ELISA) kits and immunofluorescent staining, TF treatment was found to inhibit tert-Butyl hydroperoxide (TBHP)-induced imbalance of anabolism and catabolism in primary mouse chondrocytes. Then, according to western blot, live-dead staining, and SA-β-gal staining, the dramatically increased level of apoptosis and senescence of chondrocytes in response to TBHP was also found to be reduced by TF administration. With regard to upstream signaling investigation, the in vitro molecular binding analysis indicated that the beneficial effects of TF might be related to the regulation of the Keap1/Nrf2/HO-1 axis. Furthermore, the Silencing of Nrf2 resulted in the abolishment of the anti-apoptosis and anti-senescence effects of TF. In addition, the oral administration of TF was demonstrated to ameliorate osteoarthritis development in a surgically induced mouse OA model. Taken together, these results suggest that TF might be a promising therapeutic option for the treatment of OA.

Doxorubicin (Dox) is an effective chemotherapy drug against a wide range of cancers, including both hematological and solid tumors. However, the serious cardiotoxic effect restricted its clinical application. We previously have illuminated the protective role of canonical Wnt/β-catenin signaling in Dox-induced cardiotoxicity. Secreted frizzled-related protein 1 (sFRP1) is one of the endogenous inhibitors of both canonical and noncanonical Wnt signaling. In this study, we investigated the relationship between sFRP1 and noncanonical Wnt/PCP-JNK (Wnt/planar cell polarity-c-Jun N-terminal kinase) pathway in Dox-induced cardiotoxicity in vitro and in vivo. We showed that treatment of H9c2 cardiac myoblasts with Dox (1 μM) time-dependently suppressed cell viability accompanied by significantly decreased sFRP1 protein level and increased Wnt/PCP-JNK signaling. Pretreatment with SP600125, the Wnt/PCP-JNK signaling inhibitor, attenuated Dox-induced apoptosis of H9c2 cells. Overexpression of sFRP1 protected H9c2 cells from Dox-induced apoptosis by inhibiting the Wnt/PCP-JNK pathway. After intraperitoneal injection of a cumulative dose of 15 mg/kg Dox, rats displayed significant cardiac dysfunction; their heart showed inhibited Wnt/β-catenin signaling and activated Wnt/PCP-JNK signaling. These results suggest that sFRP1 may be a novel target for Dox-induced cardiotoxicity.

Transcribed ultra-conserved region (T-UCR) transcripts are a novel class of long non-coding RNAs (lncRNAs) transcribed from ultra-conserved region which is highly conserved in human, rat, and mouse genome. LncRNA UC.173 has been found significantly down-regulated in lead-exposed population and lead-exposed animal mode, and had an inhibitory effect on lead-induced nerve cell apoptosis. We supposed that lncRNA UC.173 had an inhibitory effect on lead-induced renal tubular epithelial cell apoptosis. Thus, the aim of our study was to explore the function of lncRNA UC.173 in lead-exposed renal tubular epithelial cells. In our results, lead exposure inhibited renal tubular epithelial cells viability and promoted cell apoptosis and apoptosis-associated genes expression, but no effect on cell-cycle distribution. Lead exposure inhibited the expression of lncRNA UC.173 in renal tubular epithelial cells, and the inhibition effect was time-dependent and concentration-dependent. Up-regulation of lncRNA UC.173 had no effect on renal tubular epithelial cell viability, cell cycle and apoptosis, but significantly rescued lead-induced inhibition of renal tubular epithelial cell viability and suppressed lead-induced cell apoptosis. In summary, our experiments suggest that lncRNA UC.173 is certainly involved in the regulation of lead-induced renal tubular epithelial cell apoptosis, which may supply a new strategy to minimize lead-induced nephrotoxicity., (Copyright © 2018 Elsevier Masson SAS. All rights reserved.)

Nonreceptor tyrosine kinase c-Src, also known as Src, is a potent oncogene involved in a series of biological processes including cell growth, differentiation, and apoptosis; however, its expression pattern and function in esophageal cancer is poorly addressed. In this study, abnormal overexpression of Src protein was observed in esophageal cancer tissues, which fuelled the speculation that microRNA-mediated posttranscriptional regulatory mechanism might be involved. Bioinformatic analyses were applied to identify miRNAs that could potentially target Src. miR-1 was predicted and further validated as a direct repressor of Src. Moreover, we manipulated knockdown and overexpression experiment on TE-1 and TE-10 cells to demonstrate miR-1 suppressed proliferation and promoted apoptosis in esophageal cancer cells by inhibiting Src. Taken together, this study underlines a negative regulatory mechanism in which miR-1 serves as a suppressor of Src in esophageal cancer cells and may provide insights into novel therapeutic approaches for esophageal cancer., (© 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.)

Spinal cord injury (SCI) often causes neurological deficits with poor recovery; the treatment, however, is far from satisfaction, and the mechanisms remain unclear. Using immunohistochemistry and western blotting analysis, we found α-synuclein (SNCA) was significantly up-regulated in the spinal caudal segment of rats subjected to spinal cord transection at 3 days post-operation. Moreover, the role of SNCA on neuronal growth and apoptosis in vitro was determined by using overexpressing and interfering SNCA recombined plasmid vectors, and the underlying mechanism was detected by QRT-PCR and western blotting. Spinal neurons transfected with SNCA-shRNA lentivirus gave rise to an optimal neuronal survival, while it results in cell apoptosis in SNCA-ORF group. In molecular level, SNCA silence induced the up-regulation of CNTF and down-regulation of Caspase7/9. Together, endogenous SNCA plays a crucial role in spinal neuronal survival, in which the underlying mechanism may be linked to the regulation both apoptotic genes (Caspase7/9) and CNTF. The present findings therefore provide novel insights into the role of SNCA in spinal cord and associated mechanism, which may provide novel cue for the treatment of SCI in future clinic trials.

Although considerable energy and money have been spent trying to inhibit Aβ production and its related metabolic enzyme activities, there are still no drug treatments available to cure even slow for Alzheimer's disease. Therefore, tau protein has been focused recently as the new target for the treatment of Alzheimer's disease. The transfected human embryonic kidney 293 (HEK 293) cells with or without Tau 411 plasmid were used to evaluate the effect of tau protein on cell viability. H 2 O 2 was added to simulate microenvironment of oxidative stress (OS) during aging. N-stearoyl-l-tyrosine (Nstyr), one of the synthesized N-arachidonoylethanolamide analogues was administrated in HEK293/Tau cells during H 2 O 2 insults. Cellular senescence and tau aberrant modification appeared after tau transfection and aggravated by H 2 O 2 insult which detected by β-galactosidase staining analysis and western blotting analysis. The level of expression of Bcl-2 and the result of FCAS analysis indicated the appearance of cellular apoptosis. The expression of prosenescence moleculars such as p16-Rb and P53 were induced by tau transfection in HEK293 cells. Both p16-Rb and p53 senescent molecules were inhibited by Nstyr. AM251 (1 μM; an antagonist of CB1 cannabinoid receptor) or AM630 (1 μM; an antagonist of CB2 cannabinoid receptor) was used to offset the anti-senescence effects afforded by NsTyr. The anti-senescence and anti-apoptosis effect of NsTyr was completely abolished by AM630. Meanwhile, transfection of siRNA CB2 was used to further confirm the above experimental results and it came out the similar results compared with AM630. Taken together, our results suggest that oxidative stress aggravates cellular senescence and apoptosis in HEK293/Tau, which can be reversed by Nstyr via CB2 receptor., (Copyright © 2017 Elsevier B.V. All rights reserved.)

