Search

One new species of the genus Garudinia Moore, 1882, G. ovata sp. nov., is described from China. Two species, G. pseudolatana Holloway, 2001 and G. biplagiata Hampson, 1896, are reported for the first time from China. The female genitalia of G. pseudolatana is described herein for the first time. The new species’ imagos and genitalia are illustrated and compared with related species. The distribution map of the genus Garudinia in China is provided.

Garudinia ovata sp. nov. (Figures 1, 2, 13, 18, 22) Type-material. Holotype: 1♂, China, Yunnan Province, Xishuangbanna Prefecture, Yexianggu scenic spot, 4– 5.VIII.2018, leg. H.L. Han, J. Wu & M.R. Li, genit. prep. no. ztt-225-1, in NEFU. Paratypes: 1♀, China, Yunnan Province, Pu’er City, Jiangcheng County, 15–17.IX.2008, leg. H.L. Han & E. Liu, genit. prep. no. ztt-178-1; 1♂, China, Yunnan Province, Pu’er City, Jiangcheng County, 15.II.2014, leg. H.L. Han & G.H. Zu, genit. prep. no. ztt-181-1; 1♂, China, Yunnan Province, Pu’er City, Jiangcheng County, 1–2.VIII.2018, leg. H.L. Han, J. Wu & M.R. Li, genit. prep. no. ztt-232-1; 1♂, same data as holotype, genit. prep. no. ztt-233-1; in NEFU., Published as part of Zhao, Ting-Ting, Wu, Jun & Han, Hui-Lin, 2023, One new species and two new records of the genus Garudinia Moore, 1882 (Lepidoptera, Erebidae, Arctiinae, Lithosiini) from China, pp. 188-194 in Zootaxa 5256 (2) on page 189, DOI: 10.11646/zootaxa.5256.2.6, http://zenodo.org/record/7745553

Garudinia pseudolatana Holloway, 2001 (Figures 4, 5, 15, 19, 22) Garudinia pseudolatana Holloway, 2001; Moths of Borneo 7: 391, pl. 6, f. 307. Type locality: Sarawak, Gunong Mulu Nat. Park. Material examined. 1♂, 3♀, China, Yunnan Province, Xishuangbanna Prefecture, Yexianggu scenic spot, 4 – 5.VIII.2018, leg. H.L. Han, J. Wu & M. R. Li, genit. prep. no. ztt-241-1, ztt-226-2, ztt-239-2, ztt-240-2; 1♀, China, Yunnan Province, Pu’er City, Jiangcheng County, 15.II.2014, leg. H.L. Han & G.H. Zu, genit. prep. no. ztt-190-2, in NEFU. Distribution (Fig. 22). China (Yunnan, New to China), India, Malaysia., Published as part of Zhao, Ting-Ting, Wu, Jun & Han, Hui-Lin, 2023, One new species and two new records of the genus Garudinia Moore, 1882 (Lepidoptera, Erebidae, Arctiinae, Lithosiini) from China, pp. 188-194 in Zootaxa 5256 (2) on pages 191-192, DOI: 10.11646/zootaxa.5256.2.6, http://zenodo.org/record/7745553, {"references":["Holloway, J. D. (2001) The Moths of Borneo: Family Arctiidae, subfamily Lithosiinae. Malaysian Nature Journal, 55, 279 - 458."]}

Garudinia biplagiata Hampson, 1896 (Figures 7, 8, 16, 20, 22) Garudinia biplagiata Hampson, 1896; Fauna Br. India (Moths) 4: 498. Type locality: Bhutan, 2500 ft. Material examined. 1♂, China, Yunnan Province, Pu’er City, Jiangcheng County, 1–2.VIII.2018, leg. H.L. Han, J. Wu & M.R. Li, genit. prep. no. ztt-229-1; 1♂, China, Yunnan Province, Pu’er City, Jiangcheng County, 15– 17.IX.2008, leg. H.L. Han & E. Liu, genit. prep. no. ztt-177-1; 1♂, China, Yunnan Province, Tengchong City, Gaoligong Mountain, 17.XI.2020, leg. K.L. Wu, genit. prep. no. ztt-189-1; 5♂, 1♀, China, Yunnan Province, Xishuangbanna Prefecture, Mengla County, Wangtianshu scenic spot, 27.XI.2020, leg. J. Wu et al., genit. prep. no. ztt-299-2, ztt-300-1, ztt-301-1, ztt-302-1, ztt-303-1, ztt-304-1; 2♂, China, Yunnan Province, Xishuangbanna Prefecture, Yexianggu scenic spot, 4–5.VIII.2018, leg. H.L. Han, J. Wu & M.R. Li, genit. prep. no. ztt-227-1, ztt-228- 2; 1♂, China, Yunnan Province, Xishuangbanna Prefecture, Mengla County, Wangtianshu scenic spot, 13.I.2013, leg. H.L. Han & Y. Ding, genit. prep. no. ztt-187-1; 1♂, 1♀, China, Yunnan Province, Xishuangbanna Prefecture, Mengla County, Mohan, 20.XI.2020, leg. J. Wu et al., genit. prep. no. ztt-305-1, ztt-306-2; 1♂, China, Yunnan Province, Ruili City, Rare Botanical Garden, 8.VIII.2005, leg. Y.D. Ren, genit. prep. no. ztt-297-1, in NEFU. Distribution (Fig. 22). China (Yunnan, New to China), India, Bhutan, Thailand, Peninsular Malaysia., Published as part of Zhao, Ting-Ting, Wu, Jun & Han, Hui-Lin, 2023, One new species and two new records of the genus Garudinia Moore, 1882 (Lepidoptera, Erebidae, Arctiinae, Lithosiini) from China, pp. 188-194 in Zootaxa 5256 (2) on page 193, DOI: 10.11646/zootaxa.5256.2.6, http://zenodo.org/record/7745553, {"references":["Hampson, G. F. (1896) The Fauna of British India, including Ceylon and Burma. Taylor and Francis (Volume 4), London, 594 pp."]}

Genus Garudinia Moore, 1882 Garudinia Moore, 1882: 59. Type species: Tospitis latana Walker, 1863. Type locality: Sri Lanka. Genera Garudinia Moore, 1882 and Padenia Moore, 1882 are similar externally. Both the forewings are white with two distinct marks; the hindwings of the females are similarly shaped, but those of the males are broad and marginally excavate. The diagnostic features between them are as follows. In Padenia, the forewing is narrower and slightly longer, with two narrow brown bands that run from the costal margin to the inner margin, and there are at least three medial sector veins involved in the branching system of the forewing. The ground color of the hindwing is lighter. Garudinia is characterized by its small to medium size. The forewings are oval-shaped, with a length of 6.5– 10 mm; the ground color is white, with two large purple black marks on the antemedial and subterminal areas; there are at most two medial sector veins involved in the branching system of the forewing. In the male genitalia, the valva is symmetrical and membranous; the costal process is usually developed, sclerotized, and apically narrowed while the saccular process is undeveloped, but in a few species the costal process is nonexistent, and the saccular process is developed, sclerotized, and apically narrowed. In the female genitalia, the base of the apophysis anterior is triangular, while the apophysis posterior is thinner, and obviously longer than the apophysis anterior; the ostium bursae is wrinkled; and the corpus bursae has a zone of spines., Published as part of Zhao, Ting-Ting, Wu, Jun & Han, Hui-Lin, 2023, One new species and two new records of the genus Garudinia Moore, 1882 (Lepidoptera, Erebidae, Arctiinae, Lithosiini) from China, pp. 188-194 in Zootaxa 5256 (2) on page 188, DOI: 10.11646/zootaxa.5256.2.6, http://zenodo.org/record/7745553, {"references":["Moore, F. (1882 - 1883) The Lepidoptera of Ceylon. Vol. 2. L. Reeve & Co., London, 162 pp.","Walker, F. (1863) List of the Specimens of Lepidopterous Insects in the collection of the British Museum, Part 27. Edward Newman, London, 286 pp."]}

