Search

Treatment results for patients with newly diagnosed FMS-like tyrosine kinase 3 (FLT3)-mutated (FLT3mut+) acute myeloid leukemia (AML) ineligible for intensive chemotherapy are disappointing. This multicenter, open-label, phase 3 trial randomized (2:1) untreated adults with FLT3mut+ AML ineligible for intensive induction chemotherapy to receive gilteritinib (120 mg/d orally) and azacitidine (GIL + AZA) or azacitidine (AZA) alone. The primary end point was overall survival (OS). At the interim analysis (August 26, 2020), a total of 123 patients were randomized to treatment (GIL + AZA, n = 74; AZA, n = 49). Subsequent AML therapy, including FLT3 inhibitors, was received by 20.3% (GIL + AZA) and 44.9% (AZA) of patients. Median OS was 9.82 (GIL + AZA) and 8.87 (AZA) months (hazard ratio, 0.916; 95% CI, 0.529-1.585; P = .753). The study was closed based on the protocol-specified boundary for futility. Median event-free survival was 0.03 month in both arms. Event-free survival defined by using composite complete remission (CRc) was 4.53 months for GIL + AZA and 0.03 month for AZA (hazard ratio, 0.686; 95% CI, 0.433-1.087; P = .156). CRc rates were 58.1% (GIL + AZA) and 26.5% (AZA) (difference, 31.4%; 95% CI, 13.1-49.7; P < .001). Adverse event (AE) rates were similar for GIL + AZA (100%) and AZA (95.7%); grade ≥3 AEs were 95.9% and 89.4%, respectively. Common AEs with GIL + AZA included pyrexia (47.9%) and diarrhea (38.4%). Gilteritinib steady-state trough concentrations did not differ between GIL + AZA and gilteritinib. GIL + AZA resulted in significantly higher CRc rates, although similar OS compared with AZA. Results support the safety/tolerability and clinical activity of upfront therapy with GIL + AZA in older/unfit patients with FLT3mut+ AML. This trial was registered at www.clinicaltrials.gov as #NCT02752035.

Background: Gilteritinib (ASP2215) is a novel, highly selective, potent oral FLT3/AXL inhibitor with preclinical activity against FLT3-ITD activating and FLT3-D835 resistance mutations. The objectives of this phase 1/2 study were to assess gilteritinib safety/tolerability, pharmacokinetic (PK) and pharmacodynamic (PD) profiles after single- and multiple-day dosing, and antileukemic effects in patients with R/R AML. Methods: This open-label study (NCT02014558) enrolled patients (≥18 yr) into 1 of 7 dose-escalation cohorts (20-450 mg once daily [QD]) or concomitant dose-expansion cohorts. While confirmed FLT3 mutation was not an inclusion criterion, each expanded dose level enrolled ≥10 patients with FLT3 mutations (FLT3mut+); 120 and 200 mg dose levels were further expanded with ≥40 FLT3mut+ patients. The choice to expand these dose cohorts was based upon FLT3 inhibition in correlative assays and clinical activity seen during dose escalation. Safety and tolerability were primary endpoints; blood samples were drawn from patients in the dose-escalation cohorts to evaluate gilteritinib PK parameters and PD effects. Antileukemic response rates (eg, complete remission [CR], CR with incomplete platelet recovery [CRp], CR with incomplete hematological recovery [CRi], overall response rate [ORR]) were secondary endpoints. Results: Patients (N=252; 129M:123F, median age 62 yr [range: 21-90]) enrolled between October 2013 and August 2015 received ≥1 dose of gilteritinib. The study population was heavily pretreated: 70% (n=177) had ≥2 prior AML therapies, 29% (n=73) had a prior stem cell transplant, and 25% (n=63) had prior TKI treatment with sorafenib most commonly used. Across the study, 194 patients had a locally confirmed FLT3 mutation (ITD, n=159; D835, n=13; ITD-D835, n=16; other, n=6). For all