Search

Tomato mottle virus (ToMoV) is a single-stranded DNA (ssDNA) begomovirus transmitted to solanaceous crops by the whitefly species complex (Bemisia tabaci), causing stunted growth, leaf mottling, and reduced yield. Using a genetic repertoire of seven genes, ToMoV pathogenesis includes the manipulation of multiple plant biological processes to circumvent antiviral defenses. To further understand the effects of whitefly feeding and whitefly-transmitted ToMoV infection on tomato plants (Solanum lycopersicum &lsquo, Florida Lanai&rsquo, ), we generated comprehensive protein profiles of leaves subjected to feeding by either viruliferous whiteflies harboring ToMoV, or non-viruliferous whiteflies, or a no-feeding control. The effects of whitefly feeding and ToMoV infection were measured both locally and systemically by sampling either a mature leaf directly from the site of clip-cage confined whitefly feeding, or from a newly formed leaf 10 days post feeding (dpf). At 3 dpf, tomato&rsquo, s response to ToMoV included proteins associated with translation initiation and elongation as well as plasmodesmata dynamics. In contrast, systemic impacts of ToMoV on younger leaves 10 dpf were more pronounced and included a virus-specific change in plant proteins associated with mRNA maturation and export, RNA-dependent DNA methylation, and other antiviral plant processes. Our analysis supports previous findings and provides novel insight into tomato&rsquo, s local and systemic response to whitefly feeding and ToMoV infection.

Tomato mottle virus (ToMoV) is a single-stranded DNA (ssDNA) begomovirus transmitted to solanaceous crops by the whitefly species complex (Bemisia tabaci), causing stunted growth, leaf mottling, and reduced yield. Using a genetic repertoire of seven genes, ToMoV pathogenesis includes the manipulation of multiple plant biological processes to circumvent antiviral defenses. To further understand the effects of whitefly feeding and whitefly-transmitted ToMoV infection on tomato plants (Solanum lycopersicum ‘Florida Lanai’), we generated comprehensive protein profiles of leaves subjected to feeding by either viruliferous whiteflies harboring ToMoV, or non-viruliferous whiteflies, or a no-feeding control. The effects of whitefly feeding and ToMoV infection were measured both locally and systemically by sampling either a mature leaf directly from the site of clip-cage confined whitefly feeding, or from a newly formed leaf 10 days post feeding (dpf). At 3 dpf, tomato’s response to ToMoV included proteins associated with translation initiation and elongation as well as plasmodesmata dynamics. In contrast, systemic impacts of ToMoV on younger leaves 10 dpf were more pronounced and included a virus-specific change in plant proteins associated with mRNA maturation and export, RNA-dependent DNA methylation, and other antiviral plant processes. Our analysis supports previous findings and provides novel insight into tomato’s local and systemic response to whitefly feeding and ToMoV infection.

The complete genome sequence of a bipartite begomovirus found in a Sida sp. plant growing in Bradenton, FL, was determined. The virus is a new strain of Sida golden mosaic Buckup virus (family Geminiviridae, genus Begomovirus). This is the first report of this virus in the United States and the first report outside Jamaica.

The location of tomato mottle virus (ToMoV) and cabbage leaf curl virus (CabLCV) (Geminiviridae, genus Begomovirus) in the whitefly vector Bemisia tabaci B-biotype (Homoptera: Aleyrodidae) was elucidated using a novel technique incorporating indirect immunofluorescent labeling in freshly dissected whiteflies. Begomoviruses were visualized in the whitefly by indirect-fluorescent-microscopy. Polyclonal and monoclonal primary antibodies were used to successfully detect both ToMoV and CabLCV. Both begomoviruses were located in the anterior region of the midgut and filter-chamber of adult whiteflies, with ToMoV detected in the salivary glands. CabLCV was detected at a greater frequency than ToMoV, with a positive detection of 16% (89 out of 560) for CabLCV and 3% (25 out of 840) for ToMoV. Possible sites involved in geminivirus transport from the gut lumen of whiteflies into the hemocoel were located in the filter-chamber and anterior portion of the midgut. The location of these begomoviruses suggests a possible scenario of virus movement through the whitefly, which is discussed.