Genus Ploneta Snellen, 1900 Ploneta Snellen in Piepers & Snellen, 1900, Tijdschr. Entomol. 43 (1): 105. Type species: Ploneta diducta Snellen, 1900. Darna (Ploneta): Holloway, 1986. Malay. Nat. J. 40 (1–2): 137. Note. The genus includes middle-sized moths and usually has sexual dimorphism: the female tending to have uniform brown forewings, and the males have a fine, pale postmedial line on generally darker ground. The tibial spurs are 0-2-4. In the male genitalia, the uncus and gnathos are more or less fused together, the rows of scales same as in Oxyplax and Darna are reduced or lost. In some members, e.g. diducta Snellen, 1900, flavina (Hering, 1931), and bradleyi (Holloway, 1987), the tegumen has prominent socii. The costal process to the valva is more cylindrical than flattened, not down cross the interior face of the valva. The male genitalia of P. hosei (Holloway, 1987) and the external descriptions of P. cotesi (Swinhoe, 1893) are very similar to that of Paroxyplax species. Perhaps, they belong to the genus Paroxyplax, but since the former one was described based on a single worn male, and we were not able to examine the types of both species, later examination of more material to determine the exact status is needed. The genus is reported for the first time from China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on pages 389-390, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Piepers, M. C. & Snellen, P. C. T. (1900) Enumeration des Lepidopteres Heteroceres recueillis a Java. Tijdschrift voor Entomologie, 43, 12 - 108.","Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165.","Hering, M. (1931) Limacodidae (Cochliopodidae). In: Seitz, A. (Ed.), Die Gross-Schmetterlinge der Erde. Vol. 10. Alfred Kerner Verlag, Stuttgart, pp. 665 - 728.","Holloway, J. D., Cock, M. J. W. & Desmier De Chenon, R. (1987) Systematic account of South-east Asian pest Limacodidae. In: Cock, M. J. W., Godfray, H. C. J. & Holloway, J. D. (Eds.), Slug and Nettle Caterpillars. CAB International, Wallingford, pp. 15 - 117.","Swinhoe, C. (1893) New species of Oriental moths. Annals and Magazine of Natural History, 12 (6), 210 - 225 + 254 - 265. https: // doi. org / 10.1080 / 00222939308677617"]}

Genus Orthocraspeda Hampson, 1893 Orthocraspeda Hampson, 1893, Fauna Br. India (Moths) 1: 373 (key), 393. Type species: Parasa trima Moore, 1860, by original designation. Thoseoides Shiraki, 1913, Spec. Rep. Formosa Agric. Expt. Sta. 8: 388, 391. Type species: Thoseoides fasciata Shiraki, 1913, by original designation. Darna (Orthocraspeda): Holloway, 1986. Malay. Nat. J. 40 (1–2): 139. Note. The genus includes middle-sized moths and obscure, brown in coloration. The male antennae are bipectinate till to the tip; female antennae are filiform. The forewing facies resembles Darna Walker, 1862, but usually with four black transverse fasciae (antemedian, median, postmedian, and subterminal fasciae). The tibial spurs are 0-2-4. The larvae are nettle-type. In the male genitalia, the uncus is bifid and split into lateral processes, but the processes are not balloon-shaped and lack the rows of scales ventrally; the process of costa in valva arise from very base rather than being displaced distally as in Darna and Oxyplax. In the female genitalia, there have a pair of sclerotized plates on the lamella vaginalis either side of the ostium; the signum in ductus bursae is variable, but usually is a scobinate zone or ridge set longitudinally., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on page 391, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Shiraki, T. (1913) Investigations upon general insect pests. Formosa Agricultural Experiment Station, Special Report, 8, 670 pp.","Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165.","Walker, F. (1862) Catalogue of the Heterocerous Lepidopterous insects collected at Sarawak, in Borneo, by Mr. A. R. Wallace, with descriptions of new species. Journal of the Proceedings of the Linnean Society, Zoology, 6, 82 - 145 + 171 - 198. https: // doi. org / 10.1111 / j. 1096 - 3642.1862. tb 00945. x"]}

Orthocraspeda sordida Snellen, 1900 Figures 25, 26, 31, 35, 36 Orthocraspeda sordida Snellen, 1900, Tijdschr. Ent. 43: 99. Type locality: “ Batavia (14 métres)” [Java]. Lectotype: male, in RMNH, designated by J. D. Holloway, 1986. Orthocraspeda luticrista Tams, 1924, J. nat. Hist. Soc. Siam 6: 280, pl. 17, fig. 7. Type locality: “ Bangkok ” [Thailand]. Holotype: male, in NHMUK. Material examined. 1 female, CHINA, Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Jinghong City, Mengyang Town, 4-5.VIII.2018, leg. HL. Han, J. Wu & MR. Li, genit. prep. WuJ-188-2, coll. NEFU; 1 male and 1 female, CHINA, Yunnan Province, Yuxi City, Yuanjiang County, Laohuqing, 29.XI.2020, leg. J. Wu, JJ. Fan, MR. Li & G. Fu, genit. prep. WuJ-496-1, WuJ-495-2, coll. NEFU. Diagnosis. This species differs from O. furva (Wileman, 1911) (Figs 27, 28, 32, 37), the only species of this genus known to occur in China previously, by the lack of the distinctive dark transverse fasciae on the forewing. It also resembles in appearance the rare Bornean member O. bornesordida (Holloway, 1986), but in the male genitalia of O. sordida Snellen, 1900 (Fig. 31), the valva is more erect, the sacculus is more angled, and the costal process also shares distinctly different features. Bionomics. The examined specimens were collected in southern Yunnan in August close to the tropical rainforest and in central Yunnan in November from a mango orchard. Distribution. China (Yunnan), Thailand, northern Vietnam, western Malaysia, Sumatra, Java. Remarks. This species is reported for the first time from China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on pages 391-392, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165.","Tams, W. H. T. (1924) List of moths collected in Siam by E. J. Godfrey, B. Sc., F. E. S. with descriptions of new species. Journal of the Natural History Society of Siam, 6, 229 - 289.","Wileman, A. E. (1911) New Lepidoptera-Heterocera from Formosa. The Entomologist, 44, 204 - 206."]}

Genus Darna Walker, 1862 Darna Walker, 1862, J. Proc. Linn. Soc. (Zool.) 6: 174. Type species: Darna plana Walker, 1862, by monotypy. Note. The genus includes middle-sized, being at least partly pale dull orange or pinkish orange moths. The male antennae are bipectinate till to the tip. The forewings are triangular in shape, with black discal spot and dark, not well defined, external fascia. The hind wings are pale. The tibial spurs are 0-2-4. The larvae are of the nettle-type. The male genitalia are diagnostic: the uncus is divided into two balloon-shaped parts, thickly covered with rows of scales; the gnathos is very slender and hook-shaped; the costal process in valva is a single flexed spine or with an apical patch of setae. The genus is reported for the first time from China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on page 393, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Walker, F. (1862) Catalogue of the Heterocerous Lepidopterous insects collected at Sarawak, in Borneo, by Mr. A. R. Wallace, with descriptions of new species. Journal of the Proceedings of the Linnean Society, Zoology, 6, 82 - 145 + 171 - 198. https: // doi. org / 10.1111 / j. 1096 - 3642.1862. tb 00945. x"]}

Paroxyplax nanlingensis sp. nov. Figures 1, 2, 7, 8 Type material. Holotype: male, CHINA, Hunan Province, Chenzhou City, Yizhang County, Mangshan National Nature Reserve, Jiangjunzhai scenic spot, 30.VII–7.VIII.2021, leg. J. Wu and Q. Lin, genit. prep. WuJ-633-1, coll. NEFU. Paratype: 1 male, same data as for holotype, genit. prep. WuJ-879-1, coll. NEFU. Diagnosis. P. nanlingensis sp. nov. (Figs 1, 2, 7, 8) is similar to P. menghaiensis Cai, 1984 (Figs 5, 11) and P. lineata Cai, 1984 (Figs 6, 12) in both appearance and male genitalia, but it can be distinguished by the following morphological characters: 1) the forewing relatively broad, the ground color is ochreous, with a dark transverse fascia beyond the discal cell to the outer margin, whereas the the same fascia in both P. menghaiensis and P. lineata are lacking, and the forewing is distinctly elongated, with a dark brown ground color in P. lineata; 2) the postmedial line in P. nanlingensis sp. nov. is narrow, slightly out-curved, whereas the same line is broader and very straight in P. menghaiensis; 3) in the male genitalia, the new species differs from P. menghaiensis by having a large uncus and smaller gnathos and juxta, however, it differs from P. nanlingensis sp. nov. by having lower parts of the gnathos and juxta that are larger; 4) differs from P. lineata by the large uncus and the basal process of the costa being shorter than the latter (about 1/2 the length of valva in P. nanlingensis sp. nov. and 4/ 5 in P. lineata); 5) the phallus is relatively slender, the apex without the deep angled incision but a sclerotized finger-shaper process; however, in P. menghaiensis and P. lineata, the phallus is short, with a deep angled incision apically. Description. Adult (Figs 1, 2). Forewing length 12 mm, wingspan 25 mm in male. Head and labial palpus ochreous; male antennae broad bipectinate till to tip, with longest rami in the middle. Thorax ochreous. Forewing broad, costal margin slightly concave; ground color ochreous to dark brown, with a dark, blurred fascia arising from base of discal cell and extends to outer margin; postmedial line distinct, broad, bright, pale yellow, slightly out-curved, runs from apex to inner margin at ca. 2/3 distance from wing base; terminal area grayish brown; terminal line broad, pale brown; fringe greyish brown. Hindwing ground color greyish brown, but pale yellow along with costal margin, and dark brown along with outer margin; terminal line fine, brown; fringe dark brown. Scales on legs brown. Abdomen brown to dark brown, with erect scale tuft at middle dorsally; brown ventrally. Male genitalia (Figs 7, 8). Uncus wide, triangular, slightly bifid and covered with long hairs apically. Gnathos divided into two parts: upper part small, with a row of strongly sclerotized, fine teeth; basal part large, stout, strongly sclerotized, sickle-shaped. Tegumen broad. Valva elongated, distinct swollen at base, quite narrow at subbase then gradually widening towards the end; cucullus rounded; base of costa has a large horn-shaped process, which ca. 1/2 the length of valva, with a sclerotized plate apically. Juxta broad, with a single, triangular medium process and two slightly curved lateral processes. Phallus straight, tube-shaped, with a small, sclerotized, finger-shaped apical process. Bionomics. The specimens were collected with a light trap at altitudes of 1,265 m a.s.l.; the collecting site is close to mixed coniferous and broad-leaved forests. Distribution. China (Hunan). Etymology. The new species is named after its type locality, the northern part of the Nanling Mountains in China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on pages 384-387, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694