enrolled patients, progressive disease (n=75), lack of efficacy (n=44), adverse events (n=34), and death (n=29) were the most common reasons for treatment discontinuation. Seven deaths were considered possibly/probably related to treatment: pulmonary embolism, respiratory failure, hemoptysis, intracranial bleed, ventricular fibrillation, septic shock, and neutropenia (all n=1). Maximum tolerated dose was determined to be 300 mg when 2 of 3 patients in the 450 mg cohort experienced diarrhea and/or hepatic transaminase elevation as dose-limiting toxicities. Diarrhea (16%) and fatigue (15%) were the most commonly reported treatment-related adverse events of any grade. Less than 5% of patients (11/252) had a maximum post-baseline QTcF interval >500 msec. Gilteritinib concentrations were generally dose proportional and showed both a long-elimination half-life (45-159 h) and substantial accumulation (3.2-10 fold) by day 15. An exposure-related increase in the inhibition of FLT3 phosphorylation with increasing doses of gilteritinib was also observed. Gilteritinib showed strong antileukemic activity in FLT3mut+ patients (ORR=49%); response was observed less frequently in patients with wild-type FLT3 (ORR=12%). While CR, CRi, and CRp occurred at all doses, responses were enriched among FLT3mut+ patients with gilteritinib steady-state trough concentrations ≥100 ng/mL, which correlated with potent FLT3 inhibition in PD assays and corresponded to doses ≥80 mg. The ORR in 169 FLT3mut+ patients receiving ≥80 mg was 52% (Table); median overall survival in this patient population was ~31 wk (range: 1.7-61; Figure) and median duration of response was 20 wk (range: 1.1-55). Clinical responses occurred in FLT3mut+ patients with -ITD, -D835, and both mutations (ORR: 55%, 17%, and 62%, respectively) as well as in FLT3mut+ patients with or without prior TKI treatment (ORR: 42% vs 56%, respectively). Conclusions: This PD-driven, first-in-human study shows that gilteritinib was well tolerated and generated frequent, prolonged, clinically important responses in FLT3mut+ patients with R/R AML. Antileukemic responses were enriched in FLT3mut+ patients treated at doses that consistently and potently inhibited FLT3 phosphorylation. The survival of these patients appears better than expected for this patient population when treated with standard therapy. Our data suggest that FLT3 inhibition may improve survival in patients with FLT3mut+R/R AML; as such, phase 3 testing of oral gilteritinib 120 mg QD in patients with FLT3mut+R/R AML after first-line therapy is underway (NCT02421939). Disclosures Perl: Astellas US Pharma Inc.: Consultancy, Membership on an entity's Board of Directors or advisory committees; Daichi Sankyo: Consultancy, Membership on an entity's Board of Directors or advisory committees; Asana Biosciences: Consultancy, Membership on an entity's Board of Directors or advisory committees; Arog Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees; Actinium Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees. Altman:Janssen: Other: advisory board; BMS: Membership on an entity's Board of Directors or advisory committees; Spectrum: Other: advisory board; Ariad: Other: advisory board; Seattle Genetics: Other: advisory board; Syros: Other: advisory board. Cortes:ARIAD: Consultancy, Research Funding; BMS: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; Pfizer: Consultancy, Research Funding; Teva: Research Funding. Smith:Astellas: Research Funding. Erba:Jannsen: Consultancy, Research Funding; Millennium Pharmaceuticals, Inc.: Research Funding; Agios: Research Funding; Juno: Research Funding; Incyte: Consultancy, DSMB, Speakers