Search

Fatty acid synthase (FAS) regulates the production of fatty acids and plays a role in regulating apoptosis. Hoechst 33342-induced apoptosis in BC3H-1 myocytes was used as a model to explore intracellular changes in FAS protein (Western blot) and FAS mRNA (RT-PCR). Total lipid and individual phospholipid synthesis was inhibited by a lethal dose of Hoechst 33342 (20 microg/ml) while total lipid and phospholipid degradation ([1-14C]-acetate pulse chase method) were not. Hoechst 33342 at 20 microg/ml reduced the concentration of FAS protein, which was followed more than 6 hr later by a reduction in FAS mRNA. In conclusion, the inhibition of fatty acid synthesis induced by 20 microg/ml of Hoechst 33342 is attributed to the degradation of FAS protein by activated caspases rather than by inhibition of FAS enzyme activity or FAS mRNA synthesis.

Abstract. Hoechst 33342's effects on apoptosis and mitochondrial membrane potential (delta psi) were investigated in a myelogenous leukemia cell line, HL-60. Delta psi was detected with 2 lipophilic cationic fluorochromes: 3,3'-dihexyloxacarbocyanine iodide [DiOC6(3)] or 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide (JC-1). Mitochondrial mass was measured with nonyl acridine orange (NAO). Protonophore carbonyl cyanide m-chlorophenylhydrazone (CCCP) depolarized mitochondria in control experiments. Cell viability was determined by propidium iodide uptake. Hoechst 33342 at 10-20 mg/L decreased fluorescence for DiOC6(3) at 0.5 hr. The fluorescence partially normalized at 3 hr and then progressively decreased at 5-24 hr, resulting in cell shrinkage and death. Mitochondrial mass decreased 40-70% by 1 hr and 70-90% at 24 hr. A lower concentration of Hoechst 33342, 5 mg/L, reduced the delta psi at 0.5 hr, but delta psi returned to control values after 3 hr. Mitochondrial mass decreased 30-40% and then partially normalized, and cell viability was > 92% at 24 hr. Protonophore carbonyl cyanide m-chlorophenylhydrazone lowered delta psi with little cell death. Thus, at high concentration, Hoechst 33342 induces depolarization of delta psi and subsequent apoptosis. Lack of apoptosis at low concentration of Hoechst 33342, despite depolarization of delta psi, indicates that mitochondrial membrane depolarization alone is insufficient to induce apoptosis.

Background: Hoechst 33342 and Hoechst 33258 bind to the minor groove of DNA. Hoechst 33342 induces apoptosis in a variety of cell types by a mechanism that is associated with disruption of the formation of the TATA box-binding protein/DNA complex., Objective: To further investigate the role of Hoechst 33342 in gene regulation using BC3H-1 myocytes transfected with 4 different pGL3 luciferase reporter vectors constructed with or without the SV40 promoter and/or enhancer regions or with 2 synthetic Renilla luciferase vectors (phRL-null and phRL-TK)., Methods: Luciferase messenger RNA content was measured by reverse transcriptase-polymerase chain reaction, and luciferase activity was measured by luminometry. The ability of transcription factors in nuclei prepared from BC3H-1 myocytes to bind to a [32P]-labeled 24-base pair oligonucleotide containing the TATA box-binding element was determined by a gel mobility shift assay., Results: In vivo, 4.4 and 8.9 microM of Hoechst 33342 (sublethal doses) increased luciferase enzyme activity in cells transfected with each of the 4 pGL3 luciferase reporter vectors and both of the Renilla luciferase vectors. Hoechst 33258 had no effect on luciferase enzyme activity. In vitro, Hoechst 33342 increased transcription factor binding to the 24-mer oligonucleotide containing the TATA box-binding element, which would be favorable to increased RNA polymerase II efficiency., Conclusion: Hoechst 33342 stimulates luciferase activity by a pathway that is independent of the integrity of the promoters in the luciferase gene expression vectors used (pGL3 basic, pGL3 control, pGL3 enhancer, and pGL3 promoter vectors, phRL-null, or phRL-TK).

Context: Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions., Objective: To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis., Methods: The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction., Results: Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines., Conclusion: Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.

Hoechst 33342 and Hoechst 33258 bind to adenine-thymine rich regions of the minor groove of DNA. Hoechst 33342, but not Hoechst 33258, induces BC3H-1 myocyte cell death and DNA fragmentation into an internucleosomal pattern characteristics of apoptosis. Hoechst 33342 has been shown to inhibit endogenous nuclear topoisomerase I activity. Another enzymatic activity utilizing the minor groove of DNA, the initiation of RNA polymerase II activity by formation of a TATA box binding protein/TATA box promoter complex, is shown to be altered using a gel mobility shift assay. A [32P]-labeled 24-oligonucleotide containing a TATA box element formed one molecular weight complex in control and Hoechst 33258 treated cells. The presence of Hoechst 33342 (26.7 microM) decreased the amount of the control complex and increased the presence of lower molecular weight species suggesting degradation of nuclear TBP and/or release of other transcription factors from the complex creating a smaller sized molecular complex which retains TATA box binding capacity. These results suggest that the pathway utilized to induce apoptosis in BC3H-1 myocytes may also involve the alteration of normal TBP/DNA complex formation and reduction in the initiation of new transcription.

Hoechst 33342, a bisbenzimidazole dye, binds to adenine/thymine rich regions in the minor groove of deoxyribonucleic acid (DNA). This dye induces apoptosis in BC3H-1 myocytes. The mechanism of Hoechst 33342-induced apoptosis was investigated. Inhibitors of ribonucleic acid (RNA) synthesis, protein synthesis, and serine or cysteine proteases failed to prevent BC3H-1 myocyte death induced by Hoechst 33342. Apoptosis may be dependent on increased p53 expression. Hoechst 33342 had no effect on p53 expression in BC3H-1 myocytes. Lactate oxidation, a monitor of mitochondrial function, was altered by Hoechst 33342 in dose dependent manner. Also, nuclear extracts were used to assay endogenous topoisomerase I activity which was inhibited by Hoechst 33342 treatment of BC3H-1 myocytes. Therefore, Hoechst 33342 appears to initiate apoptosis in BC3H-1 myocytes by a pathway which is independent of de novo RNA and protein synthesis. However, the dye does initiate mitochondrial dysfunction and inhibition of nuclear topoisomerase I as two important steps in the apoptotic pathway.

Bisbenzimidazoles (Hoechst 33342 and Hoechst 33258) are cell permeable, adenine-thymine binding fluorescent dyes used to stain deoxyribonucleic acid (DNA) during the evaluation of cell cycle, induction of apoptosis by various ligands and cell viability by flow cytometry. These dyes inhibit topoisomerase I activity in vitro, like camptothecin. In this study, Hoechst 33342 is shown to induce apoptosis at concentration of 10 micrograms/mL or greater after 3 hours incubation in Dulbecco's Modified Eagle Medium characterized by rounded cell morphology, half-moon nuclei with condensed chromatin and a DNA fragmentation ladder of 180 base pair multiples. Hoechst 33258 at the same molarity or seven times greater molarity did not induce apoptosis. If the BC3H-1 myocytes were incubated in RPMI-1640 media, two times the concentration of Hoechst 33342 (20 micrograms/mL) was required to initiate apoptosis. Staining of unfixed cells with Hoechst 33342 may induce apoptosis in the absence of ligands. Therefore, Hoechst 33342 concentration and staining interval should be tested before ligands which may induce apoptosis are evaluated.