Paroxyplax fusca sp. nov. Figures 3, 4, 9, 10 Type material. Holotype: male, CHINA, Yunnan Province, Lincang City, Zhenkang County, Fengwei Town, 26.V.2022, leg. J. Wu & B. Gao, genit. prep. WuJ-839-1, coll. NEFU. Paratypes: 1 male, CHINA, Yunnan Province, Lincang City, Zhenkang County, Mengdui Township, genit. prep. WuJ-788-1, coll. NEFU. Diagnosis. Paroxyplax fusca sp. nov. (Figs 3, 4, 9, 10) is allied to P. lineata (Figs 6, 12) because they share similarity in the features of body coloration and male genitalia, however, P. fusca sp. nov. has a smaller body size in adults than the latter, with the forewing length only 9-10 mm and wingspan 19-22 mm in male (11-12 mm and 24-26 mm in P. lineata), and the forewing is not elongated as in P. lineata. The male genitalia are diagnostic: 1) in P. fusca sp. nov., the uncus is reduced, just showing in a disk-shaped process, whereas in P. lineata the uncus is distinct, rounded apically; 2) the upper part of gnathos is coronoid, lower part slender, claw-shaped, whereas the same structures in P. lineata are a row of fine teeth with a very small coronoid process, and stout and foot-shaped; 3) the cucullus of valva is narrow, but rounded in P. lineata; 4) the base process of costa is tapering to a point with a small apical process, however, the same structure is swollen in the basal half and thin in the distal half, with a long, claw-shaped apical process; 5) the base of sacculus distinctly projected, which is smoothly curved in P. lineata; 6) the phallus is tapering to a point with a sclerotized, leaf-shaped apical process, whereas in P. lineata, the phallus is tube-shaped, with an angled incision apically. Description. Adult (Figs 3, 4). Forewing length 9-10 mm, wingspan 19-22 mm in male. Head and labial palpus dark brown; male antennae dark, broad bipectinate till to tip, with longest rami in the middle. Thorax dark brown. Costal margin of forewing slightly concave; ground color dark brown, posterior area slightly paler than ground color; postmedial line burred, straight, runs from costal margin near apex to inner margin at ca. 2/3 distance from wing base; fringe dark brown. Hindwing ground color dark brown; fringe dark brown. Scales on legs pale brown. Abdomen dark brown. Male genitalia (Figs 9, 10). Uncus reduced, just showing in a disk-shaped process. Gnathos divided into two parts: upper part coronoid, strongly sclerotized; basal part slender, long, claw-shaped, strongly sclerotized apically. Tegumen broad. Valva elongated, narrow at subbase but widening at middle; cucullus narrow, somewhat pointed; base of sacculus distinctly projected; basal process of costa large, horn-shaped, which ca. 4/5 the length of valva, with a small, sclerotized, triangular plate apically. Juxta broad, with a single, triangular medium process and two short lateral processes. Phallus nearly conical in shape, tapering to a point from caecum; terminal part with a sclerotized, leaf-shaped apical process. Bionomics. The specimens were collected with a light trap at altitudes of 877 m a.s.l. in western Yunnan, the collecting site is close to a broad-leaved forest, agricultural fields, and tea plantations. Distribution. China (Yunnan). Etymology. The specific name is derived from the Latin “fuscus”, meaning “dark-colored, somber, and dusky” and refers to the dark brown ground color of the body., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on page 387, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694

Genus Paroxyplax Cai, 1984 Paroxyplax Cai, 1984, Acta Entomol. Sin. 27 (2): 211, 213. Type species: Paroxyplax menghaiensis Cai, 1984, by original designation. Note. The genus includes middle-sized moths with brownish ground color. The male antennae are bipectinate till to the tip, with a cluster of long scale tuft at distal 1/4; female antennae are filiform. The labial palpi are slightly up-curved, but not reaching beyond the frontal tuft. The thorax and abdomen are stout, densely covered with scales; the base of tegula bearing an erect angled scale tuft, the same tuft also present at the middle of metathorax and basal segment of dorsally abdomen. The basal half of the costal margin in the forewing are straight, the distal half are slightly arched; the apes is pointed; the tornus is rounded. The tibial spurs are 0-2-4. The male genitalia are highly modified, the uncus is very short; the gnathos is divided into upper and lower parts; the valva is slender, with a distinct, large, horn-shaped process at the base of the costa; the juxta is developed. The phallus is moderately stout and straight, usually split at the terminal part. In the female genitalia, the papillae anales is broad; the anterior apophyses is short, whereas the posterior apophyses is slender; the lamella postvaginalis is large, but without the plate-shaped process; the ductus bursae is short and straight; the corpus bursae is large, without signa., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on page 384, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694

Ploneta diducta Snellen, 1900 Figures 18, 24 Ploneta diducta Snellen, 1900, Tijdschr. Entomol. 43 (1): 105, pl. 4, f. 9, pl. 3, f. 7-8. Type locality: Java, Batavia, Buitenzorg. Darna (Ploneta) diducta: Holloway, 1986. Malay. Nat. J. 40 (1–2): 144. Material examined. 1 male, CHINA, Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Mohan Town, 19.XI.2020, leg. J. Wu, JJ. Fan, MR. Li & G. Fu, genit. prep. WuJ-873-1, coll. NEFU. Diagnosis. Ploneta diducta (Fig. 18) is charactered by the rather elongated dark brown forewings with a fine, pale postmedial line and a notch in the outer margin at the position of vine R 5. In the male genitalia (Fig. 24), the uncus and gnathos are strongly sclerotized and almost fused together; the socii of tegumen are slender, tapering to the apical. Bionomics. This single specimen was collected from southern Yunnan, which borders Laos, and the collecting site was close to the tropical rainforest. Distribution. China (Yunnan), southern Thailand, western Malaysia; Borneo; Indonesia (Sumatra, Java); Philippines (Luzon). Remarks. This species is reported for the first time from China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on page 391, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165."]}