Bureau; Daiichi Sankyo: Consultancy; Ariad: Consultancy; Amgen: Consultancy, Research Funding; Astellas: Research Funding; Gylcomimetics: Other: DSMB; Seattle Genetics: Consultancy, Research Funding; Sunesis: Consultancy; Novartis: Consultancy, Speakers Bureau; Celator: Research Funding; Celgene: Consultancy, Speakers Bureau; Pfizer: Consultancy. Gill:Astellas: Employment. Goldberg:Bristol Myers Squibb, Novartis: Speakers Bureau; Novartis: Consultancy; COTA Inc: Employment; Pfizer: Honoraria; Neostem: Equity Ownership. Jurcic:Astellas: Research Funding. Larson:Astellas: Consultancy, Research Funding; Bristol-Myers Squibb: Consultancy. Liu:Astellas: Employment. Ritchie:Celgene: Consultancy, Other: Travel, Accomodations, Expenses, Speakers Bureau; Incyte: Consultancy, Speakers Bureau; Novartis: Consultancy, Other: Travel, Accommodations, Expenses, Research Funding, Speakers Bureau; Ariad: Speakers Bureau; Pfizer: Consultancy, Research Funding; Astellas Pharma: Research Funding; Bristol-Meyers Squibb: Research Funding; NS Pharma: Research Funding. Schiller:Incyte Corporation: Research Funding. Strickland:Celator: Research Funding; Cyclacel: Research Funding; Karyopharm Therapeutica: Research Funding; GlaxoSmithKline: Research Funding; Baxalta: Consultancy; Boehringer Ingelheim: Consultancy, Research Funding; Ambit: Consultancy; Alexion Pharmaceuticals: Consultancy; Astellas Pharma: Research Funding; CTI Biopharma: Consultancy; Daiichi Sankyo: Consultancy; Sunesis Pharmaceuticals: Consultancy, Research Funding; Abbvie: Research Funding; Sanofi: Research Funding. Wang:Incyte: Speakers Bureau; Immunogen: Research Funding. Stuart:Sunesis: Consultancy, Honoraria, Other: Travel, Accomodations, Expenses, Research Funding; Agios: Research Funding; Incyte: Research Funding; Bayer: Research Funding; Celator: Research Funding; Astellas: Research Funding. Martinelli:Ariad: Consultancy, Speakers Bureau; Pfizer: Consultancy, Speakers Bureau; BMS: Speakers Bureau; Roche: Consultancy, Speakers Bureau; MSD: Consultancy; Genentech: Consultancy; Novartis: Speakers Bureau; Celgene: Consultancy, Speakers Bureau; Amgen: Consultancy, Speakers Bureau. Bahceci:Astellas: Employment. Levis:Millennium: Consultancy, Research Funding; Astellas: Consultancy, Honoraria, Research Funding; Daiichi-Sankyo: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Research Funding.

Introduction: ASP2215, a new tyrosine kinase inhibitor with activity against FMS-like receptor tyrosine kinase-3 (FLT3) and AXL receptor tyrosine kinase, is currently in development for the treatment of acute myeloid leukemia (AML). Methods: In an ongoing, first-in-human Phase 1/2, dose-escalation/dose-expansion study, the pharmacokinetic (PK) profile and pharmacodynamic (PD) effects of ASP2215 were evaluated under fasting conditions in patients with relapsed or refractory AML (R/R AML). Patients who met study criteria were assigned to treatment in the dose-escalation cohorts or were randomized to an open dose level in the dose-expansion cohorts. The dose-escalation cohort was a modified 3+3 with accelerated titration design that evaluated ascending oral doses of ASP2215 (20-450 mg), the dose-expansion cohort was a parallel, multi-dose-expansion cohort. Blood samples were collected and safety/tolerability assessments, including 12-lead electrocardiogram, were evaluated at protocol-specified time points for both cohorts. Effect of increasing ASP2215 exposure on inhibition of FLT3 phosphorylation, assessed via plasma inhibitory assay (PIA), was evaluated using an inhibitory PK/PD Emaxmodel. PK/PD analyses were performed to evaluate the relationship between ASP2215 