Polyclonal rabbit antisera were produced to the coat protein of Bean golden mosaic virus Brazil isolate (BGMV), Cabbage leaf curl virus (CabLCV), Tomato yellow leaf curl virus (TYLCV), and Tomato mottle virus (ToMoV), all expressed in Escherichia coli by the pETh expression vector. The expressed coat protein of each virus was purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis for use as an immunogen. The antisera to BGMV, CabLCV, TYLCV, and ToMoV reacted in indirect (plate-trapping) enzyme-linked immunosorbent assay (ELISA) with extracts from begomovirus-infected tissue. The antisera to BGMV, CabLCV, TYLCV, and ToMoV also reacted specifically with the test begomovirus antigens in leaf imprint blots and Western blots. The CabLCV and TYLCV antisera were used to detect Bean golden yellow mosaic virus antigens by immunogold labeling of thin sections of infected bean tissues. In tissue blot immunoassays, the TYLCV antiserum reacted well with TYLCV antigens but not with ToMoV antigens, while CabLCV antiserum reacted well with ToMoV antigens and weakly with TYLCV antigens. The results indicate that polyclonal antisera prepared to expressed begomovirus coat proteins were useful for the detection of begomoviruses in an array of assays.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence ( Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

Virus-like symptoms of leaf deformation and rugosity, especially of younger leaves, and a mild mosaic were observed on fresh market common (green) bean (Phaseolus vulgaris L.) plants in Hendry County in southwest Florida in December of 2007 and again in February of 2008. All bean fields were adjacent to watermelon fields in which Cucurbit leaf crumple virus (CuLCrV), Squash vein yellowing virus (SqVYV), and Papaya ringspot virus type W (PRSV-W) infections had previously been confirmed (fall of 2007) by PCR, reverse transcription (RT)-PCR, and/or ELISA. Whiteflies, Bemisia tabaci, were observed on both bean and watermelon plants in December and February. Fifteen samples (eleven with symptoms) were collected in December and two (both with symptoms) in February. Initial ELISA assays using commercially available antisera for potyviruses or Cucumber mosaic virus (Agdia, Elkhart, IN) were negative. Total nucleic acids were extracted and used for PCR testing. All samples tested negative by RT-PCR using specific primers for SqVYV, PRSV-W, and Cucurbit yellow stunting disorder virus, and degenerate primers for potyviruses. Ten of fifteen December samples (ten of eleven symptomatic samples) and both February samples yielded PCR products of the expected size with the degenerate begomovirus primers, PAR1c496/PAL1v1978, which amplify a portion of the begomovirus A component (3). PCR products from three December and both February samples were cloned and sequenced. The 1,159-nt PCR products shared 99% identity with each other and 96% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF256200 and AF224760, respectively). Additional degenerate begomovirus primers PBL1v2040/PCRc154, which amplify a 381-nt portion of the hypervariable region of the begomovirus B component (3), and AC1048/AV494, which amplify a 533-nt portion of a conserved region of the coat protein gene (4), were used to confirm the identity of CuLCrV in the three December samples. The PBL1v2040/PCRc154 PCR products shared 98 to 99% identity with each other and 94 to 95% identity with the corresponding region of B component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF327559 and AF224761, respectively), whereas the AC1048/AV494 PCR products shared 99% identity with each other and 97% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates. Nucleic acid dot-blot hybridization assays of sap from homogenized leaves of the three December samples (from which the PCR product clones were obtained) with a digoxigenin-labeled CuLCrV cDNA probe also confirmed the presence of CuLCrV. Although CuLCrV has been reported to experimentally infect common bean and tobacco (2), to our knowledge, this is the first report of CuLCrV infecting any noncucurbit host in Florida. This finding suggests that CuLCrV may be more widely distributed than previously known in Florida (1) and that common bean (and potentially other legumes) are potential reservoirs for CuLCrV. References: (1) F. Akad et al. Plant Dis. 92:648, 2008. (2) J. K. Brown et al. Phytopathology 92:734, 2002. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Bemisia tabaci has had a colorful nomenclatural past and is now recognized as a species complex. This new species framework has added many new areas of research including adding new insight into the virus transmission specificity of the species in the B. tabaci species complex. There is a wide disparity in what is known about the transmission of plant viruses by different members of the B. tabaci species complex. In this paper, we have synthesized the transmission specificities of the plant viruses transmitted by species belonging to the complex. There are five genera of plant viruses with members that are transmitted by species of the B. tabaci species complex. The transmission of viruses belonging to two of these, Begomovirus and Crinivirus, are well studied and much is known in regards to the relationship between species and transmission and etiology. This is in contrast to viruses of the genera, Torradovirus and Carlavirus, for which very little is known inregards to their transmission. This is the first attempt to integrate viral data within the new B. tabaci species complex framework. It is clear that matching historical transmission data with the current species framework is difficult due to the lack of awareness of the underlying genetic diversity within B. tabaci. We encourage all researchers to determine which species of B. tabaci they are using to facilitate association of phenotypic traits with particular members of the complex. © 2014 Society of Chemical Industry

Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640–750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (, This project is funded by grants from the National Science Foundation’s Systematic Biology and Biodiversity Inventories Program (DEB-1025915 to MB, DEB-1025901 to JEP). Authors would like to thank all the collaborators who provided whitefly specimens, including Jorge Gonzales (Guatemala), Moshe Lapidot (Israel), Bill Wintermantel (USA), James D. McCright (USA), Eric Portales (Guatemala), Esvin Salguero (Guatemala), Sakata Seed of Guatemala, and Sakata Seed of South America, We acknowledge support by the CSIC Open Access Publication Initiative through its Unit of Information Resources for Research (URICI).

A begomovirus causing mottling and leaf deformation in tomato from the State of Mérida was cloned and sequenced. The virus has a bipartite genome comprised of a DNA-A (2,572 nucleotides) and a DNA-B (2,543 nucleotides) with a genome organization typical of New World begomoviruses. Both components share a common region of 115 nucleotides with 98 % sequence identity. Phylogenetic analysis indicated that while no virus sequences were closely related, the A component was distantly related to those of two other tomato-infecting viruses, tomato leaf deformation virus and Merremia mosaic virus; and the DNA-B, to those of pepper huasteco yellow vein virus and Rhynchosia golden mosaic Yucatan virus. The DNA-A and DNA-B sequences were submitted to GenBank (accession no. AY508993 and AY508994, respectively) and later accepted by the International Committee on Taxonomy of Viruses as the genome of a member of a unique virus species with the name Tomato yellow margin leaf curl virus (TYMLCV). Tomato (Solanum lycopersicum L. 'Fl. Lanai') plants inoculated with cloned TYMLCV DNA-A and DNA-B became systemically infected and showed chlorotic margins and leaf curling. The distribution of TYMLCV in tomato-producing states in Venezuela was determined by nucleic acid spot hybridization analysis of 334 tomato leaf samples collected from ten states using a TYMLCV-specific probe and confirmed by PCR and sequencing of the PCR fragment. TYMLCV was detected in samples from the states of Aragua, Guárico, and Mérida, suggesting that TYMLCV is widely distributed in Venezuela.

A new system for inoculation of plants with begomoviral DNA without cloning or the use insect vectors is described. Total DNA extracted from begomovirus-infected plants was amplified by rolling circle amplification (RCA) using the bacteriophage phi29 DNA polymerase, and inoculated to plants by particle bombardment. Infection rates of up to 100% were obtained using this technique. This technique successfully inoculated all the begomoviruses evaluated: five bipartite (Bean golden yellow mosaic virus, Cabbage leaf curl virus, Squash leaf curl virus, Tomato mottle virus, Watermelon chlorotic stunt virus) as well as one monopartite (Tomato yellow leaf curl virus). The success of the technique was not dependent upon plant species. Four species from three plant families [Phaseolus vulgaris (bean), Solanum lycopersicum (tomato), Cucurbita pepo (squash), and Citrullus lanatus (watermelon)], could all be inoculated by this technique. The success of the method was not dependent upon either the type or the age of the source of virus. Infectious DNA was obtained successfully from fresh, freeze-dried or desiccated plant material, from squashes of plant leaves on FTA cards, as well as from the insect vector. Plant material collected and dried as long as 25 years ago yielded infectious DNA by this method. In summary, this method can be used to obtain infectious DNA of single-stranded circular DNA viruses that can be activated for purposes of completing Koch's postulates, for preservation of pure virus cultures, and for many other applications where infectious DNA is required.