Spinal cord injury (SCI) often causes severe functional impairment with poor recovery. The treatment, however, is far from satisfaction, and the mechanisms remain unclear. By using proteomics and western blot, we found spinal cord transection (SCT) resulted in a significant down-regulation of α-synuclein (SNCA) in the motor cortex of SCT rats at 3 days post-operation. In order to detect the role of SNCA, we used SNCA-ORF/shRNA lentivirus to upregulate or knockdown SNCA expression. In vivo, SNCA-shRNA lentivirus injection into the cerebral cortex motor area not only inhibited SNCA expression, but also significantly enhanced neurons' survival, and attenuated neuronal apoptosis, as well as promoted motor and sensory function recovery in hind limbs. While, overexpression SNCA exhibited the opposite effects. In vitro, cortical neurons transfected with SNCA-shRNA lentivirus gave rise to an optimal neuronal survival and neurite outgrowth, while it was accompanied by reverse efficiency in SNCA-ORF group. In molecular level, SNCA silence induced the upregulation of Bcl-2 and the downregulation of Bax, and the expression of NGF, BDNF and NT3 was substantially upregulated in cortical neurons. Together, endogenous SNCA play a crucial role in motor and sensory function regulation, in which, the underlying mechanism may be linked to the regulation of apoptosis associated with apoptotic gene (Bax, Bcl2) and neurotrophic factors expression (NGF, BDNF and NT3). These finds provide novel insights to understand the role of SNCA in cerebral cortex after SCT, and it may be as a novel treatment target for SCI repair in future clinic trials.

Mutational changes in p53 correlate well with tumorigenesis. Remarkably, however, relatively little is known about the role that p53 variations may play in environmental adaptation. Here we report that codon asparagine-104 (104N) and glutamic acid-104 (104E), respectively, of the p53 gene in the wild zokor (Myospalax baileyi) and root vole (Microtus oeconomus) are adaptively variable, meeting the environmental stresses of the Tibetan plateau. They differ from serine-104 (104S) seen in other rodents, including the lowland subterranean zokor Myospalax cansus, and from serine 106 (106S) in humans. Based on site-directed mutational analysis in human cell lines, the codon 104N variation in M. baileyi is responsible for the adaptive balance of the transactivation of apoptotic genes under hypoxia, cold, and acidic stresses. The 104E p53 variant in Microtus oeconomus suppresses apoptotic gene transactivation and cell apoptosis. Neither 104N nor 104E affects the cell-cycle genes. We propose that these variations in p53 codon 104 are an outcome of environmental adaptation and evolutionary selection that enhance cellular strategies for surviving the environmental stresses of hypoxia and cold (in M. baileyi and M. oeconomus) and hypercapnia (in M. baileyi) in the stressful environments of the Qinghai-Tibet plateau.

Ginkgolide B (GB) has been demonstrated to have a variety of pharmacological actions. Accumulating evidence indicates that GB may exert a protective effect on brain injury. The study was designed to investigate the influence of GB on toll-like receptor 4 (TLR-4) and nuclear factor κB (NF-κB)-dependent inflammatory responses and neuronal cell apoptosis after traumatic brain injury (TBI). Wistar rats were subjected to 5, 10 and 20 mg/kg GB daily for 5 days, intraperitoneally, following TBI. Rats were sacrificed at hour 2, 6 and 12, as well as day 1, 2, 3 and 5 after TBI. The administration of 10 and 20 mg/kg GB could significantly (least-significant difference test: p < 0.05) suppress gene expressions of TLR-4 and NF-κB, lessen concentrations of tumour necrosis factor α, interleukin-1β and interleukin-6, as well as reduce the number of apoptotic neuronal cells in traumatic rat brain tissues, but the administration of 5 mg/kg GB did not (p > 0.05). However, a clear concentration-response relationship was not found. Thus, GB may inhibit TLR-4 and NF-κB-dependent inflammatory responses, and furthermore lessen neuronal cell apoptosis after TBI, which may support the use of GB for the treatment of TBI., (Copyright © 2012 John Wiley & Sons, Ltd.)

Objective: The expression of 2-amino-3-(5-methyl-3-oxo-1, 2-oxazol-4-yl) propanoic acid receptor (AMPAR) subunits in the hippocampus of naive immature and adult rats (IRs, ARs) was investigated after status convulsion (SC)., Methods: Seizures were induced in IRs and ARs with intraperitoneal injections of lithium and pilocarpine. Rats were killed at four time points (3 h, 1 day, 3 days, and 7 days) after SC. The proportion of apoptotic cells was quantified by Annexin V-FITC apoptosis detection. The location and type of apoptotic cells were assessed by using terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling staining. Immunoblotting techniques were used to demonstrate changes in AMPAR subunit expression., Results: Severe seizures induced neuronal apoptosis in the hippocampus. The proportion of apoptotic cells in IRs was consistently lower than that in ARs after SC. The expressions of four AMPAR subunits in IRs were consistently lower than those in ARs before and after SC. SC for 1 h inhibited the expression of glutamate receptors (GluR1-4) in the hippocampus of IRs and ARs and altered the subunit composition of AMPARs. GluR2 was the predominant AMPAR subunit in the hippocampus of normal ARs, while the GluR2/3 subunits were predominantly expressed 7 days after SC. GluR3/4 subunits were mainly expressed in the hippocampus of normal IRs, which had the lowest levels of GluR2., Conclusions: Immature brain was more resistant to seizure-induced neural damage. The time course of reduction and recovery differed for each subunit and was dependent on developmental stage. The increased expression of GluR2 could confer early but transient protection in the immature brain after SC.

Background: Propofol exposure to neurons during synaptogenesis results in apoptosis, leading to cognitive dysfunction in adulthood. Previous work from our laboratory showed that isoflurane neurotoxicity occurs through p75 neurotrophin receptor (p75(NTR)) and subsequent cytoskeleton depolymerization. Given that isoflurane and propofol both suppress neuronal activity, we hypothesized that propofol also induces apoptosis in developing neurons through p75(NTR)., Methods: Days in vitro 5-7 neurons were exposed to propofol (3 μM) for 6 h and apoptosis was assessed by cleaved caspase-3 (Cl-Csp3) immunoblot and immunofluorescence microscopy. Primary neurons from p75(NTR-/-) mice or wild-type neurons were treated with propofol, with or without pretreatment with TAT-Pep5 (10 μM, 15 min), a specific p75(NTR) inhibitor. P75(NTR-/-) neurons were transfected for 72 h with a lentiviral vector containing the synapsin-driven p75(NTR) gene (Syn-p75(NTR)) or control vector (Syn-green fluorescent protein) before propofol. To confirm our in vitro findings, wild-type mice and p75(NTR-/-) mice (PND5) were pretreated with either TAT-Pep5 or TAT-ctrl followed by propofol for 6 h., Results: Neurons exposed to propofol showed a significant increase in Cl-Csp3, an effect attenuated by TAT-Pep5 and hydroxyfasudil. Apoptosis was significantly attenuated in p75(NTR-/-) neurons. In p75(NTR-/-) neurons transfected with Syn-p75(NTR), propofol significantly increased Cl-Csp3 in comparison with Syn-green fluorescent protein-transfected p75(NTR-/-) neurons. Wild-type mice exposed to propofol exhibited increased Cl-Csp3 in the hippocampus, an effect attenuated by TAT-Pep5. By contrast, propofol did not induce apoptosis in p75(NTR-/-) mice., Conclusion: These results demonstrate that propofol induces apoptosis in developing neurons in vivo and in vitro and implicate a role for p75(NTR) and the downstream effector RhoA kinase.