exposure and changes from baseline in QTcF intervals (ΔQTcF) and changes from baseline in clinical laboratory values (e.g., creatinine kinase [ΔCK], aspartate aminotransferase [ΔAST]). Results: Data from an interim analysis of the dose-escalation/dose-expansion study were available from 215 subjects (n=23 [dose escalation], n=192 [dose expansion]). The ASP2215 PK parameters across the dose range (20-450 mg), evaluated after both single- and multiple-dose administration, are presented (Table); statistical analyses suggest the ASP2215 PK parameters are dose proportional from 20-450 mg. Median time to maximal concentration (Tmax) was observed between 2 hr and 6 hr after single and repeated oral dosing. The estimated median half-life (t1/2) ranged from approximately 45 hr to 159 hr based on the accumulation ratio; ASP2215 accumulation was extensive after multiple dose administration as reflected by the accumulation index (Rac) ranging from approximately 3.2-10. A strong correlation was shown for ASP2215 exposure-related inhibition of FLT3 phosphorylation, with >90% FLT3 inhibition observed by Day 8 at ASP2215 doses of ≥80 mg. Although a positive slope was observed between ΔQTcF and ASP2215 exposure, only 5% of the study population were reported as having a maximum post-baseline QTcF interval >500 msec. A similar trend was observed with ASP2215 concentration-related increases in ΔCK and ΔAST; however, Conclusions: ASP2215 has demonstrated exposure-related FLT3 inhibition and a pharmacokinetic profile that support once-daily oral administration for the treatment of AML in subjects who relapsed after, or are refractory to, induction or salvage treatment. Table. ASP2215 Pharmacokinetic Parameters after Multiple-Dose Administration 20 mg (n=4) 40 mg (n=3) 80 mg (n=3) 120 mg (n=3) 200 mg (n=2) 300 mg (n=3) 450 mg (n=3) Cmax(ng/mL) 45.6 (30.5, 137) 106 (76.7, 140) 396 (217, 516) 282 (248, 593) 1460 (886, 2040) 1260 (1040, 2280) 1150 (776, 1530) Tmax(hr) 4.01 (4.00, 6.00) 3.87 (0.500, 6.00) 4.33 (4.00, 4.42) 2.02 (1.95, 5.75) 6.03 (6.00, 6.07) 6.05 (4.08, 6.07) 5.00 (4.07, 5.93) AUC0-24(ng·h/mL) 926 (543, 2480) 2460 (1750, 2800) 6280 (4160, 10600) 6190 (4200, 11300) 31500 (16500, 46600) 28700 (22300, 43300) 11500 (8070, 14900) t1/2 (hr) 52.8 (39.7, 83.1) 83.7 (68.5, 243) 91.5 (60.9, 108) 45.3 (30.5, 63.3) 143 (99.7, 186) 159 (83.3, 187) 56.9 (51.5, 62.3) Rac 3.70 (2.92, 5.51) 5.55 (4.64, 15.1) 6.02 (4.18, 7.02) 3.25 (2.38, 4.33) 9.08 (6.51, 11.7) 10.1 (5.53, 11.7) 3.94 (3.62, 4.27) Data are presented as median (minimum, maximum). AUC0-24, area under the concentration-time curve between 0-24 hr; Cmax, maximal concentration; t1/2, elimination half-life; Tmax, time to maximal concentration; Rac, accumulation ratio. Disclosures Smith: Astellas: Research Funding; Plexxikon: Research Funding. Off Label Use: ASP2215 is an investigational product for the treatment of AML. Perl:Astellas US Pharma Inc.: Consultancy; Ambit/Daichi Sankyo: Consultancy; Arog Pharmaceuticals: Consultancy; Asana Biosciences: Consultancy; Actinium Pharmaceuticals: Consultancy. Altman:Novartis: Other: Advisory board; BMS: Other: Advisory board; Seattle Genetics: Other: Advisory board; Spectrum: Other: Advisory board; Ariad: Other: Advisory board; Astellas: Other: Advisory board; assistance with abstract preparation. Gill:Astellas Pharma US, Inc: Employment. Kadokura:Astellas Pharma Global Development: Employment, Other: Personal fees. Yuen:Astellas Pharma, Inc.: Employment. Fisniku:Astellas: Employment. Liu:Astellas: Employment. Nagase:Astellas: Employment. Sargent:Astellas Pharma US, Inc: Employment. Bahceci:Astellas Pharma Global Development: Employment.