The impact of trademarked and commercial products on settling of adults of the sweetpotato whitefly, Bemisia tabaci (Gennadius), was studied in the laboratory. A no-choice bioassay using leaf disks of tomato, Solanum esculentum L., was developed to evaluate the impact of concentration series of products on settling of B. tabaci adults. The concentration of each product that would reduce settling by 50% (SC50) was estimated for each product using standard probit analyses, and the values were compared with that of Ultra-Fine Oil, a paraffinic oil product that is known to reduce settling of whitefly adults. Twenty-two trademarked products and 42 other products were evaluated in the laboratory bioassay. Based upon comparisons of fiducial limits of the respective SC50 values, Dawn detergent and E-RASE jojoba oil were the only trademarked products that were as effective as Ultra-Fine Oil in reducing settling of B. tabaci adults. Of the nontrademarked products, 25 were similar to Ultra-Fine Oil, although cedar, geranium, ginger, Hamlin (citrus), patchouli, olive and wintergreen oils, as well as citronellal and limonene, had ratios of respective SC50 values with that of Ultra-Fine Oil of approximately 1.5 or less. Combinations of limonene and citronellal with either olive oil or Ultra-Fine Oil were 15 and 30 times, respectively, more effective than Ultra-Fine Oil alone. Candidate products and combinations of products were further evaluated on tomato seedlings in no-choice screenhouse trials for effects on oviposition and on transmission of Tomato yellow leaf curl virus (family Geminiviridae, genus Begomovirus, TYLCV) by B. tabaci. Ultra-Fine Oil and olive oil reduced oviposition and transmission of TYLCV in the screenhouse trials. Ginger oil and limonene reduced oviposition in at least one screenhouse trial but did reduce transmission of TYLCV. The laboratory bioassay provided a rapid and relatively easy method to compare products for reducing settling of B. tabaci adults. Even though the reduced settling indicated in the laboratory bioassays was not always reflected in reduced oviposition or TYLCV transmission in the screenhouse trials, the bioassay was useful in rapidly identifying products that reduce settling and that could be investigated further.

Background Plant viruses in the genus Begomovirus, family Geminiviridae often cause substantial crop losses. These viruses have been emerging in many locations throughout the tropics and subtropics. Like many plant viruses, they are often not recognized by plant diagnostic clinics due in large part to the lack of rapid and cost effective assays. An isothermal amplification assay, Recombinase polymerase amplification (RPA), was evaluated for its ability to detect three begomoviruses and for its suitability for use in plant diagnostic clinics. Methods for DNA extraction and separation of amplicons from proteins used in the assay were modified and compared to RPA manufacturer’s protocols. The modified RPA assays were compared to PCR assays for sensitivity, use in downstream applications, cost, and speed. Results Recombinase polymerase amplification (RPA) assays for the detection of Bean golden yellow mosaic virus, Tomato mottle virus and Tomato yellow leaf curl virus (TYLCV) were specific, only amplifying the target viruses in three different host species. RPA was able to detect the target virus when the template was in a crude extract generated using a simple inexpensive extraction method, while PCR was not. Separation of RPA-generated amplicons from DNA-binding proteins could be accomplished by several methods, all of which were faster and less expensive than that recommended by the manufacturer. Use of these modifications resulted in an RPA assay that was faster than PCR but with a similar reagent cost. This modified RPA was the more cost effective assay when labor is added to the cost since RPA can be performed much faster than PCR. RPA had a sensitivity approximate to that of ELISA when crude extract was used as template. RPA-generated amplicons could be used in downstream applications (TA cloning, digestion with a restriction endonuclease, direct sequencing) similar to PCR but unlike some other isothermal reactions. Conclusions RPA could prove useful for the cost effective detection of plant viruses by plant diagnostic clinics. It can be performed in one hour or less with a reagent cost similar to that of PCR but with a lower labor cost, and with an acceptable level of sensitivity and specificity. Electronic supplementary material The online version of this article (doi:10.1186/s12985-016-0504-8) contains supplementary material, which is available to authorized users.