Ethnopharmacological Relevance: Ginkgolide B (GB) is one of the ginkgolides that have been isolated from leaves and root bark of the Chinese tree Ginkgo biloba L. (Ginkgoaceae), and is a specific and potent antagonist of platelet activating factor. There is a large body of data showing that GB possesses a markedly neuroprotective property against ischemia-induced impairment in vivo and in vitro. Recently it has been found that GB can inhibit the inflammation in the rat brain tissues with ischemia/reperfusion injury and in the astrocytes treated with lipopolysaccharide, as well as protect neurons against beta-amyloid 25-35 and ischemia-induced apoptosis. However, there have been few reports on the influence of GB on intracerebral hemorrhage (ICH). This study was to investigate the effects of intraperitoneal GB on neuronal cell apoptosis, inflammatory cytokines and Toll-like receptor 4 (TLR4)/nuclear factor kappa-B (NF-κB) pathway after ICH., Materials and Methods: Wistar rats obtained an intraperitoneal injection of 5, 10 and 20mg/kg GB after ICH once a day till day 5. Rats were sacrificed by decapitation at hour 2, 6 and 12, as well as day 1, 2, 3 and 5 after ICH. Gene expressions of TLR-4 and NF-κB, concentrations of tumor necrosis factor-alpha (TNF-α), interleukin-1beta (IL-1β) and interleukin-6 (IL-6) as well as number of apoptotic neuronal cells in hemorrhagic rat brain tissues were determined., Results: The administration of 10 and 20mg/kg GB could significantly suppress gene expressions of TLR-4 and NF-κB, lessen concentrations of TNF-α, IL-1β and IL-6 as well as reduce number of apoptotic neuronal cells in hemorrhagic rat brain tissues by Least-significant Difference test (P<0.05), but the administration of 5mg/kg GB not (P>0.05). However, a clear concentration-response relationship was not found., Conclusions: GB may inhibit TLR4/NF-κB-dependent inflammatory responses, and furthermore lessen neuronal cell apoptosis after ICH, which may support the use of G. biloba extracts for the treatment of ICH., (Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.)

Sinomenine (SIN), an alkaloid extracted from the stem of the Chinese medicinal plant sinomenium acutum, has been used for treating rheumatoid arthritis. But little is known whether SIN has a protective effect on osteoarthritis (OA). In this study, we investigated the protective effect of SIN on IL-1beta-induced proteoglycan degradation and apoptosis in rabbit articular cartilage and chondrocytes. Treatment with 10 ng/ml IL-1beta increased the level of glycosaminoglycan (GAG) released into the culture media, and up-regulated the activity and mRNA expression of matrix metalloproteinase 13 (MMP-13) and down-regulated the activity and mRNA expression of tissue inhibitor of metalloproteinase 1 (TIMP-1) in cartilage explants, as confirmed by the methods of GAG quantitation, MMP-13/TIMP-1 enzyme-linked immunosorbent assay (ELISA) and real-time quantitative RT-PCR. Treatment with 10 ng/ml IL-1beta resulted in marked apoptosis in chondrocytes, as demonstrated by decreased cell viability, occurrence of DNA laddering and increased caspase-3 activity and annexin V binding of phosphatidylserine. However, simultaneous treatment with SIN (10, 50 or 250 microM) inhibited the GAG release and the activity and mRNA expression of MMP-13, and enhanced the activity and mRNA expression of TIMP-1 in a dose-dependent manner in cartilage explants. Furthermore, DNA fragment, caspase-3 activity and apoptosis rate were down-regulated, and cell viability was up-regulated dose-dependently in chondrocytes. Thus, SIN has the protective capacity to antagonize cartilage degradation and chondrocyte apoptosis, which suggest that SIN may act as an agent for pharmacological intervention in the progress of OA.

Background: Apoptosis plays an important role in further brain injury after intracerebral hemorrhage (ICH). Procoagulant microparticles (MPs) are shed from the plasma membrane of apoptotic cells. The objective of this study was to determine plasma and cerebrospinal fluid (CSF) levels of MPs in patients with spontaneous ICH and to correlate MP levels with Glasgow Coma Scale (GCS) scores, ICH volumes, presence of intraventricular hemorrhage (IVH), and survival rate., Methods: Ten patients with suspicion of subarachnoid hemorrhage and 36 patients with spontaneous basal ganglia hemorrhage were included. Plasma and CSF samples were collected. Circulating MPs were obtained by double centrifugation and captured with annexinV. Their procoagulant potential was measured with a prothrombinase assay., Results: Plasma or CSF MP levels in the ICH group were significantly higher than those in the control group (8.2 +/- 3.0 vs 3.2 +/- 1.7 nmol/L phosphatidylserine [PS] equivalent; P < .001 or 9.8 +/- 3.7 vs 1.4 +/- 0.6 nmol/L PS equivalent; P < .001). The MP levels were highly associated with GCS scores, ICH volumes, presence of IVH, and survival rate (all P < .05) in ICH. A receiver operating characteristic curve identified CSF and plasma MP cutoff levels that predicted 1-week mortality of patients with the high sensitivity and specificity values. Areas under curves (AUCs) of GCS scores and ICH volumes were larger than those of CSF and plasma MP levels, but only the difference between AUC of GCS scores and that of plasma MPs levels reached statistical significance (P < .05)., Conclusions: High levels of procoagulant MPs are present in the CSF and peripheral blood of patients with ICH and may contribute to the pathogenesis of ICH. The levels of CSF and plasma MPs after spontaneous onset of ICH seem to correlate with clinical outcome in these patients. Taking clinical complexity into account, only plasma MP levels can be served as useful clinical markers for evaluating the prognosis of ICH.

Objective: To explore the influence of duration of convulsion state (SC) on neuronal apoptosis, mitochondrial membrane potential (Deltapsim) and cytochrome C (cyt C) release in hippocampus in Wistar rats after SC., Methods: SC lasting for 30 minutes or 3 hours was induced by intraperitoneal injection of lithium chloride and pilocarpine. Rats were sacrificed at 3, 6, 12 hours and on 1 day after 30 minutes SC and at 3, 6 hours and on 1 day after 3 hours SC. The apoptosis, mitochondrial Deltapsim and intracellular cyt C were determined with flow cytometry, and the correlation with SC duration was compared., Results: The proportion of apoptotic cells, the decrease in mitochondrial Deltapsim and the release of intracellular cyt C significantly changed at 30 minutes after SC. The peak level of apoptosis was seen at 12 th hour after SC and that of mitochondrial peaked at 6 th hour after SC in apoptosis and the two early apoptotic events, respectively. Compared with the same time point after 30 minutes SC, the levels of apoptosis and the two early apoptotic events after 3 hours SC were much higher. The neuronal apoptosis and the two early apoptotic events in hippocampus after SC showed positive correlation with the duration of SC in partial correlation analysis (all P<0.05)., Conclusion: Severe seizure could induce the changes in neuronal apoptosis and the early apoptotic events in hippocampus after SC. The longer the duration of SC is, the more serious change in apoptosis and early apoptotic events are.