This paper describes the binding interactions of Escherichia coli transcription factors sigma 70 and NusA with core RNA polymerase, both free in solution and as a part of the functional transcription complex. High pressure liquid chromatography gel filtration and fluorescence techniques have been used to monitor the binding of these factors to core polymerase in solution at salt concentrations roughly comparable to the in vivo environment (250 mM-KCl, 50 mM-potassium phosphate (pH 7.5]; under these conditions all the interacting species exist separately as protein monomers. We find that sigma 70 and NusA binds competitively to core polymerase with a 1:1 binding stoichiometry in this milieu, and that NusA does not bind to the polymerase holoenzyme. Association constants of approximately 2 x 10(9) and 1 x 10(7) M-1 have been measured for the sigma 70-core polymerase interaction and for the NusA-core polymerase interaction, respectively. These findings are consistent with the original formulation of the NusA-sigma 70 cycle put forward by Greenblatt & Li, and provide the basis for a further (and preliminary) quantitative examination of these same interactions within the transcription complex. We use a number of molecular biological techniques, together with data from the literature, to estimate these binding constants in various phases of the transcription cycle. In keeping with our results in solution, we find that the effective binding affinity of sigma 70 for core polymerase within the "open" promoter-polymerase complex is at least 500-fold greater than that of NusA. As the transcription complex moves from the initiation to the elongation phase these relative binding affinities are reversed; the average association constant of NusA for the core polymerase in the elongation complex remains practically the same as in free solution (approx. 3 x 10(7) M-1), while the affinity of sigma 70 for core polymerase in this complex drops to less than 5 x 10(5) M-1. These results are used to begin to define the basic conformational states and interaction potentials of core polymerase in the various stages of the transcription cycle.

A family of sequence-related 2'-aminopyrimidine, 2'-hydroxylpurine aptamers, developed by oligonucleotide-based combinatorial chemistry, SELEX (systematic evolution of ligand by exponential enrichment) technology, binds human nonpancreatic secretory phospholipase A2 (hnps-PLA2) with nanomolar affinities and inhibits enzymatic activity. Aptamer 15, derived from the family, binds hnps-PLA2 with a Kd equal to 1.7 +/- 0.2 nM and, in a standard chromogenic assay of enzymatic activity, inhibits hnps-PLA2 with an IC50 of 4 nM, at a mole fraction of substrate concentration of 4 x 10(-6) and a calculated Ki of 0.14 nM. Aptamer 15 is selective for hnps-PLA2, having a 25- and 2500-fold lower affinity, respectively, for the unrelated proteins human neutrophil elastase and human IgG. Contractions of guinea pig lung pleural strips induced by hnps-PLA2 are abolished by 0.3 microM aptamer 15, whereas contractions induced by arachidonic acid are not altered. The structure that is essential for binding and inhibition appears to be a 40-base hairpin/loop motif with an asymmetrical internal loop. The affinity and activity of the aptamers demonstrate the ability of the SELEX process to isolate antagonists of nonnucleic-acid-binding proteins from vast oligonucleotide combinatorial libraries.