Oxyplax bannaensis sp. nov. Figures 17, 23 Type material. Holotype: male, CHINA, Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, 14.I.2013, leg. HL. Han, genit. prep. WuJ-716-1, coll. NEFU. Diagnosis. Externally, the new species (Figs 17, 23) is similar to O. yunnanensis Cai, 1984 (Figs 13, 19), O. caii (Holloway, 1986) (Figs 14, 20), and O. pallivitta (Moore, 1877) (Figs 15, 16, 21, 22), but it can be separated by the following morphological characters: 1) the overall color is grayish brown in O. bannaensis sp. nov., whereas ochreous to dark brown in O. caii, O. yunnanensis, and O. pallivitta; 2) the postmedial line is straight, the terminal area is greyish white, whereas the same line and area are slightly out-curved and dark brown, respectively; 3) in the male genitalia, the costa of valva is strongly arched, however, it is only slightly arched in O. caii and O. yunnanensis, and concaved in O. pallivitta; 4) the process in subcosta is slender, about 1/5 of its own length beyond the lower margin of valva, however, the process is wider than the former and barely extends beyond the lower margin of the valva in O. caii and O. yunnanensis, and lacking the same structure in O. pallivitta; 5) the base of sacculus is smooth, without setae, whereas sparsely covered with setae in O. pallivitta and densely in O. caii and O. yunnanensis; 6) the phallus is short, slightly curved, whereas it is relatively long in the three comparative species, and in O. caii and O. pallivitta is straight. Description. Adult (Fig. 17). Forewing length 12 mm, wingspan 26 mm in male. Head and labial palpus dark brown tinted grey; male antennae dark, broad bipectinate till to tip. Thorax dark brown tinted grey. Costal margin of forewing slightly concave; ground color dark brown to greyish brown; postmedial line distinct, grey, straight, runs from apex to middle of inner margin; terminal area greyish white tinted some pale brown; fringe greyish brown. Hindwing ground color dark rufous brown; fringe along outer margin rufous brown at base with an outer greyish brown layer. Scales on legs greyish brown. Abdomen dark rufous brown. Male genitalia (Fig. 23). Uncus bifid into two lateral parts, each part densely covered with black scales. Gnathos slender, hook-shaped. Tegumen broad. Valva elongated, cucullus narrow; costa distinctly arched in the middle, costal processes slender, ca. 1/5 of its length beyond the lower margin of valva, blunt and slightly curved apically; base of sacculus swollen, smooth, without setae. Juxta small, shield-shaped. Phallus small, short, slightly curved; terminal part pointed and sclerotized, with an angled incision on one side. Bionomics. The specimen was collected with a light trap at Mengla county in southern Yunnan, the collecting site is close to the tropical rainforest. Distribution. China (Yunnan). Etymology. The specific name is derived from “banna”, the abbreviation of the type locality Xishuangbanna Dai Autonomous Prefecture in the southwestern part of Yunnan Province, China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on page 388, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165.","Moore, F. (1877) New species of Heterocerous Lepidoptera of the tribe Bombyces, collected by Mr. W. B. Pryer chiefly in the district of Shanghai. Annals and Magazine of Natural History, 94 (20), 83 - 94. https: // doi. org / 10.1080 / 00222937708682201"]}

Darna sybilla (Swinhoe, 1903) Figures 29, 33 Thosea sybilla Swinhoe, 1903, Ann. Mag. nat. Hist. (7): 502. Type locality: “ Siam, Muok-Lek, 1000 feet ” [Thailand]. Lectotype: male, in NHMUK, designated by Solovyev & Witt, 2009: 190. Material examined. 1 male, CHINA, Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Menglun Town, 8.VIII.2018, leg. HL. Han, J. Wu & MR. Li, genit. prep. WuJ-146-1, coll. NEFU; 1 male, CHINA, Yunnan Province, Pu’er City, Manxieba, 3.VIII.2018, leg. HL. Han, J. Wu & MR. Li, genit. prep. WuJ-241-1, coll. NEFU; 1 male, CHINA, Yunnan Province, Baoshan City, Shidian County, Jiucheng Township, 11.XI.2020, leg. J. Wu, JJ. Fan, MR. Li & G. Fu, genit. prep. WuJ-493-1, coll. NEFU. Diagnosis. Externally D. sybilla (Fig. 29) is similar to its congener D. metaleuca (Walker, 1862) (Fig. 30), but the black mark in the distally costal margin of forewing is small, inconspicuous; in the male genitalia (Fig. 33), the valva is narrower than the latter, and the costal process is slender rather than short and stout as in D. metaleuca (Fig. 34). It is also similar to O. sordida (Fig. 25) externally, the difference is that the forewing pattern of this species is usually more unicolorous; in male genitalia, the uncus is divided into two balloon-shaped parts, the gnathos is slender, and the shape of costal process are diagnostic. Bionomics. The specimens were collected at southern and western Yunnan in August and November, the collecting sites are usually close to the tropical or subtropical rainforests. Distribution. China (Yunnan), Thailand, Vietnam. Remarks. This species is reported for the first time from China., Published as part of Wu, Jun & Han, Hui-Lin, 2023, New species and records of Paroxyplax Cai, 1984 (Lepidoptera: Limacodidae) and its allies from China, with a checklist of the treated genera, pp. 383-397 in Zootaxa 5254 (3) on pages 393-394, DOI: 10.11646/zootaxa.5254.3.5, http://zenodo.org/record/7727694, {"references":["Swinhoe, C. (1903) New species of Eastern and African Lepidoptera. Annals and Magazine of Natural History, 11 (7), 499 - 511. https: // doi. org / 10.1080 / 00222930308678810","Solovyev, A. V. & Witt, T. J. (2009) The Limacodidae of Vietnam. Entomofauna, Supplement 16, 33 - 229.","Walker, F. (1862) Catalogue of the Heterocerous Lepidopterous insects collected at Sarawak, in Borneo, by Mr. A. R. Wallace, with descriptions of new species. Journal of the Proceedings of the Linnean Society, Zoology, 6, 82 - 145 + 171 - 198. https: // doi. org / 10.1111 / j. 1096 - 3642.1862. tb 00945. x"]}

Genus Striogyia Holloway, 1986 Striogyia Holloway, 1986. Malayan Nature Journal, 40 (1–2): 136. Type species: Striogyia snelleni Holloway, 1986 (Malaysia: Sarawak), by original designation. Diagnosis. Members of the genus Striogyia are medium-sized moths; the ground color is from brown to dark brown. The forewing venation is typical of the Darna Walker, 1862 group, but the male antennae are always filiform rather than bipectinate as in Darna species. Most of their forewings have a distinct, oblique postmedial line running almost from the apex to the posterior margin. In the male genitalia, the uncus is rectangular or triangular; the gnathos is slender or absent; the transtilla is well developed, strongly sclerotized; the interior of the sacculus bears a setose papilla or a prominent spine. The eighth sternite is modified, which is sclerotized, distal margin concave, and densely covered with setae (Holloway 1986)., Published as part of Wu, Jun & Han, Hui-Lin, 2022, Striogyia bifidijuxta sp. nov., a new slug caterpillar moth (Lepidoptera: Zygaenoidea: Limacodidae) from China, pp. 92-96 in Zootaxa 5219 (1) on page 92, DOI: 10.11646/zootaxa.5219.1.6, http://zenodo.org/record/7408333, {"references":["Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165.","Walker, F. (1862) Catalogue of the Heterocerous Lepidopterous insects collected at Sarawak, in Borneo, by Mr. A. R. Wallace, with descriptions of new species. Journal of the Proceedings of the Linnean Society, Zoology, 6, 82 - 145, 171 - 198. https: // doi. org / 10.1111 / j. 1096 - 3642.1862. tb 00945. x"]}

Ovipennis multicornuta Huang, Volynkin, Zhao & Han sp. n. (Figs 9, 16) Ovipennis (Ovipennis) sp.: Huang et al. 2021: fig. 3. Type material. Holotype (Figs 1, 17): male, “ 30-VI-2019 | Fengtongzhai, Baoxing County, Ya’an City, Sichuan Province, China [in Chinese] | HSY TSY CCL [leg. Si-yao Huang, Shun-yun Tan & Cheng-long Cao]” / [gen. prep. No.:] “ LHSY117 ” (Coll. SCAU). Diagnosis. Externally, Ovipennis multicornuta sp. n. is reminiscent of O. postalba and O. semilutea but distinguished by the larger size, the somewhat smaller yellowish patch, and the outer darkish pattern forming a diffused large patch. In male genital capsule, the uncus is somewhat longer than in the congeners, and the transtilla lacks dorsal lobes, similar to that in O. semilutea. The phallus of the new species is broader than in the congeners. The vesica of O. multicornuta sp. n. is broader than in O. postalba and O. semilutea and sack-like, with a small dorsal basal diverticulum and the surface of its main chamber scattered by several clusters of long and thick cornuti, while the vesica is totally membranous without sclerotized elements in O. postalba, and lobe-like with a single distal cluster of cornuti in O. semilutea. Description. Male. Length of forewing 9.7 mm in holotype. Antenna brownish with white scales scattered at basal half section. Head, thorax and abdomen covered with whitish scales. Forewing moderately broad, with ochreous-yellowish patch present from subbasal to medial section and larger brownish diffused patch from medial to submarginal section. Forewing cilia whitish. Hindwing monotonous creamy white, cilia whitish. Male genitalia. Uncus slender and curved subapically. Tegumen triangular, short and broad. Transtilla smooth. Juxta shield-like. Saccus broad and short, U-shaped. Valva dilated distally, thoroughly sclerotized. Distal margin of costa somewhat dentate. Sacculus thick and stout basally, gradually tapered towards distal end. Distal saccular process short and apically pointed. Phallus short and broad, slightly tapered distally. Vesica sack-like with small dorsal basal diverticulum and main chamber bearing several clusters of long and thick cornuti. Female unknown. Distribution. Known only from Western Sichuan Province in Southwestern China. Etymology. The specific epithet “ multicornuta ” refers to the presence of numerous cornuti in the phallus vesica., Published as part of Zhao, Ting-Ting, Volynkin, Anton V., Huang, Si-Yao & Han, Hui-Lin, 2022, Contribution to the knowledge of the genus Ovipennis Hampson, 1900 with descriptions of two new species from Southern and Southwestern China (Lepidoptera, Erebidae, Arctiinae, Lithosiini), pp. 483-492 in Zootaxa 5178 (5) on pages 487-490, DOI: 10.11646/zootaxa.5178.5.5, http://zenodo.org/record/7034036, {"references":["Huang, S. Y., Volynkin, A. V., Miao, Z. P., Tan, S. Y., Wang, M. & Fan, X. L. (2021) Molecular phylogeny and classification of Nudariina (Lepidoptera: Erebidae) with emphasis on the genera Barsine Walker, Ammatho Walker and Ovipennis Hampson. Systematic Entomology, 46 (4), 1045 - 1059. https: // doi. org / 10.1111 / syen. 12509"]}