Background: Photochemotherapy has long been used in the treatment of psoriasis; however, its mechanism has not been completely elucidated. Psoriasis is now regarded as an angiogenesis-related disease. Recent studies indicated that the inhibition of angiogenesis by photochemotherapy could be an underlying mechanism. It was found that photochemotherapy can downregulate the expression of angiogenic factors in keratinocytes. However, the direct effect of photochemotherapy on endothelial cells has not been studied., Methods: In this study, we determined the effect of photochemotherapy on the proliferation of human microvascular endothelial cells through MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and cell cycle analysis. The migration assay and in vitro tube formation assay were used to investigate the migration properties and tube formation ability of human microvascular endothelial cells after psoralen plus UVA (PUVA) treatment. The apoptosis of endothelial cells elicited by photochemotherapy was also analyzed with fluorescence-activated cell sorting analysis (FACS)., Results: UVA (0.8-5.0 J/cm(2)) irradiation with the presence of 8-methoxypsoralen (8-MOP) (300 ng/ml) resulted in a dose-dependent reduction in the cell viabilities of endothelial cells. FACS data showed an accumulation of cells in G0/G1 phase of cell cycle and apoptotic features of cell death after UVA irradiation with psoralen. The migration properties and tube formation ability of endothelial cells were dramatically inhibited by photochemotherapy., Conclusion: Our results showed that photochemotherapy inhibits angiogenesis and induces apoptosis of human microvascular endothelial cells in vitro, which may be a possible mechanism of photochemotherapy in the treatment of psoriasis.

Disulfidptosis, a newly identified mode of programmed cell death, is yet to be comprehensively elucidated with respect to its multi-omics characteristics in tumors, specific pathogenic mechanisms, and antitumor functions in liver cancer. This study included 10,327 tumor and normal tissue samples from 33 cancer types. In-depth analyses using various bioinformatics tools revealed widespread dysregulation of disulfidptosis-related genes (DRGs) in pan-cancer and significant associations with prognosis, genetic variations, tumor stemness, methylation levels, and drug sensitivity. Univariate and multivariate Cox regression and LASSO regression were used to screen and construct prognosis-related hub DRGs and predictive models in the context of liver cancer. Subsequently, single cell analysis was conducted to investigate the subcellular localization of RPN1, a hub DRG, in various solid tumors. Western blotting was performed to validate the expression of RPN1 at both cellular and tissue levels. Additionally, functional experiments, including CCK8, EdU, clone, and transwell assays, indicated that RPN1 knockdown promoted the proliferative and invasive capacities of liver cancer cells. Therefore, this study elucidated the multi-omics characteristics of DRGs in pan-cancer and established a prognostic model for liver cancer. Additionally, this study revealed the molecular functions of RPN1 in liver cancer, suggesting its potential as a therapeutic target for this disease. [ABSTRACT FROM AUTHOR]

Addressing recurrent cervical cancer poses a substantial challenge. Osimertinib, an FDA-approved EGFR inhibitor, has emerged as a promising option. Our study examined its potential to enhance paclitaxel's efficacy against cervical cancer. Osimertinib effectively hindered cancer cell growth and induced apoptosis across multiple cell lines. Combined with paclitaxel, it exhibited synergy in suppressing cervical cancer cells. Importantly, osimertinib's inhibitory effect was EGFR-independent; it targeted Mnk phosphorylation, reducing eIF4E activity. In mice, the combined osimertinib-paclitaxel treatment surpassed individual drugs in inhibiting cancer growth. These preclinical findings suggest osimertinib's repurposing as a means to improve paclitaxel's effectiveness in cervical cancer treatment. [ABSTRACT FROM AUTHOR]

Abstract Background Angiostrongylus cantonensis has been the only parasite among Angiostrongylidae to cause human central nervous system infection characterized by eosinophilic meningitis or meningoencephalitis. The mechanism of the extensive neurological impairments of hosts caused by A. cantonensis larvae remains unclear. The aim of the present study was to investigate apoptosis, necroptosis and autophagy in the brains of mice infected with A. cantonensis, which will be valuable for better understanding the pathogenesis of angiostrongyliasis cantonensis. Methods Functional and histological neurological impairments of brain tissues from mice infected with A. cantonensis were measured by the Morris water maze test and haematoxylin and eosin (H&E) staining, respectively. The transcriptional and translational levels of apoptosis-, necroptosis- and autophagy-related genes were quantified by quantitative real-time polymerase chain reaction (RT-PCR), and assessed by western blot and immunohistochemistry (IHC) analysis. Apoptotic and necroptotic cells and their distributions in infected brain tissues were analysed by flow cytometry and transmission electron microscopy (TEM). Results Inflammatory response in the central nervous system deteriorated as A. cantonensis infection evolved, as characterized by abundant inflammatory cell infiltration underneath the meninges, which peaked at 21 days post-infection (dpi). The learning and memory capacities of the mice were significantly decreased at 14 dpi, indicating prominent impairment of their cognitive functions. Compared with those of the control group, the mRNA levels of caspase-3, -4, -6, and RIP3 and the protein levels of caspase-4, cleaved caspase-3, cleaved caspase-6, RIP3, and pRIP3 were obviously elevated. However, no changes in the mRNA or protein levels of FADD, Beclin-1 or LC3B were evident, indicating that apoptosis and necroptosis, but not autophagy, occurred in the brain tissues of mice infected with A. cantonensis. The quantitative RT-PCR, western blot, IHC, flow cytometry and TEM results further revealed the apoptotic and necroptotic microglia, astrocytes and neurons in the parenchymal and hippocampal regions of infected mice. Conclusions To our knowledge, we showed for the first time that A. cantonensis infection causes the apoptosis and necroptosis of microglia and astrocytes in the parenchymal and hippocampal regions of host brain tissues, further demonstrating the pathogenesis of A. cantonensis infection and providing potential therapeutic targets for the management of angiostrongyliasis.

Depression is a global public health issue that is widely studied due to the large number of people it affects and its serious consequences. Clinical studies have shown that regular tea consumption may reduce depression risk. (−)‐Epigallocatechin gallate (EGCG), the main tea polyphenol, was observed to alleviate depression, but the underlying mechanism has not been elucidated. In this study, chronic unpredictable mild stress (CUMS) was used to induce depression‐like behavior in mice, and behavioral tests, such as sucrose preference test and forced swim test, were performed. Then, ELISA, western blot and QT‐PCR tests were used to assess the expression of the key components of the NLRP3 inflammasome and its downstream inflammatory effectors (e.g., IL‐1β, IL‐18), autophagy markers (Beclin‐1, LC3, P62) and apoptosis markers (Bax, Bcl‐2) in mouse brain tissues. Changes in serum lipid levels were also assessed. EGCG alleviated CUMS‐induced depression‐like behavioral changes in mice, reduced activation of the NLRP3 inflammasome, inhibited the mTOR signaling pathway, restored autophagy levels, reduced apoptosis marker expression and attenuated abnormal changes in blood lipid levels. Our study demonstrates that EGCG exerts antidepressive effects through multiple mechanisms, providing new insight into the pathological mechanism of depression and laying the foundation for the development of new therapeutic measures. [ABSTRACT FROM AUTHOR]