Background : Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) is a potent inducer of new blood vessel growth (angiogenesis) that contributes to the pathology of many angiogenesis-associated disease states such as psoriasis, rheumatoid arthritis and cancer. Few molecular entities capable of binding to VPF/VEGF with high affinity and specificity have been described to date. Results : Nuclease-resistant 2′-amino-2′-deoxypyrimidine nucleotide RNA (2′-aminopyrimidine RNA) ligands that bind to VPF/VEGF with high affinity have been identified by iterative rounds of affinity-selection/amplification from two independent random libraries. The sequence information that confers high affinity binding toVPF/VEGF is contained in a contiguous stretch of 24 nucleotides, 5′- CCCUGAUGGUAGACGCCGGGGUG -3′ (2′-aminopyrimidine nucleotides are designated with italic letters). Of the 14 ribopurines in this minimal ligand, 10 can be substituted with the corresponding 2′-O-methylpurine nucleotides without a reduction in binding affinity to VPF/VEGF. In fact, the 2′ O-methyl substitution at permissive positions leads to a ∼17-fold improvement in the binding affinity to VPF/VEGF The higher affinity results from the reduction in the dissociation rate constant of the 2′-O-methyl-substituted RNA ligand from the protein compared to the unsubstituted ligand. The 2′-O-methyl-substituted minimal ligand, which folds into a bulged hairpin motif, is also more thermally stable than the unsubstituted ligand. Nuclease resistance of the ligand is further improved by the 2′-O-methyl substitutions and the addition of short phosphorothioate caps to the 3′- and 5′-ends. Conclusions : We have used the SELEX (systematic evolution of ligands by exponential enrichment) process in conjunction with post-SELEX modifications to define a highly nuclease-resistant oligonucleotide that binds to VPF/VEGF with high affinity and specificity.

Abstract 4327 Quizartinib (AC220) is an oral tyrosine kinase inhibitor that has shown promising activity in refractory/relapsed acute myeloid leukemia patients in a Phase 1 and a Phase 2 study. The absorption, metabolism, and excretion of quizartinib were characterized in healthy volunteers in a Phase 1 mass balance study. Six healthy males (mean ± SD age 29 ± 8.4 years) received a single oral dose of 60 mg quizartinib as a solution; approximately 1.6% of the total dose was labeled with 14C (approximately 100 μCi). Blood, plasma, urine, and feces were collected for 14 days (336 h) after dosing. Maximum mean ± SD blood radioactivity concentrations, reached 4 h after dosing, were 296 ± 67.4 ng equivalents/g. Maximum blood radioactivity concentrations in individual subjects occurred 4 h after dosing and ranged from 228 to 397 ng equivalents/g. Excretion of radioactivity was relatively consistent throughout the study. The maximum mean ± SD urinary concentration of radioactivity was 112 ± 52.3 ng equivalents/g at 8 to 24 hours after dosing, and the maximum mean ± SD fecal concentration of radioactivity was 51,100 ± 21,300 ng equivalents/g at 24 to 48 h after dosing. A mean ± SD of 1.64 ± 0.482% of the dose was recovered in urine, and 76.3 ± 6.23% was recovered in feces. The overall mean ± SD recovery of radioactivity in urine and feces was 78.0 ± 6.24% over the course of the study, with recovery from individual subjects ranging from 72.4% to 88.3%. Excretion of radioactivity was still ongoing at study completion (336 h). Recovery of The major radiolabeled components of plasma were unchanged quizartinib and the oxidative metabolite AC886. Five additional metabolites in plasma were identified by LC-MS but could not be identified by measurement of radioactivity, because of low levels. Eighteen radioactive peaks in urine were detected, representing less than 0.09% of the administered dose, but their putative structures could not be identified because of low levels. Quizartinib was extensively metabolized, with the metabolites excreted primarily in feces, suggesting hepatobiliary excretion of radioactivity, non-biliary excretion into the gastrointestinal tract, or metabolism within the gastrointestinal tract. Forty-two radioactive peaks were detected in fecal extracts, of which unchanged quizartinib was a significant radioactive component (mean of 4.0% of the administered radioactive dose), and 15 metabolites, each representing a mean of 1.0% to 3.5% of the administered radioactive dose, were identified. Quizartinib was predominantly metabolized by phase I biotransformations, as was evident by the absence of any conjugates of quizartinib or of oxidative metabolites under the analytical conditions used to profile plasma, urine, and feces. Quizartinib was metabolized by multiple biotransformation pathways, including oxidation, reduction, dealkylation, deamination, and hydrolysis, and by combinations of these pathways. Quizartinib was well tolerated as a single 60 mg dose in this study. There were no clinically significant changes in vital signs, ECGs, or laboratory test results. Two subjects experienced adverse events. Grade 1 dry skin in 1 subject was considered to be unrelated to study treatment, and Grade 1 diarrhea in 1 subject was considered to be possibly related to treatment. The results of this study indicated that, in humans, quizartinib was orally available and predominantly eliminated in feces, with renal clearance as a minor elimination route, and that AC886 was the only major metabolite in the circulation. Disclosures: Li: Ambit Biosciences: Employment. Bresnahan:Ambit Biosciences: Employment. Gammon:Ambit Biosciences: Employment. Sanga:Covance Laboratories, Inc.: Employment. Hale:Covance, Inc.: Employment. Hashimoto:Astellas Pharma, Inc.: Employment. Gill:Astellas Pharma, Inc.: Employment. James:Ambit Biosciences: Employment.