Ovipennis mixta Huang, Zhao, Volynkin & Han, sp. n. (Figs 6–8, 14, 15) Gymnasura semilutea: Kishida 2011: 223, pl. 26 fig. 4. [misidentification] Type material. Holotype (Figs 1, 17): male, [Baishaogou, Zunyi City, Guizhou Province, China] “ Guizhou, Zunyi | Xintiankan | 6–7 VIII 2020 | HL Han, J Wu”, gen. prep. No.: ztt-360-1 (Coll. NEFU). Paratypes: 7 males, the same data as in the holotype, gen. prep. Nos.: ztt-358-1, ztt-359-1, ztt-361-1, ztt-673-1, ztt-374-1, ztt-375-1, ztt-376-1 (Coll. NEFU); 1 male, 3–5.VIII.2020, Shuanghe County, Zunyi City, Guizhou Province, China, leg. H.L. Han & J. Wu, gen. prep. No.: ztt-671-1 (Coll. NEFU); 3 males, 30.VII–7.VIII.2021, Mt. Mangshan, Yizhang City, Hunan Province, China, J. Wu & Q. Lin, gen. prep. Nos.: ztt-668-1, ztt-669-1, ztt-670-1 (Coll. NEFU). Diagnosis. Externally, Ovipennis mixta sp. n. is reminiscent of O. milani, O. postalba and O. semilutea but distinguished by the combination of the following characters. (1) The forewing dorsum is without a short blackish streak, similar to O. postalba and O. semilutea, while such a streak is present in O. milani. (2) The yellowish patch on the forewing is fused with the darkish band distal to it, similar to that in O. milani, while these two patterns are interrupted by a whitish area in O. postalba and O. semilutea. (3) The hindwing bears a diffused submarginal band, while it is monotonous creamy white in O. milani, and bearing a subapical spot in O. postalba and O. semilutea. (4) In the male genitalia, the transtilla has two broad and short lobes with numerous spinules covering its inner margin, while such lobes are smaller and covered thoroughly with smaller spinules in O. postalba, and absent in O. milani and O. semilutea. (5) The valva is narrower and its extreme distal section is bending downwards, similar to that in O. semilutea, while in O. milani and O. postalba, the valva is broader with the extreme distal section extended upwards. (6) The valva lacks a rod-like clasper as in O. postalba and O. semilutea, similar to O. milani. (7) The costa bears dentation at the distal margin, similar to that in O. postalba and O. semilutea, while the costa of O. milani is smooth. (8) The distal saccular process is elongate and curved downwards medially, while it is straight and shorter in O. milani and O. semilutea, and rounded and shorter in O. postalba. (9) The phallus vesica is narrower than in the congeners, slender and lacking a basal cluster of cornuti, the distal cluster of cornuti is attached directly at the surface of the main chamber of the vesica, and the distal section of the vesica bears a granulation field, while the distal cluster of cornuti is attached at the surface of a small lateral diverticulum and the distal section of vesica bears no granulation field in O. milani; the vesica is sack-like without sclerotized structures in O. postalba; and the vesica is longer with a distal cluster consisting of longer cornuti in O. semilutea. Description. Male. Length of forewing 7.0– 7.8 mm (7.0 mm in holotype). Antenna ochreous with white scales scattered at basal section. Head, thorax and abdomen covered with whitish scales. Forewing moderately broad, with large golden yellowish patch present from subbasal to postmedial section. Veins in patch tinged with ochreous, and broad, darkened ochreous border present distal to yellowish patch. Diffused blackish band present distal to ochreous border. Submarginal zone with two small diffused brownish patches. Forewing cilia whitish. Hindwing ground color creamy white with broad diffused submarginal band. Hindwing cilia whitish. Male genitalia. Uncus slender and curved subapically. Tegumen triangular, short and broad. Transtilla with two broad and short lobes covered with numerous spinules inwardly. Juxta shield-like. Saccus broad and short, Ushaped. Valva elongate and lobular, thoroughly sclerotized with distal end bending downwards. Distal margin of costa dentate. Sacculus thick and stout basally and gradually tapered towards the distal end. Distal saccular process short and curved downwards medially, apically pointed. Phallus short and narrow, tubular and straight. Vesica lobelike, simple and narrow, with distal part bearing granulation field and cluster of tiny cornuti. Female unknown. Remarks. This species was erroneously identified as Gymnasura semilutea (now Ovipennis semilutea) in Kishida (2011). Distribution. Guizhou, Hunan and Guangdong Provinces (Kishida 2011, as Ovipennis semilutea) in Southwestern and Southern China. Etymology. The specific epithet “ mixta ” refers to the features of the new species are mixture of the characters from its congeners.