The three Andean states of Mérida, Táchira, and Trujillo in Venezuela produce tomatoes (Lycopersicon esculentum) year-round with a high frequency of virus-like symptoms. Polymerase chain reaction amplification using degenerate primers detected begomoviruses in 18% of leaf samples collected from tomato plants showing virus-like symptoms in commercial fields in these states between 1993 and 1994. A comparison of the sequences of the amplified DNA products revealed a diversity of begomovirus sequences in tomato plants from this region. Partial A component sequences (approximately 1,100 bp) clustered in four groups based on BLAST, GAP, phylogenetic analyses of the nucleic acid sequences, and comparisons of iteron sequences with known begomoviruses. Two groups of sequences were closely related to Potato yellow mosaic virus—Venezuela strain tomato and Tomato Venezuela virus, respectively, begomoviruses previously reported from other Venezuelan states. The other two groups of sequences appear to belong to two new begomovirus species.

Yang, Y., Sherwood, T. A., Patte, C. P., Hiebert, E., and Polston, J. E. 2004. Use of Tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer TYLCV resistance in tomato. Phytopathology 94:490-496. Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), ∆2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and Rep∆2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to ∆2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

Whitefly-transmitted viruses belonging to the genus Begomovirus (family Geminiviridae) represent a substantial threat to agricultural food production. The rapid evolutionary potential of these single-stranded DNA viruses combined with the polyphagous feeding behavior of their whitefly vector (Bemisia tabaci) can lead to the emergence of damaging viral strains. Therefore, it is crucial to characterize begomoviruses circulating in different regions and crops globally. This study utilized vector-enabled metagenomics (VEM) coupled with high-throughput sequencing to survey begomoviruses directly from whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Begomoviruses were detected in all locations, with the highest diversity identified in Guatemala where up to seven different species were identified in a single field. Both bipartite and monopartite viruses were detected, including seven new begomovirus species from Guatemala, Puerto Rico, and Spain. This begomovirus survey extends the known diversity of these highly damaging plant viruses. However, the new genomes described here and in the recent literature appear to reflect the outcome of interactions between closely-related species, often resulting from recombination, instead of unique, highly divergent species., This project is funded by grants from the National Science Foundation’s Systematic Biology and Biodiversity Inventories Program (DEB-1025915 to MB, DEB-1026095 to SD, DEB-1025901 to JEP). We acknowledge support by the CSIC Open Access Publication Initiative through its Unit of Information Resources for Research (URICI).

Background In the early 2000s, two cucurbit-infecting begomoviruses were introduced into the eastern Mediterranean basin: the Old World Squash leaf curl virus (SLCV) and the New World Watermelon chlorotic stunt virus (WmCSV). These viruses have been emerging in parallel over the last decade in Egypt, Israel, Jordan, Lebanon and Palestine. Methods We explored this unique situation by assessing the diversity and biogeography of the DNA-A component of SLCV and WmCSV in these five countries. Results There was fairly low sequence variation in both begomovirus species (SLCV π = 0.0077; WmCSV π = 0.0066). Both viruses may have been introduced only once into the eastern Mediterranean basin, but once established, these viruses readily moved across country boundaries. SLCV has been introduced at least twice into each of all five countries based on the absence of monophyletic clades. Similarly, WmCSV has been introduced multiple times into Jordan, Israel and Palestine. Conclusions We predict that uncontrolled movement of whiteflies among countries in this region will continue to cause SLCV and WmCSV migration, preventing strong genetic differentiation of these viruses among these countries.

Full-length sequences of a bipartite begomovirus were obtained from a plant of Jatropha multifida in Florida showing symptoms of foliar mosaic, distortion and necrosis. Sequences of four clones each of a DNA-A and DNA-B were obtained, which showed very low sequence diversity among themselves. The clones were infectious when biolistically inoculated to J. multifida, Phaseolus vulgaris and Nicotiana tabacum, but not to J. curcas. The DNA-A sequences had less than 89 % pairwise identity scores with the DNA-A of other begomoviruses. The DNA-A appeared to be a recombinant in that 18 % of the DNA-A (470 nt) had a pairwise identity score of 91.98 % with RhRGMV, indicating that this portion most likely originated from a virus closely related to RhRGMV. The remaining 82 % of the DNA-A had lower identity scores with TbMoLCV (87.84 %) and RhRGMV (87.46 %), which suggests that this part of the component originated from an undescribed virus. There was no evidence for recombination in the DNA-B. Equivalent sequences of the DNA-A had the highest identity score (94.18 %) with a 533-nt sequence obtained from J. multifida from Puerto Rico in 2001 (GenBank accession no. AF058025). Pairwise comparison, recombination and phylogenetic analysis, and biology suggest that these clones are those of jatropha mosaic virus first reported from Puerto Rico. This is the first report of the complete genome sequence of jatropha mosaic virus.