Objective: This study sought to investigate the effect of miR‐5191 on proliferation, invasion and metastasis in salivary adenoid cystic carcinoma (SACC). Materials and Methods: The differential expression level of miR‐5191 between 5 primary tumor and adjacent non‐neoplastic samples, and in two SACC cell lines was detected by quantitative real‐time PCR. Cell proliferation, invasion, and migration were performed, followed by luciferase reporter assay and western analysis. The effect of miR‐5191 on cell proliferation and apoptosis was evaluated by cell growth and apoptosis assay. The function of miR‐5191 in SACC tumorigenesis and metastasis in vivo was investigated by nude mice experiment. The associations between miR‐5191/Notch‐2 expression and clinicopathological features were analyzed. Results: miR‐5191 was downregulated in primary tumor tissues and SACC‐LM cells. By targeting Notch‐2, miR‐5191 expression level affected the migration, invasion, and proliferation of SACC cells. Overexpression of miR‐5191 inhibited the expression levels of Notch‐2, followed by the decreased expression of c‐Myc, Bcl‐2, Hes‐1, Hey‐1, and Cyclin D1. In vivo, miR‐5191 overexpression suppressed the SACC tumorigenesis and pulmonary metastasis in mice. In SACC patients, higher expression of miR‐5191 was related to better prognoses and lower possibility of metastasis. Conclusions: miR‐5191 acts as a tumor suppressor in SACC by targeting Notch‐2. [ABSTRACT FROM AUTHOR]

Context: Osteoarthritis (OA) is a chronic joint disease that can eventually lead to degeneration, fibrosis, fractures, and defects of the articular cartilage. Long non-coding RNA (lncRNA) is a key substance in many processes, such as epigenetic regulation and cell-cycle and cell-differentiation modulation, and its relationship with OA has been repeatedly verified.Objective: The study intended to clarify the influence of lncRNA nuclear enriched abundant transcript 1 (NEAT1), lncRNA NEAT1, on lipopolysaccharide (LPS)-induced OA chondrocytes through sponge adsorption of microRNA-378 (miR-378) and to provide novel insights into future diagnosis and treatment of OA.Design: The research team performed an animal study.Setting: The study took place in the Department of Rehabilitation Medicine at Linyi People's Hospital in Linyi, Shangdong, China.Animals: The study's animals were 10 Sprague Dawley (SD) rats, 3-5 days old and 10-15 g in weight, of the specific-pathogen-free (SPF) grade.Intervention: The rat chondrocytes for the positive control group (the model group) were treated with 500 ng/mL of LPS to induce OA. Chondrocytes treated with the same amount of normal saline were used as the negative control group. The chondrocytes of the LPS-induced rats were into six groups: (1) a positive control group transfected with NEAT1-interfering RNA, the sh-NEAT1 group; (2) a negative control group not transfected with NEAT1-interfering RNA, the NEAT1 empty vector (NC-NEAT1) group; (3) an intervention group co-transfected with NEAT1 interfering RNA and the miR-378 inhibitor sequence (Inh-miR-378 the sh-NEAT1+ Inh-miR-378 group; (4) a negative control group transfected with NEAT1 interfering RNA but not transfected with the miR-378 inhibitor sequence, the sh-NEAT1+ miR-378 negative control (NC-miR-378) group; (5) a negative control group transfected with the miR-378 inhibitor sequence but not transfected with NEAT1 interfering RNA, the NEAT1 empty vector (NC-NEAT1) + Inh-miR-378 group; (6) a negative control group not transfected with either NEAT1 interfering RNA or the miR-378 inhibitor sequence, the NC-NEAT1 + NC-miR-378 group.Outcome Measures: An OA-chondrocyte model was induced by LPS and measurements of NEAT1 and miR-378 expression were made by real-time quantitative reverse transcription (qRT)- polymerase chain reaction (PCR). Then, small NEAT1-interfering RNA (sh-NEAT1), empty vector NEAT1 (NC-NEAT1), inhibitor-sequence-miR-378 (Inh-miR-378), and negative-control-miR-378 (NC-miR-378) were transfected into cells, and cell viability and apoptosis rate were measured. Finally, the study verified the relationship between NEAT1 and miR-378.Results: Compared to the control group, NEAT1 was significantly elevated in the model group, and its miR-378 was significantly decreased. Silencing NEAT1 can enhance OA-chondrocyte activity and decrease apoptosis. When NEAT1 and miR-378 were inhibited together, as shown fort the NC-NEAT1 + NC-miR-378 group, NEAT1 expression, as well as the multiplication and apoptosis ability of the OA-model cells, were the same as those of cells transfected with an empty vector, the NC-NEAT1 group. Also, the NEAT1 + NC-miR-378 group's cell activity was lower than that of the sh-NEAT1+NC-miR-378 group but higher than that of the NC-NEAT1 + Inh-miR-378 group. Finally, higher fluorescence activity occurred for NEAT1-mutant type (MUT) transfected with Inh-miR-378.Conclusions: NEAT1, which is highly expressed in OA, mediates LPS-induced OA-chondrocyte activity through sponge adsorption of miR-378. [ABSTRACT FROM AUTHOR]

Cognitive impairment (CI) is one of the major clinical features of many neurodegenerative diseases. It can be aging-related or even appear in non-central nerve system (CNS) diseases. CI has a wide spectrum that ranges from the cognitive complaint with normal screening tests to mild CI and, at its end, dementia. Ginsenosides, agents extracted from a key Chinese herbal medicine (ginseng), show great promise as a new therapeutic option for treating CI. This review covered both clinical trials and preclinical studies to summarize the possible mechanisms of how ginsenosides affect CI in different diseases. It shows that ginsenosides can modulate signaling pathways associated with oxidative stress, apoptosis, inflammation, synaptic plasticity, and neurogenesis. The involved signaling pathways mainly include the PI3K/Akt, CREB/BDNF, Keap1/Nrf2 signaling, and NF-κB/NLRP3 inflammasome pathways. We hope to provide a theoretical basis for the treatment of CI for related diseases by ginsenosides. [ABSTRACT FROM AUTHOR]

High-fat diet (HFD) is the primary cause of metabolic syndrome associated chronic kidney disease. This study aimed to investigate the pathogenesis of HFD-induced kidney injury. ApoE−/− mice were fed with HFD and kidney damage was examined. In addition, HK-2 human renal proximal tubular epithelial cells were treated with fructose and receptor of advanced glycation end products (RAGE) siRNA. The results showed that HFD increased body weight, blood glucose and insulin resistance in ApoE−/− mice. The kidney damage was associated with increased oxidative stress and strong staining of RAGE and NF-κB in kidney tissues, as well as high serum levels of TNF-α, IL-1β and IL-6. Western-blot analysis showed that HFD increased the levels of RAGE, p-IκBα, p-NF-κB, bax, caspase-3 and caspase-9 but decreased the levels of Bcl-2 in kidney tissues. In HK-2 cells, fructose promoted the secretion of TNF-α, IL-1β and IL-6 and increased the levels of RAGE, p-IκBα, p-NF-κB, bax, caspase-3 and caspase-9, but decreased the levels of Bcl-2. Moreover, RAGE siRNA could attenuate increased levels of p-IκBα, p-NF-κB, bax, caspase-3 and caspase-9 while restore decreased levels of Bcl-2 in fructose-treated HK-2 cells. In conclusion, HFD causes kidney injury by promoting oxidative stress, inflammation and apoptosis possibly through the activation of RAGE/NF-κB pathway. [ABSTRACT FROM AUTHOR]