Ovipennis milani (Černý, 2009), comb. n. (Figs 2–5, 12, 13, 19, 20) Idopterum milani Černý in Černý & Pinratana 2009: 102, fig. 203. Nanarsine milani Černý: Volynkin et al. 2019: 78. Type material examined. Holotype: (Fig. 2) male, printed white label “N. Thailand | Chiang Mai-prov., | Doi Inthanon-NP, 1416m | 18°30′59″N, 98°28′13″ E | 30. IV. 2006 leg. K. Cerný [Černý]” / printed red label “HOLOTYPE | Idopterum | milani sp. n. | Karel Černý 2009 ” / printed white QR-code label with a unique number: “ NHMUK010605737 ” (Coll. NHMUK) . Paratypes: 2 males, N Thailand, Lampang, Chae Son NP, 1496m, 18°51.080'N, 99°22.016'E, 10. V.2008, leg. K. Černý, gen. prep. No.: AV2570 (prepared by Volynkin) (Coll. CKC); 1 female (Fig. 3), N Thailand, Chiang Mai Prov., Fang distr., Doi Pha Hom Pok, 1400 m, 20°02′54″N, 99°09′49″E, 28–29.XI.2005, leg. K. Černý, gen. prep. No.: AV2571 (prepared by Volynkin) (Coll. CKC); 1 female, N Thailand, Chiang Mai Prov., Fang distr., Doi Pha Hom Pok, 2050 m, 20°07′30″N, 99°08′49″E, 21.IV.2006, leg. K. Černý (Coll. CKC); Additional material examined. CHINA: 1 male, Yunnan Province, Pu’er City, 6.VII.2013, H.L. Han, gen. prep. No.: ztt-691-1 (Coll. NEFU); 1 male, 1 female, Yunnan Province, Pu’er City, Taiyanghe National Forest Park, 7.VIII.2013, S. R. Liu, Y.Q. Wang & K.J. Teng, gen. prep. Nos.: ztt-367-1 (male), ztt-366-2 (female) (Coll. NEFU); 1 male, Yunnan Province, Tengchong City, Huanxipo, 4–6.VIII.2014, H.L. Han, genit. prep. No.: ztt-379- 1 (Coll. NEFU); 3 males, Xizang Autonomous Region, Linzhi (= Nyingchi) City, Motuo (= Medog) County, 107K, 12–14.IV.2018, H.L. Han, genit. prep. Nos.: ztt-62-1, ztt-63-1, ztt-64-1 (Coll. NEFU); 2 males, Xizang Autonomous Region, Linzhi City, Motuo County, 16–17.IV.2018, H.L. Han, genit. prep. Nos.: ztt-362-1, ztt-363-1 (Coll. NEFU); 1 male, Yunnan Province, Lvchun County, Mt. Huanglianshan, 27–31.VII.2018, H.L. Han, J. Wu & M. R. Li, genit. prep. No.: ztt-376-1 (Coll. NEFU); 1 male, 1 female, Yunnan Province, Jiangcheng County, 1–2.VIII.2018, H.L. Han, J. Wu & M. R. Li, genit. prep. Nos.: ztt-365-1 (male), ztt-364-1 (female) (Coll. NEFU); 1 male, NW Yunnan, Nu Jiang valley, road Fugong / Gongshan, H- 1800 m, N 27°18.24″, E 98°53.20″, 17. V.2018, leg. Butvila & Saldaitis (Coll. ASV); 1 female, same locality and collectors as previous but 18. V.2018 (Coll. ASV). VIETNAM: 1 male, 1600m, Fan-si-pan Mt. (North), Cha-pa, primary forest, 22°17'N 103°44'E, 20–30.IV.1995, leg. V. Sinyaev & local collectors, genit. prep. No.: MWM 31.454 (prepared by Volynkin) (Coll. MWM / ZSM). Remarks. 1) In the analysis, the genus Ovipennis is found to be a monophyletic group receiving strong support from both methods (Fig. 1, UFBS=100, PP=1). Nanarsine milani is embedded in Ovipennis and clustered with Ovipennis multicornuta sp. n. with moderate support from both methods (Fig. 1, UFBS=63, PP=0.58), while the type species of the genus Nanarsine Volynkin, 2019, N. porphyrea (Snellen, 1880) is grouped with the species of the genera Barsilene Volynkin & Huang, 2019, Floridasura Volynkin, 2019 and Asura Walker, 1854 and the topology of this part is exactly the same as in Huang et al. (2021). Hence we transfer this species from Nanarsine to Ovipennis, viz. O. milani (Černý, 2009) comb. n. 2) This species is hereby recorded from Vietnam and China for the first time. Diagnosis. Ovipennis milani is characterized by the presence of a large golden patch on forewing and a short blackish streak on forewing dorsum. In male genitalia, the species is characterized by the sack-like phallus vesica with two clusters of small cornuti, of which one is positioned basally while the other one is positioned at the surface of a small diverticulum distally. Distribution. Northern Thailand, Northern Vietnam * and Southwestern China *(Xizang, Yunnan)., Published as part of Zhao, Ting-Ting, Volynkin, Anton V., Huang, Si-Yao & Han, Hui-Lin, 2022, Contribution to the knowledge of the genus Ovipennis Hampson, 1900 with descriptions of two new species from Southern and Southwestern China (Lepidoptera, Erebidae, Arctiinae, Lithosiini), pp. 483-492 in Zootaxa 5178 (5) on page 486, DOI: 10.11646/zootaxa.5178.5.5, http://zenodo.org/record/7034036, {"references":["Cerny, K. & Pinratana, A. (2009) Moths of Thailand. Vol. 6. Arctiidae. Brothers of Saint Gabriel in Thailand, Bangkok, 283 pp.","Volynkin, A. V., Huang, S. - Y. & Ivanova, M. S. (2019) An overview of genera and subgenera of the Asura / Miltochrista generic complex (Lepidoptera, Erebidae, Arctiinae). Part 1. Barsine Walker, 1854 sensu lato, Asura Walker, 1854 and related genera, with descriptions of twenty new genera, ten new subgenera and a check list of taxa of the Asura / Miltochrista generic complex. Ecologica Montenegrina, 26, 14 - 92. https: // doi. org / 10.37828 / em. 2019.26.3","Snellen, P. C. T. (1880) Natuurlijke Historie. Achtse afdeeling. Lepidoptera door P. C. T. Snellen, met eene inleiding door Joh. F. Snelleman. Midden-Sumatra. Midden-Sumatra, 4 (8), 1 - 84, pl. 1 - 2. [in Dutch]","Walker, F. (1854) List of the specimens of lepidopterous insects in the collection of the British Museum. Vol. 2. Trustees of the British Museum, London, 303 pp. [pp. 279 - 581]","Huang, S. Y., Volynkin, A. V., Miao, Z. P., Tan, S. Y., Wang, M. & Fan, X. L. (2021) Molecular phylogeny and classification of Nudariina (Lepidoptera: Erebidae) with emphasis on the genera Barsine Walker, Ammatho Walker and Ovipennis Hampson. Systematic Entomology, 46 (4), 1045 - 1059. https: // doi. org / 10.1111 / syen. 12509"]}

The knowledge of the genus Ovipennis Hampson, 1900 is updated. Nanarsine milani (Černý, 2009) is recorded from China and Vietnam for the first time and transferred to the genus Ovipennis based on multilocus molecular phylogenetic and morphological analyses: O. milani (Černý, 2009), comb. n. Two new species related to Ovipennis semilutea species-group are described: O. mixta Huang, Zhao, Volynkin & Han, sp. n. from Guizhou and Hunan and O. multicornuta Huang, Volynkin, Zhao & Han, sp. n. from Sichuan. Adults and genitalia of the aforementioned taxa are illustrated.

Genus Pseudohampsonella Solovyev & Saldaitis, 2014 Pseudohampsonella Solovyev & Saldaitis, 2014, Journal of Insect Science, 14 (46): 3. Type species: Pseudohampsonella erlanga Solovyev & Saldaitis, 2014, by original designation. Type locality: China, Sichuan (Erlangshan Mts).

Pseudohampsonella medogensis sp. nov. Figures 1, 2, 5, 6, 9, 10, 11 Type-material. Holotype: male, China, Xizang Autonomous Region (= Tibet), Linzhi (= Nyingchi) City, Motuo (= Medog) County, Gedang Countryside, 25–30.V.2021, legs J. Wu & JJ. Fan, genit. prep. WuJ-562-1 with GenBank Accession No. OM 307230, in NEFU. Paratypes: 2 males, 1 female, same data as for holotype, genit. prep. WuJ-532-1 with GenBank Accession No. OM 307228 (male), WuJ-533-2 with GenBank Accession No. OM 307229 (female), all in NEFU. Diagnosis. Externally, the new species (Figs 1, 2) is similar to P. bayizhena (Fig. 3) and P. hoenei (Fig. 4), but it can be separated by the following morphological characters (character states for related species are parenthesized): in P. medogensis sp. nov., the forewing, thorax, and abdomen are densely diffused with silvery scales (in P. bayizhena and P. hoenei are without silvery scales on the body); the forewing without distinct rounded whitish spots along the postmedial line (in P. bayizhena and P. hoenei, the postmedial line consists of rounded whitish spots). The male genitalia of the new species (Figs 5, 6) are diagnostic. The new species differs from P. bayizhena (Fig. 7), P. hoenei (Fig. 8), and other congeners by the apex of uncus being blunt and the phallus strongly curved mesally; whereas in all congeners, the uncus is acute apically and the phallus is almost straight or only weakly curved. In the female genitalia, P. medogensis sp. nov. (Fig. 9) is easily distinguished from the congeners with known female genitalia (P. erlanga, P. argenta, and P. lii) by the corpus bursae with a single star-shaped signum; whereas in P. erlanga and P. argenta, the corpus bursae has a small area of stellate signa and in P. lii the signum is absent. Description. Adult (Figs 1, 2). Forewing length 11–12 mm, wingspan 25–26 mm in male; 14 mm and 28 mm in female. Head and labial palpus pale brown; antenna brown, weakly serrate and somewhat flattened in male, filiform in female; proboscis absent. Thorax silvery white mixed with brown scales. Forewing ground color brown to dark brown, suffused with silver; antemedial line zigzag-like, weakly defined dark brown embedded with silver; forewing without distinct rounded whitish spots along postmedial line; discal spot conspicuous, rounded, silver encircled with dark brown to black scales; postmedial line sinuous, dark brown, from approximately 3/4 of costal margin from wing base to tornus; posterior area of M 2 and terminal area greyish white but with diffuse dark brown scales near tornus; terminal line dark brown, mixed with silver scales; fringe along outer margin brown at base with an outer dark brown layer. Hindwing ground color brown; terminal line distinct, dark brown; fringe brown. Scales on legs pale brown; tibial spurs 0-2-4. Abdomen brown, mixed with dark brown and silver scales dorsally; ventral side silvery white, black, and dark brown from anterior to terminal area, respectively. Female similar in pattern except somewhat duller in coloration. Male genitalia (Figs 5, 6). Uncus longer than valva, strongly sclerotized, deeply divided into a pair of pincerlike lobes; each lobe very slender, slightly waved, broad basally and blunt apically. Gnathos reduced, represented by a waved, strongly sclerotized process connecting two basal parts of uncus lobes. Valva nearly semicircular in shape proximally, bearing a strongly sclerotized process down-curved, apex pointed; distal portion of sacculus densely covered with long setae. Juxta faintly sclerotized, shield-shaped, with a deep medial incision. Phallus tube-shaped, tapering to apex, strongly curved medially. Female genitalia (Fig. 9). Papillae anales flattened, ear-shaped, covered with dense setae, particularly dense in apical area; margins have a deep cleft subapically. Anterior apophysis robust, blunt apically; posterior apophysis long and slender, approximately twice longer than anterior apophysis. Vaginal plate strongly sclerotized, spinulate. Antrum swollen, strongly sclerotized, densely covered with spinules. Ductus bursae membranous, with two medial, arc-curved, slender, strongly sclerotized, longitudinal ribbons. Corpus bursae pear-shaped, with a single star-shaped signum. Bionomics. The type series was collected in late May at altitudes of 2,120 m, closing to the subtropical mixed forest, with massive shrubs, ferns and patches of grassland growing in the ground cover layer of the forest (Fig. 10). Distribution. Pseudohampsonella medogensis sp. nov. is currently known only from Motuo (= Medog) County of the Xizang Autonomous Region (= Tibet), China (Fig. 11). Etymology. The new species is named after the Tibetan name of its type locality “Medog” County of Xizang Autonomous Region (= Tibet), China., Published as part of Wu, Jun, Zhao, Ting-Ting & Han, Hui-Lin, 2022, A new species of the genus Pseudohampsonella Solovyev & Saldaitis (Lepidoptera: Limacodidae) from Xizang Autonomous Region, China, pp. 67-74 in Zootaxa 5138 (1) on pages 69-71, DOI: 10.11646/zootaxa.5138.1.6, http://zenodo.org/record/6552200, {"references":["Pan, Z. H. & Wu, C. S. (2015) New and little known Limacodidae (Lepidoptera) from Xizang, China. Zootaxa, 3999 (3), 393 - 400. https: // doi. org / 10.11646 / zootaxa. 3999.3.4","Solovyev, A. V. & Saldaitis, A. (2014) Pseudohampsonella: a new genus of Limacodidae (Lepidoptera: Zygaenoidea) from China, and three new species. Journal of Insect Science, 14 (46), 1 - 14. https: // doi. org / 10.1093 / jis / 14.1.46"]}