El virus del mosaico dorado amarillo de la habichuela (BGYMV) es un geminivirus transmitido por moscas blancas (Género: Bemisia). Este virus causa pérdidas económicas considerables en la habichuela común (Phaseolus vulgaris L.). Las técnicas serológicas como ELISA, se han utilizado ampliamente en la detección de viruses. Se evaluaron tres anticuerpos monoclonales existentes (3F7, 2G5 y 5C5) en la detección del BGYMV en varias líneas de habichuela en Puerto Rico. El anticuerpo monoclonal 3F7 resultó el más efectivo en detectar el virus en tejidos de habichuela de la línea DOR 364 y los cultivares susceptibles Top Crop y Quest. Sin embargo, no fue efectivo en detectar el virus en la línea DOR 303 aún en presencia de síntomas típicos.También se evaluaron muestras de Macroptilium lathyroides, una maleza que puede ser reservorio del virus. Las pruebas de ELISA resultaron inconclusas en la detección de geminiviruses en M. lathyroides. Se utilizó la reacción en cadena de la poíimerasa (PCR) para complementar el diagnóstico de! BGYMV en M. lathyroides y líneas de habichuela con síntomas de virosis pero negativas a la prueba de ELISA. Se utilizaron tíos pares de iniciadores en las pruebas de PCR, específicos para Begomovirus como el BGYMV. Utilizando PCR fue posible detectar el virus en los tejidos de la línea DOR 303 y en M. lathyroides.

The whitefly Bemisia tabaci (Gennadius) is a widely distributed pest of many important food and fiber crops. This whitefly is also a vector of more than 70 plant-infecting viruses. A cell line was established in vitro using embryonic tissues from the eggs of Bemisia tabaci (Gennadius), B biotype (pseudonym B. argentifolii Bellows & Perring), and referred to as ‘Btb(Ba)97, Hunter-Polston’. Cell cultures were successfully inoculated with begomovirus (BGMV and ToMoV)-infected tomato plant sap. Embryonic tissues were seeded into Kimura's modified medium and kept at a temperature of 24°C. Continuous cell cultures were established and have since undergone 92 passages in 25-cm 2 flasks. Cell doubling time is approximately 3 days and the cells have been successfully revived after 1 year after storage at −80°C. The cell population is monolayers of predominately fibroblast with some epithelial cells. Begomoviruses (bean golden mosaic begomovirus, BGMV, and tomato mottle begomovirus, ToMoV) were inoculated to the cell cultures independently and detected by labeling by an indirect immunofluorescence technique. The viruses were detected bound to the cell membranes and within the cell cytoplasm. This is the first report of a continuous cell line established from a species of whitefly and its inoculation with two begomoviruses. The successful inoculation of whitefly cell cultures with begomoviruses shown in our results represents great promise for the development of systems that allow researchers to achieve a better understanding of the complex relationship between begomoviruses and their whitefly vectors.

Tobacco plants (Nicotiana tabacum ‘Xanthi’) were transformed with a binary vector containing the coat protein gene of tomato mottle begomo-virus (ToMoV) modified by the deletion of 30 nucleotides in the 5′ end. The R1 generation was screened for resistance to ToMoV by inoculation with viruliferous whiteflies. Fifteen days after inoculation, symptom development was recorded weekly for up to 120 days using a visual scale, and ToMoV infection was confirmed by polymerase chain reaction and enzyme-linked immunosorbent assay. The response to high inoculation levels of ToMoV varied and ranged from susceptibility to immunity. The transgene transcript was detected by northern blot analysis; however, the transgene product could not be detected by protein blot analysis using antisera reactive with ToMoV coat protein. The lack of detection of the transgene product in resistant plants suggests that it is not involved in eliciting the resistance response and that resistance may be mediated by the transgene transcript.