• Designed and developed the sorafenib-surface decorated iRED nanoparticles. • Sora-NPs and iRED@Sora-NPs shows excellent in vitro cytotoxicity against hepatocellular cancer cells. • The cancer cells morphological examinations were investigated by various biochemical analyses. • Further, the cell death mechanisms were explored by flowcytometry analysis. Hepatocellular carcinoma (HCC) is one of the most common causes of cancer-related mortality worldwide. Sorafenib acts as a potential anticancer agent, but it shows less aqueous solubility, so its clinical application is limited. In this present study, we developed Sora-surface decorated iRGD (small cyclic peptide motif (CRGDK/RGPD/EC)) nanoparticles (labelled Sora-NPs and iRGD@Sora-NPs, respectively) to enhance its aqueous formulation and improve the anticancer activity of Sora. The synthesized Sora-NPs and iRGD@Sora-NPs confirmed by various spectroscopies and electroscopic techniques. Sora-NPs and iRGD@Sora-NPs dramatically suppressed the proliferation of hepatocellular carcinoma cells (BEL-7402 and Huh-7) and showed low toxicity in MTT assays. Compared with free Sora and Sora-NPs, iRGD@Sora-NPs significantly induces the apoptosis in hepatocellular carcinoma cells. The morphological changes were evaluated via various biochemical staining techniques (AO-EB and nuclear staining). Further, the apoptosis mode of hepatocellular carcinoma cell death was confirmed via flow cytometry analysis. Furthermore, the Sora-NPs and iRGD@Sora-NPs promoted apoptotic manner of cell death by G2/M phase arrest. In this present study explained that iRGD@Sora-NPs as a safe and hopeful strategy for chemotherapeutics of hepatocellular carcinoma therapy and deserve further clinical evaluations. [ABSTRACT FROM AUTHOR]

Infection with the roundworm Angiostrongylus cantonensis is the main cause of eosinophilic meningitis worldwide. The underlying molecular basis of the various pathological outcomes in permissive and non-permissive hosts infected with A. cantonensis remains poorly defined. In the present study, the histology of neurological disorders in the central nervous system (CNS) of infected rats was assessed by using hematoxylin and eosin staining. Quantitative reverse transcription polymerase chain reaction (RT-qPCR), western blot and immunofluorescence (IF) were used in evolutions of the transcription and translation levels of the apoptosis-, necroptosis-, autophagy-, and pyroptosis-related genes. The distribution of apoptotic and necroptotic cells in the rat hippocampus and parenchyma was further detected using flow cytometry, and the features of the ultrastructure of the cells were examined by transmission electron microscopy (TEM). The inflammatory response upon CNS infection with A. cantonensis evolved, as characterized by the accumulation of a small number of inflammatory cells under the thickened meninges, which peaked at 21 days post-infection (dpi) and returned to normal by 35 dpi. The transcription levels and translation of caspase-2, caspase-8, RIP1 and RIP3 increased significantly at 21 and 28 dpi but decreased sharply at 35 dpi compared to those in the normal control group. However, the changes in the expression of caspase-1, caspase-3, caspase-11, Beclin-1 and LC3B were not obvious, suggesting that apoptosis and necroptosis but not autophagy or pyroptosis occurred in the brains of infected animals at 21 and 28 dpi. The results of RT-qPCR, western blot analysis, IF, flow cytometry and TEM further illustrated that necroptosis and caspase-2-mediated apoptosis occurred in astrocytes and neurons but not in microglia in the parenchyma and hippocampus of infected animals. This study provides the first evidence that neuronal and astrocytic necroptosis and caspase-2 -mediated apoptosis are induced by A. cantonensis infection in the parenchymal and hippocampal regions of rats at 21 and 28 dpi but these processes are negligible at 35 dpi. These findings enhance our understanding of the pathogenesis of A. cantonensis infection and provide new insights into therapeutic approaches targeting the occurrence of cell death in astrocytes and neurons in infected patients. [ABSTRACT FROM AUTHOR]

Osteoarthritis (OA) is a progressive joint disorder that is primarily characterized by the degeneration and destruction of the articular cartilage. Cartilage matrix degradation, production of proinflammatory mediators, chondrocyte apoptosis and activation of macrophages in the synovial are involved in OA pathogenesis. Current non-surgical therapies for OA mainly aim at relieving pain but can barely alleviate the progression of OA. Quercetin, a naturally occurring flavonoid has shown potent anti-inflammatory effects, however, its effects and underlying mechanisms on OA have seldom been systematically illuminated. In this study, we explored the protective effects of quercetin on repairing OA-induced cartilage injuries and its possible mechanisms. In vitro , quercetin remarkably suppressed the expression of matrix degrading proteases and inflammatory mediators, meantime promoted the production of cartilage anabolic factors in interleukin-1β-induced (IL-1β) rat chondrocytes. In addition, quercetin exhibited anti-apoptotic effects by decreasing intracellular reactive oxygen species (ROS), restoring mitochondrial membrane potential (MMP) and inhibiting the Caspase-3 pathway in apoptotic rat chondrocytes. Moreover, quercetin induced M2 polarization of macrophages and upregulated the expression of transforming growth factor β (TGF-β) and insulin-like growth factor (IGF), which in turn created a pro-chondrogenic microenvironment for chondrocytes and promoted the synthesis of glycosaminoglycan (GAG) in chondrocytes. In vivo, intra-articular injection of quercetin alleviated the degradation of the cartilage and the apoptosis of chondrocytes in a rat OA model. Moreover, the expression of TGF-β1 and TGF-β2 in the synovial fluid and the ratio of M2 macrophages in the synovial membrane were elevated. In summary, our study proves that quercetin exerts chondroprotective effects by inhibiting inflammation and apoptosis of chondrocytes, modulating synovial macrophages polarization to M2 macrophages and creating a pro-chondrogenic environment for chondrocytes to enhance cartilage repair under OA environment. It is suggested that quercetin may serve as a potential drug for OA treatment. Image 1 • Quercetin exerted anti-inflammatory effects on IL-1β-induced rat chondrocytes by inhibiting the Akt/NF-κB signaling pathway. • Quercetin attenuated chondrocytes apoptosis by inhibiting the Caspase-3 pathway via decreasing overproduction of the intracellular ROS and restoring mitochondrial membrane potential. • Quercetin exerted immunomodulatory effect in modulating synovial macrophages polarization to M2 macrophages which forms a pro-chondrogenic microenvironment for chondrocytes and promotes cartilage repair. • An intra-articular injection of quercetin could attenuate OA in a rat OA model. [ABSTRACT FROM AUTHOR]