To function as a DNA-RNA helicase in rho-dependent transcript termination, six genetically identical subunits of the Escherichia coli transcription termination protein rho must first assemble into a hexameric complex. To help determine the quaternary structure of this complex, we have studied the association equilibria of the rho protomers. Sedimentation equilibrium, sedimentation velocity, diffusion, X-ray scattering, and neutron-scattering data have been combined to create a "phase diagram" of the association states of this protein as a function of protein concentration and ionic environment. The results show that rho exists predominantly as a hexamer under approximately physiological conditions and that this hexamer is in equilibrium with both lower and higher states of association that may also have physiological relevance. Small-angle X-ray scattering measurements and theoretical calculations indicate that the rho hexamer has a radius of gyration of 50 +/- 3 A. The radius of gyration measured by small-angle neutron scattering in 2H2O is 47 +/- 3 A. These scattering studies also support earlier models of rho as a planar hexagon which have been developed on the basis of electron microscopy. In the following paper in this issue [Geiselmann, J., Seifried, S. E., Yager, T. D., Liang, C.,von Hippel, P. H. (1992)], these results are combined with information on symmetry, subunit interactions, and packing geometry to obtain a model of the quaternary structure of the functional rho hexamer.

The E. coli RNA transcription cycle can be divided into three major phases, which are generally called initiation, elongation, and termination. In this paper, we review recent biophysical studies of the interactions of the transcriptional regulatory proteins, sigma 70 and NusA, with themselves and with core RNA polymerase in solution, as well as with core polymerase within the transcription complex. The different affinities of sigma 70 and NusA for core RNA polymerase at various stages in the transcription cycle, together with other quantitative data, are then used to construct a partial free energy diagram for the overall transcription process. This thermodynamic framework, which is interrupted by at least two irreversible steps, can be used to rationalize physiological aspects of the transcription cycle and its regulation, as well as to identify crucial points at which our knowledge is still incomplete.

Quantitative study of protein-protein and protein-ligand interactions in solution requires accurate determination of protein concentration. Often, for proteins available only in "molecular biological" amounts, it is difficult or impossible to make an accurate experimental measurement of the molar extinction coefficient of the protein. Yet without a reliable value of this parameter, one cannot determine protein concentrations by the usual uv spectroscopic means. Fortunately, knowledge of amino acid residue sequence and promoter molecular weight (and thus also of amino acid composition) is generally available through the DNA sequence, which is usually accurately known for most such proteins. In this paper we present a method for calculating accurate (to +/- 5% in most cases) molar extinction coefficients for proteins at 280 nm, simply from knowledge of the amino acid composition. The method is calibrated against 18 "normal" globular proteins whose molar extinction coefficients are accurately known, and the assumptions underlying the method, as well as its limitations, are discussed.