Whiteflies are a key pest of crops in open-field production throughout the tropics and subtropics. This is due in large part to the long and diverse list of devastating plant viruses transmitted by these vectors. Open-field production provides many challenges to manage these viruses and in many cases adequate management has not been possible. Diseases caused by whitefly-transmitted viruses have become limiting factors in open-field production of a wide range of crops, i.e., bean golden mosaic disease in beans, tomato yellow leaf curl disease in tomato, cassava mosaic disease and cassava brown streak disease in cassava, and cotton leaf crumple disease in cotton. While host resistance has proven to be the most cost-effective management solution, few examples of host resistance have been developed to date. The main strategy to limit the incidence of virus-infected plants has been the application of insecticides to reduce vector populations aided to some extent by the use of selected cultural practices. However, due to concerns about the effect of insecticides on pollinators, consumer demand for reduced pesticide use, and the ability of the whitefly vectors to develop insecticide-resistance, there is a growing need to develop and deploy strategies that do not rely on insecticides. The reduction in pesticide use will greatly increase the need for genetic resistance to more viruses in more crop plants. Resistance combined with selected IPM strategies could become a viable means to increase yields in crops produced in open fields despite the presence of whitefly-transmitted viruses.

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species(5), are vectors of many plant viruses. Several genera of these whitefly-transmitted plant viruses (Begomovirus, Carlavirus, Crinivirus, Ipomovirus, Torradovirus) include several hundred species of emerging and economically significant pathogens of important food and fiber crops (reviewed by(9,10,16)). These viruses do not replicate in their vector but nevertheless are moved readily from plant to plant by the adult whitefly by various means (reviewed by(2,6,7,9,10,11,17)). For most of these viruses whitefly feeding is required for acquisition and inoculation, while for others only probing is required. Many of these viruses are unable or cannot be easily transmitted by other means. Therefore maintenance of virus cultures, biological and molecular characterization (identification of host range and symptoms)(3,13), ecology(2,12), require that the viruses be transmitted to experimental hosts using the whitefly vector. In addition the development of new approaches to management, such as evaluation of new chemicals(14) or compounds(15), new cultural approaches(1,4,19), or the selection and development of resistant cultivars(7,8,18), requires the use of whiteflies for virus transmission. The use of whitefly transmission of plant viruses for the selection and development of resistant cultivars in breeding programs is particularly challenging(7). Effective selection and screening for resistance employs large numbers of plants and there is a need for 100% of the plants to be inoculated in order to find the few genotypes which possess resistance genes. These studies use very large numbers of viruliferous whiteflies, often several times per year. Whitefly maintenance described here can generate hundreds or thousands of adult whiteflies on plants each week, year round, without the contamination of other plant viruses. Plants free of both whiteflies and virus must be produced to introduce into the whitefly colony each week. Whitefly cultures must be kept free of whitefly pathogens, parasites, and parasitoids that can reduce whitefly populations and/or reduce the transmission efficiency of the virus. Colonies produced in the manner described can be quickly scaled to increase or decrease population numbers as needed, and can be adjusted to accommodate the feeding preferences of the whitefly based on the plant host of the virus. There are two basic types of whitefly colonies that can be maintained: a nonviruliferous and a viruliferous whitefly colony. The nonviruliferous colony is composed of whiteflies reared on virus-free plants and allows the weekly availability of whiteflies which can be used to transmit viruses from different cultures. The viruliferous whitefly colony, composed of whiteflies reared on virus-infected plants, allows weekly availability of whiteflies which have acquired the virus thus omitting one step in the virus transmission process.

Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed "vector-enabled metagenomics" (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral diseases.

Polston, J. E., Cohen, L., Sherwood, T. A., Ben-Joseph, R., and Lapidot, M. 2006. Capsicum species: Symptomless hosts and reservoirs of Tomato yellow leaf curl virus. Phytopathology 96:447-452. Five Capsicum species were tested for susceptibility to Tomato yellow leaf curl virus (TYLCV) and the mild strain of TYLCV (TYLCV-Mld). TYLCV was able to infect 30 of 55 genotypes of C. annuum, one of six genotypes of C. chinense, one of two genotypes of C. baccatum, and the only genotype of C. frutescens tested but was unable to infect the one genotype of C. pubescens tested. This is the first evidence for the susceptibility of C. baccatum, C. chinense, and C. frutescens to TYLCV. Unlike TYLCV isolates, TYLCV-Mld was unable to infect C. chinense. No host differences were observed between the Israeli and Florida isolates of TYLCV. None of the Capsicum species showed symptoms after infection with TYLCV or TYLCV-Mld. TYLCV was detected in fruits of C. annuum, but whiteflies were unable to transmit virus from fruits to plants. Whiteflies were able to transmit both TYLCV and TYLCV-Mld from infected pepper plants to tomato plants. Pepper plants in research plots were found infected with TYLCV at rates as much as 100%. These data demonstrate the ability of some genotypes of pepper to serve as reservoirs for the acquisition and transmission of TYLCV and TYLCV-Mld.