Pancreatic ductal adenocarcinoma (PDAC) is expected to be the second leading cause of cancer mortality by 2030. PDAC remains resistant to the majority of systemic chemotherapies. In this paper, we explore if epigenetic sensitization can improve chemotherapy response in PDAC. Multiple PDAC cell lines were tested with serial concentrations of the epigenetic modulators 5-azacitidine (Aza) and guadecitabine (SGI-110). Guadecitabine was effective at inhibiting the expression of DNA Methyltransferase 1 (DNMT1) and in decreasing cell viability at nanomolar concentrations. We also report that guadecitabine has increased efficacy following a delay period or as we reference, a ‘rest period’. Sensitization with guadecitabine improved response to the chemotherapeutic agent–Irinotecan- as measured by decreased cell viability and accompanied by an increase in caspase activity. Additional studies are needed to understand the mechanism of action. [ABSTRACT FROM AUTHOR]

Aminoglycoside antibiotics such as gentamicin could cause ototoxicity in mammalians, by inducing oxidative stress and apoptosis in sensory hair cells of the cochlea. Sodium hydrosulfide (NaHS) is reported to alleviate oxidative stress and apoptosis, but its role in protecting aminoglycoside-induced hearing loss is unclear. In this study, we investigated the anti-oxidant and anti-apoptosis effect of NaHS in in vitro cultured House Ear Institute-Organ of Corti 1 (HEI-OC1) cells and isolated mouse cochlea. Results from cultured HEI-OC1 cells and cochlea consistently indicated that NaHS exhibited protective effects from gentamicin-induced ototoxicity, evident by maintained cell viability, hair cell number and cochlear morphology, reduced reactive oxygen species production and mitochondrial depolarization, as well as apoptosis activation of the intrinsic pathway. Moreover, in the isolated cochlear culture, NaHS was also demonstrated to protect the explant from gentamicin-induced mechanotransduction loss. Our study using multiple in vitro models revealed for the first time, the potential of NaHS as a therapeutic agent in protecting against aminoglycoside-induced hearing loss. [ABSTRACT FROM AUTHOR]

Abstract: Ethnopharmacological relevance: Oxymatrine is extracted from the traditional Chinese herb Sophora flavescens Ait, possesses anti-inflammatory, anti-oxidative and anti-apoptotic properties, and has been used for the treatment of chronic viral hepatitis and many other diseases. Aims of the study: This study aimed to investigate the effects of oxymatrine on inflammatory response mediated by Toll-like receptor4 (TLR4) and nuclear factor kappa-B (NF-κB), oxidative injury induced by 12/15 lipoxygenase (12/15-LOX), phosphorylated p38 mitogen activated protein kinase (phosphor-p38 MAPK) and cytosolic phospholipase A2 (cPLA2), and neuronal cell apoptosis in rat brain with intracerebral hemorrhage (ICH). Materials and methods: Wistar rats were treated intraperitoneally with 60 or 120mg/kg of oxymatrine daily for 5 days following ICH. The rats were sacrificed at hour 2, 6, 12, 24, 48, 72, and 120 after ICH. The gene expressions of TLR-4 and NF-κB, the levels of TNF-alpha, interleukin-1beta, interleukin-6, 12/15-LOX, phospho-p38 MAPK and cPLA2, and the number of apoptotic neuronal cells in rat brain were determined. Results: Oxymatrine at 120mg/kg significantly suppressed gene expressions of TLR-4 and NF-κB, decreased levels of TNF-alpha, interleukin-1beta and interleukin-6, inhibited synthesis of 12/15-LOX, phospho-p38 MAPK and cPLA2 protein, and mitigated apoptotic neuronal changes following ICH in rat. Conclusion: Oxymatrine at 120mg/kg following ICH inhibits inflammatory responses, oxidative injury, and neuronal cell apoptosis in rats. [Copyright &y& Elsevier]

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. [ABSTRACT FROM AUTHOR]

A response from the authors of the article "Codon 104 variation of p53 gene provides adaptive apoptotic responses to extreme environments in mammals of the Tibet plateau" in the 2013 issue is presented.

Icariin (ICA), an active ingredient found in Epimedium , possesses antioxidant and anti-inflammatory properties and has garnered widespread attention in recent years. This study investigated the protective effects of ICA against cadmium (Cd)-induced kidney injury in rats. Healthy male specific pathogen-free Sprague–Dawley rats were randomly divided into a control group, Cd group, a low-dose ICA group, a middle-dose ICA group, and a high-dose ICA group using a random number table. Tissue and blood samples were analyzed for renal function markers, histopathology, and gene expression. We found that ICA intervention ameliorates Cd-induced nephrotoxicity by enhancing glomerular filtration, mitigating renal tubular epithelial cell damage, reducing cellular degeneration and edema, and decreasing oxidative stress. ICA demonstrated anti-apoptotic activity through the regulation of pro- and anti-apoptotic gene transcription and by inhibiting apoptosis, thus protecting the kidneys. ICA also exhibited anti-inflammatory effects by reducing the transcription of Cd-induced pro-inflammatory genes, inhibiting nucleotide oligomerization domain-like receptor pyrin domain-containing 3 (NLRP3) inflammasome formation, and preventing pyroptosis. ICA potentially regulated the Toll-like receptor 4/ P2rx7 /nuclear factor kappa B signaling pathway, which modulated the activation of the NLRP3 inflammasome and contributed to its anti-inflammatory action. ICA reduced Cd-induced renal injury in rats, likely through a mechanism involving antioxidant, anti-apoptotic, and anti-inflammatory effects. • Icariin can alleviate renal injury in rats induced by cadmium. • Icariin exerts its effects by anti-inflammatory, antioxidant, and inhibiting apoptosis and pyroptosis. • The anti-inflammatory and antioxidant effects of icariin may be exerted through the pathway P2rx7/TLR4/NF-κB/NLRP3. [ABSTRACT FROM AUTHOR]

Background The leaves of the Khat shrub contain the major alkaloid compounds (cathinone) and cathine. These compounds can induce apoptosis and exacerbate the acute cerebral infarction, but the underlying mechanism is poorly understood. The present study aimed to investigate the effects of Khat treatment on the expression and cellular localization of Smac/Diablo (second mitochondrial activator of caspase) in the cortex of ischemic rat brain. Methods Adult male Sprague-Dawley rats were administered Khat (3 g/kg) twice daily for 4 weeks, then underwent left middle cerebral artery occlusion (MCAO) for 2 h and reperfusion for 3, 6 and 12 h, respectively. The infarction area was evaluated with 2,3,5-triphenyltetrazolium chloride (TTC) staining. Apoptosis was assessed by terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL). Smac/DIABLO expression levels in experimental and control groups were examined by immunohistochemistry and Western blot. Results Khat significantly exacerbates the neurological damage compared with control ( p < 0.05). In addition, Khat-treatment significantly increased the number of TUNEL-positive cells 3 h ( p < 0.01) and 12 h ( p < 0.05) after reperfusion. Ischemia/reperfusion enhanced the release of Smac/DIABLO from the mitochondria to the cytosol after reperfusion. Such release of Smac/DIABLO was elevated after the rats were pretreated with Khat. Conclusions Our results indicate that Khat treatment can induce apoptosis through enhancing the release of Smac/DIABLO from the mitochondria to the cytosol after transient focal ischemia which may be an important mechanism of Khat neurotoxicity. Therefore, Khat chewing should be avoided by people who have cerebrovascular problems. [ABSTRACT FROM AUTHOR]