Pseudonagoda zhejiangensis sp. nov. Figures 1, 2, 4, 5, 7, 8, 10, 12���27 Type-material. Holotype: ♂, China, Zhejiang Province, Hangzhou City, Hangzhou Botanical Garden, 9 m a.s.l., 30��15'14.48" N, 120��07'24.67" E, 11.VII.2020, reared from Castanopsis tibetana Hance, pupated 14.VII.2020, emgd. 6.VIII.2020, leg. X.F. Yang, genit. prep. WuJ-615-1, in NEFU. Diagnosis. Externally, the new species (Figs 1, 2) is similar to P. siniaevi (Fig. 3), but it can be separated from the latter by the following morphological characters (character states for P. siniaevi are parenthesized): P. zhejiangensis sp. nov. is smaller than P. siniaevi, with the length of forewing is 8 mm and a wingspan of only 19 mm in the holotype (P. siniaevi is larger than P. zhejiangensis sp. nov., forewing length is 12 mm and the wingspan approximately 27 mm in the holotype); the ground colour of the whole body is dark ochreous to fuscous (in P. siniaevi is black). The male genitalia are clearly diagnostic: i) in P. zhejiangensis sp. nov., each apical lobe of the gnathos (Figs 5, 8) is crescent-shaped (in P. siniaevi each apical lobe of the gnathos is rectangle-shaped; Figs 6, 9); ii) the shape of valva is broad triangular with straight costa and narrower cucullus (in P. siniaevi the shape of valva is triangular with arc-curved costa and rounded cucullus); iii) the horn-shaped processes of the juxta are large and robust (in P. siniaevi the same processes are smaller); iv) the finger-shaped process of the aedeagus (Fig. 10) is more slender (in P. siniaevi the same process is slightly thicker; Fig. 11). Description. Adult (Figs 1, 2, 7). Wingspan 19 mm, forewing length 8 mm in male. Head dark ochreous. Labial palpus up-curved, pale yellow to dark ochreous; proboscis absent; antenna strongly bipectinate in basal third then filiform, fuscous (Fig. 7). Thorax ground colour dark ochreous mixed with fuscous scales dorsally, golden-brown ventrally; tegula fuscous. Forewing elongated, extensively hyaline covered with rare dark tiny scales. Costa and inner margin areas, as well as venations of forewing and hindwing densely covered with dark ochreous scales; fringe short, dark ochreous. Medial stem of forewing well developed, not branched distally; vein R 5 branched form R 3 +R 4. Scales on legs ochreous to pale yellow. Abdomen black, with a greyish yellow longitudinal median band ventrally. Male genitalia (Figs 5, 8, 10). Uncus broad, blunt apically. Gnathos highly modified, bilobed apically, each lobe crescent-shaped with a small triangular process on medial part of lower margin (Fig. 8). Tegumen broad. Valva broad triangular in shape; costa pretty straight; cucullus blunt and rounded; sacculus swollen with rounded saccular process, and a sclerotized, sawblade-shaped internal crest extended from apical of saccular process to medial part of valva base. Juxta broadly V-shaped, bearing a pair of strongly sclerotized, horn-shaped, slightly spiralled processes. Saccus not obvious. Aedeagus tube-shaped, with several small spines and a weakly spiralled, finger-shaped process apically (Fig. 10). Sternite VIII with a sclerotized triangular process (Fig. 4, arrowed). Female genitalia. Unknown. Immature stages (Figs 12 ���27). Final instar larva (Figs 12 ���15) 10 mm in length. Larva is of a non-stinging form, with two pairs of black D (= dorsal) setae and one black SD (= subdorsal) seta per segment on each side of the larva. Head dark brown, not visible from above. Ground colour creamy white dyed with light blue. From lateral view, the body is triangular in shape, bears a pair of large dorsal horns that are pink to black, robust, pointed apically, and conical-shaped. Lateral side of body with an arc-curved, broken, pale yellow medial line, and eight orange spiracles arranged in a line located above lower margin; upper margin of lateral body is bright yellow whereas lower margin bright white dyed with pale yellow. Dorsal side rhombohedral, with an interrupted white medial line throughout the whole body; two deep blue dots spread out on both sides of white medial line at each segment. Cocoon hard and oval-shaped, greyish white with diffused ochreous, sparsely distributed with several ochreous patches (Fig. 23). Biology. Two larvae were collected on Castanopsis tibetana Hance (Fagaceae) on 11.VII.2020, and on Quercus sp. (Fagaceae) on 12.IX.2021, then reared with the samples of its host plants in the laboratory. The larva from Castanopsis tibetana Hance began cocooning on 14.VII.2020, emerged on 6.VIII.2020, as a male adult that later served as the holotype of this species; the cocoon period lasts approximately 23 days. The second larva reared on Quercus sp. was collected at the same locality as the holotype. We presume that this is a 4 th instar larva (Fig. 16) and possibly the second generation of the year. But unfortunately, the pupation was unsuccessful. The larvae feed on the underside of the leaf of the family Fagaceae, starting from one side of the apex of the leaf and feeding on the leaf in a line perpendicular to the midrib, turning when they encounter an older midrib (Figs 16, 17). The soft underbelly is completely covered by the hard dorsal surface when larvae sense attack on a flat surface. When resting on the curved leaves or branches, the body is more tightly wrapped by the hard dorsum on either side and making the underbelly unexposed. When disturbed (e.g. touching its body with a finger or brush), the larvae defend themselves from potential predators by rapidly swinging the body from side to side and scraping the leaves vigorously with the mandibles to make a fricative sound. It will continue for several minutes (the related videos are available online in the Suppl. Videos S1, S2). If the stimulation does not continue, the amplitude and frequency of the swing will gradually diminish until it stops. We hypothesize that feeding on the underside of the leaf not only is effective in avoiding predators, but perhaps the louder scraping sound can be made than the sound on the smooth upper leaf surface. For example, when the larvae are on a glass petri dish they still swing back and forth but they do not make any sounds. Before the larva builds a cocoon, the dorsal horn will bend inwards, and the dorsal cuticle will soften; the parts of the front and terminus of cuticle will strongly up-curve that will make the larva looking more oval. The larva makes a silk mat in the corner on which they will then make a cocoon around their entire body; the body is extremely tight to the inside of the cocoon, with almost no gaps; the constructing of cocoon is estimated to be completed within 3���4 hours (Figs 18���23). The cocoon is similar to descriptions of most limacodid species (Holloway 1986; Epstein 1996), it is hard, oval, with a circular lid at one end after the adult crawls out (Figs 24, 25). The adult is very active after eclosion and flies wildly within the rearing box, resulting in rapid breakage of its forewings (Figs 26, 27). Host plants. Fagaceae: Castanopsis tibetana Hance, Quercus sp. Distribution. China: Zhejiang Province: Hangzhou. Etymology. The specific name is named after the type locality in Zhejiang Province, China. Molecular data. The holotype (GenBank accession number OL807620) and a larva (GenBank accession number OL807621) of the new species, were barcoded (Hebert et al. 2003). The molecular marker of two sequences COI- 5P. Both sequences are of 662 base pairs corrected and aligned (see below): Pseudonagoda zhejiangensis sp. nov. (Adult, holotype, GenBank accession number OL807620) ATCTGAGCTGGAATAGTAGGAACATCTCTAAGATTAATAATTCGAGCTGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTT - TATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCC TGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTCTTATACTTTTAATTTCAAGAAGTATTGTAGAAAATGGGGCAGGAACAGGTTGAACAGTCTATCCTCCTTTATCTTCCAATATTGCACATAGTGGTAGATCAGTAGATTTAGCAATTTTTTCCCTTCATCTAGCGGGAATTTCTTCTATTTTAGGGGCTGTAAATTTCATTACCACTATTATTAATATACGACCTAATGGAATATCATTTGACCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACTGCATTATTATTACTCCTTTCTTTACCAGTATTAGCCGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTA Pseudonagoda zhejiangensis sp. nov. (Larva, GenBank accession number OL807621) ATCTGAGCTGGAATAGTAGGAACATCTCTAAGATTAATAATTCGAGCTGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTT - TATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCC TGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTCTTATACTTTTAATTTCAAGAAGTATTGTAGAAAATGGGGCAGGAACAGGTTGAACAGTCTATCCTCCTTTATCTTCCAATATTGCACATAGTGGTAGATCAGTAGATTTAGCAATTTTTTCCCTTCATCTAGCGGGAATTTCTTCTATTTTAGGGGCTGTAAATTTCATTACCACTATTATTAATATACGACCTAATGGAATATCATTTGACCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACTGCATTATTATTACTCCTTTCTTTACCAGTATTAGCCGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTA Remarks. The sequence with GenBank accession number OL807621 came from the larva (Fig. 15) that died during the rearing process. After death, the larva was stored in 100% alcohol and subsequently used for DNA extraction and amplification. To date, all three known species of this genus are represented by a single male holotype and, with the exception of this new species, molecular data and immature stages are lacking. In this article, the life history of P. zhejiangensis sp. nov. was recorded, as well as the DNA was extracted and sequenced. The barcode sequences were deposited in GenBank. Mr.John Horstman once collected and reared a larva that successfully eclosed as a male adult in Pu'er City of Yunnan Province, China, and posted the photos online. Although we cannot be certain which species it is, we were able to identify it as belonging to the genus Pseudonagoda (https://twitter.com/sinobug/status/1090597104706248705). In addition, Ms. Marina Roth has also shared some photographs of the larvae of this genus from Shangrao City of Jiangxi Province on iNaturalist platform. The collection site is not far from the type locality of the new species P. zhejiangensis sp. nov., and we speculate that these samples could be probably conspecific (https://www.inaturalist. org/observations/104722689). Additional adult specimens from both localities are still needed to confirm the presence of P. zhejiangensis sp. nov. in Pu'er City of Yunnan Province and Shangrao City of Jiangxi Province, China. What is certain, is that the genus Pseudonagoda occurs in at least two other provinces in China besides Zhejiang. Females of this genus remain unknown. Among the cup moths known as having transparent patchy wings females are recorded for the following genera Nagodopsis Matsumura, 1931, Nagoda Moore, 1887, and Cheromettia Moore, 1883. All these three genera are sexually dimorphic. It seems that in Limacodidae the clearwing or with clear patches on the wing species tend to be sexually dimorphic (Dr. Marc E. Epstein, pers comm. 18 January 2022). Therefore, we presume that it is highly possible that species in the genus Pseudonagoda are also sexually dimorphic. Female characters can be better studied and recorded by collecting and rearing more larvae or pupae, so female adult specimens are obtained., Published as part of Wu, Jun, Yang, Xiao-Feng & Han, Hui-Lin, 2022, Discovery of the genus Pseudonagoda Holloway, 1990 (Lepidoptera: Limacodidae) from China, with description of a new species and notes on the immature stages, pp. 293-300 in Zootaxa 5099 (2) on pages 294-298, DOI: 10.11646/zootaxa.5099.2.9, http://zenodo.org/record/6048598, {"references":["Solovyev, A. V. (2009) Notes on South-East Asian Limacodidae (Lepidoptera, Zygaenoidea) with one new genus and eleven new species. Tijdschrift voor Entomologie, 152 (1), 167 - 183. https: // doi. org / 10.1163 / 22119434 - 900000273","Holloway, J. D. (1986) The moths of Borneo: Part I. Key to families; families Cossidae, Metarbelidae, Ratardidae, Dudgeoneidae, Epipyropidae and Limacodidae. Malayan Nature Journal, 40 (1 - 2), 1 - 165.","Epstein, M. E. (1996) Revision and phylogeny of the Limacodid-group families, with evolutionary studies on slug caterpillars (Lepidoptera: Zygaenoidea). Smithsonian Contributions to Zoology, 582, 1 - 102. https: // doi. org / 10.5479 / si. 00810282.582","Hebert, P. D. N., Cywinska, A., Ball, S. L. & de Waard, J. R. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society B, 270, 313 - 321. https: // doi. org / 10.1098 / rspb. 2002.2218","Matsumura, S. (1931) Descriptions of some new genera and species from Japan, with a list of species of the family Cochlidionidae. Insecta Matsumurana, 5, 101 - 116."]}