The begomovirus Potato yellow mosaic virus (PYMV) is responsible of significant yield losses in tomato in Guadeloupe. Four field isolates from Guadeloupe were analyzed in term of their host range using three inoculation methods (mechanical, grafting and insect vector), sequences analysis of PCR fragments and phylogenetic analysis of an infectious clone, PYMV-[GP]. Capsicum annuum, Datura stramonium, Nicotiana benthamiana, N. tabacum ‘Xanthi NC’, Petunia hybrida, and Solanum tuberosum were found to be hosts. All isolates from Guadeloupe, Martinique, Puerto Rico and the Dominican Republic were closely related to PYMV-[GP]. Sequence identity between PYMV-[GP] and PYMV-Ve from Venezuela and PYMTV from Trinidad and Tobago clearly confirmed that it is a new strain of PYMV.

Viruses of to the family Geminiviridae are considered some of the most important pathogens in tropical and subtropical regions of the world. Members of one Geminiviridae genus, Begomovirus, have been causing severe losses, particularly in tomato (Lycopersicon esculentum) production in the Americas and the Caribbean. Several new begomoviruses have been reported in the region and, at least one, Tomato yellow leaf curl virus (TYLCV), has been brought in from the Old World via infected transplants. In addition, the recombination events that are playing an important role in Begomovirus diversity have increased the complexity of their control. This scenario has led to the search for control measures that go beyond traditional host genetic resistance, chemical controls and cultural practices. In this review, besides the recommended classical control measures, transgenic approaches will be discussed, as well as the mechanisms involved in their successful control of viruses. Membros do gênero Begomovirus, família Geminiviridae, estão entre os vírus mais importantes que infetam plantas nas regiões tropicais e subtropicais do mundo. Nas Américas, begomovirus vêm causando danos significativos especialmente para a produção de tomates (Lycopersicon esculentum). Inúmeros novos vírus têm sido relatados na região, e ao menos um, o Tomato yellow leaf curl virus (TYLCV), foi introduzido do Velho Continente através de plântulas infetadas. Além disso, recombinação aparentemente é um fator importante contribuindo para uma maior diversidade desses vírus, dificultando seu controle. Esta situação levou à procura de medidas de controle que vão além das normalmente utilizadas como resistência genética, controle químico e cultural. Nesta revisão, além de medidas tradicionais de controle de begomovirus, são discutidas principalmente estratégias de controle alternativas, como a utilização de plantas transgênicas, assim como os mecanismos envolvidos em tais estratégias

Whiteflies from the Bemisia tabaci species complex have the ability to transmit a large number of plant viruses and are some of the most detrimental pests in agriculture. Although whiteflies are known to transmit both DNA and RNA viruses, most of the diversity has been recorded for the former, specifically for the Begomovirus genus. This study investigated the total diversity of DNA and RNA viruses found in whiteflies collected from a single site in Florida to evaluate if there are additional, previously undetected viral types within the B. tabaci vector. Metagenomic analysis of viral DNA extracted from the whiteflies only resulted in the detection of begomoviruses. In contrast, whiteflies contained sequences similar to RNA viruses from divergent groups, with a diversity that extends beyond currently described viruses. The metagenomic analysis of whiteflies also led to the first report of a whitefly-transmitted RNA virus similar to Cowpea mild mottle virus (CpMMV Florida) (genus Carlavirus) in North America. Further investigation resulted in the detection of CpMMV Florida in native and cultivated plants growing near the original field site of whitefly collection and determination of its experimental host range. Analysis of complete CpMMV Florida genomes recovered from whiteflies and plants suggests that the current classification criteria for carlaviruses need to be reevaluated. Overall, metagenomic analysis supports that DNA plant viruses carried by B. tabaci are dominated by begomoviruses, whereas significantly less is known about RNA viruses present in this damaging insect vector.