Abstract: The aim of this study was to investigate the changes of expression of Fas-associated proteins and its cellular localization in the peri-infarct region following transient focal cerebral ischemia. Adult male Sprague–Dawley rats underwent right middle cerebral artery occlusion (MCAo) for 2 h and reperfusion for 1, 3, 6, 12 and 24 h. The expression of Fas-associated death domain protein (FADD), Fas-associated phosphatase-1 (FAP-1) caspase-8 and death-associated protein (Daxx), the pro-apoptotic genes, were examined by methods of RT-PCR, immunohistochemistry and Western blot. The results showed that the expression levels of mRNA and protein for FADD and caspase-8 increased significantly at 1–3 h after reperfusion, peaked at 12 h, then declined markedly at 24 h. The time course change of FAP-1 was consistent with that of FADD. The expression level of mRNA and protein for death-associated protein (Daxx) increased significantly at 3 h after reperfusion and persisted for 24 h at a high level. Immunofluorescence double-staining laser scanning showed that the immunoreactivity of FADD was localized in cytoplasm, and Daxx immunoreactivity was translocated from nucleus to cytoplasm at 3 h after reperfusion. The TUNEL-positive cells could be found in peri-infarct region at 3 h and increased with time after reperfusion. Our findings suggest a possible association between expression of FADD, caspase-8, Daxx and FAP-1 genes and apoptosis following ischemia. [Copyright &y& Elsevier]

Post-stroke depression (PSD) is a condition characterized by a profoundly depressed mood and diminished interest following a stroke. Di-Huang-Yin-Zi (DHYZ), a traditional Chinese herbal preparation, gained widespread use and shown favorable outcomes in PSD treatment. However, the combination mechanisms of this formula for PSD remain unclear. This study aimed to assess the therapeutic effects of DHYZ extract on rats with PSD and further investigate its underlying mechanism. The active components of DHYZ extract were quantified by the high-performance liquid chromatography-ultraviolet (HPLC-UV). Neurofunctional and depressive-like behavioral tests were performed to assess the neuroprotective effects of DHYZ extract after establishing a PSD rat model. Brain tissue damage volume was assessed using TTC staining, and transmission electron microscopy (TEM) was used to observe the ultrastructural changes of neurons in the prefrontal cortex region, while cell apoptosis was evaluated through TUNEL assay in the prefrontal cortex region of the brain. The effect of DHYZ on ferroptosis markers includes Fe2+, malondialdehyde (MDA), reactive oxygen species (ROS), and glutathione (GSH) were determined in the brain tissue. Moreover, the expression of key proteins or mRNA levels of the P53/SLC7A11 signaling pathway were detected using Western blot or PCR, respectively. Additionally, P53-constructed overexpression vectors were injected to increase the level of P53. In this series of experiments, ferroptosis markers and key factors of the P53/SLC7A11 signaling pathway were evaluated. DHYZ extract could increase the sucrose preference of SPT, but decrease the duration of immobility of FST and cortical infarct volume of PSD rats. A TEM study revealed that DHYZ extract improved synaptic ultrastructure in the cortical region of PSD rats. Furthermore, DHYZ treatment effectively decreased ROS and MDA levels, inhibiting the expression of ferroptosis-related markers such as Fe2+, SLC7A11, and GPX4. Additionally, DHYZ promoted the ubiquitination of P53, thus inhibiting its degradation. Notably, AAV-mediated overexpression of P53 reversed the effects of DHYZ on neuroprotection and ferroptosis inhibition in PSD rats. Our results demonstrated that DHYZ extract alleviates the symptoms and enhances the functional capability of PSD rats, mainly by suppressing the ferroptosis through the P53/SLC7A11/GPX4 pathway. [Display omitted] • DHYZ improved neurological deficits, alleviating depression in PSD rats. • DHYZ reduces apoptosis and prefrontal cortex ferroptosis in PSD rats. • DHYZ regulates P53/SLC7A11 pathway, inhibiting ferroptosis in PSD rats. • P53 overexpression reverses DHYZ's effects on brain damage and depression. [ABSTRACT FROM AUTHOR]

• WNT4 could reduce granulosa cell apoptosis and improve ovarian reserve in endometriosis. • The modulation effect of WNT4 in endometriosis counts on macrophage polarization. • M-CSF is the mediator of macrophage polarization in WNT4 treated endometriosis. • M-CSF was secreted by granulosa cell in endometriosis after WNT4 treatment. WNT4 gene polymorphism are common in endometriosis and may functionally link estrogen and estrogen receptor signaling. Previous study confirmed estrogen and estrogen receptor signaling recruit macrophage to promote the pathogenesis of endometriosis. To investigate the effect of WNT4 in endometriosis involved in macrophage polarization and whether WNT4 could reduce the apoptosis of granulosa cells. An observational study consisting of 8 cases of women with endometriosis (diagnosed by surgery and histology) and 22 mice of endometriosis animal model was conducted. Granulosa cells were isolated from 16 patients with endometriosis and co-cultured with macrophage under WNT4 treatment using TUNEL assay, quantitative reverse transcription PCR, flow cytometry and ELISA analysis. 22 mice of endometriosis animal model confirmed the WNT4 treatment effects using histology and immunohistochemistry, Western blot and flow cytometry. We observed that the apoptotic proportion of granulosa cells was significantly decreased and M2 macrophage was significantly increased after WNT4 treatment during the granulosa cell and macrophage co-culture system. To reveal the underlying mechanism for this, we conducted a series of experiments and found that high expression of granulosa cell M-CSF led to the M2 polarization of macrophages. The animal model also suggested that the anti-apoptotic effect of WNT4 on granulosa cells were conducted by the M2 polarized macrophage. WNT4 could reduce granulosa cell apoptosis and improve ovarian reserve by promoting macrophage polarization in endometriosis. M-CSF secreted by granulosa cell after WNT4 treatment was the main mediator of macrophage polarization. [ABSTRACT FROM AUTHOR]

Breviscapine, a standardized Chinese herbal medicine extracted from Erigeron breviscapine, has been widely used to treat cerebrovascular diseases. However, there are no reports about the neuroprotective effects and underlying molecular mechanisms of breviscapine on traumatic brain injury (TBI). Therefore, this study was aimed to investigate the effects of breviscapine on rats with TBI insult and illuminate the underlying mechanism. We created a traumatic brain-injured model with breviscapine lateral ventricle injection and evaluated the expressional changes of glycogen synthase kinase 3 beta (GSK3β) as well as the GSK3β-involved signaling pathways including apoptosis and axonal growth. At 7, 14, 21 days after injection, we found a great reduction of motor disability in TBI rats following breviscapine treatment, which was accompanied with a notably increased expression of phospho-Ser9-GSK3β (p-Ser9-GSK3β) and decreased expression of phosphor-Try216-GSK3β (p-Try216-GSK3β) at 7 days after injection. Concomitantly, an enhanced expression of synaptic marker synaptophysin (SYP) together with a weakened expression of pro-apoptotic caspase3 was observed after TBI rats were treated with breviscapine. Terminal deoxynucleotidyl transferase deoxy-UTP-nick end labeling (TUNEL) immunohistochemical assay and SYP immunofluorescence staining also confirmed the result. This study suggests that breviscapine inhibits the GSK3β signaling pathway to promote neurobehavioral function following neurotrauma. These events may provide a new insight into the mechanism of breviscapine treating brain injury. [ABSTRACT FROM AUTHOR]