Genus Pseudonagoda Holloway, 1990 Pseudonagoda Holloway, 1990: 59. Type species Pseudonagoda naessigi Holloway, 1990 by original designation. Type locality Indonesia (N. Sumatra)., Published as part of Wu, Jun, Yang, Xiao-Feng & Han, Hui-Lin, 2022, Discovery of the genus Pseudonagoda Holloway, 1990 (Lepidoptera: Limacodidae) from China, with description of a new species and notes on the immature stages, pp. 293-300 in Zootaxa 5099 (2) on page 294, DOI: 10.11646/zootaxa.5099.2.9, http://zenodo.org/record/6048598, {"references":["Holloway, J. D. (1990) The Limacodidae of Sumatra. Heterocera Sumatrana Society, 6, 9 - 77."]}

Gortyna guizhouensis sp. n. (Figs 1���4, 7���9, 11, 13���16) Type-material. Holotype: ♂, China, Guizhou Province, Weining County, Zhejue Countryside, N 26.534273, E 103.916394, 6 IX 2021, legs. MF Yang, HY Zhao and M Leng, genit. slide no. hhl-4877-1, in NEFU. Paratypes: 2 ♂, 2 ♀, same data as for holotype, genit. slide no. hhl-4874-1, 4875-1, 4876-2, in NEFU. Diagnosis. The new species is very similar to G. plumbitincta Hreblay & Ronkay, 1997, but can be diagnosed with the latter by the following characters (character states for G. plumbitincta are parenthesized): G. guizhouensis sp. n. (Figs 1���4) is smaller, with a wingspan of only 34���37 mm in the type materials (that of the larger G. plumbitincta is 42���47 mm; Figs 5���6); the ground color is golden-red and veins indistinct (in G. plumbitincta is golden-orange, with veins appearing very distinct); the M 3 vein is common at the outer margin (in G. plumbitincta slightly bulge); the dark streak between the orbicular and reniform spots is present (in G. plumbitincta without). In the male genitalia, the cucullus of the new species (Figs 7���9) is nearly rectangular (in G. plumbitincta the cucullus is triangular, with the apex finely pointed; Fig. 10); the costal process is narrow, finger-shaped, reduced, bluntly round at apex (in G. plumbitincta the costal process is shorter, bifurcated, slightly curved); transtilla small (in G. plumbitincta large and triangle-shaped); the juxta with ventral-medial protrusion (in G. plumbitincta the ventral-medial protrusion is lacking); the vesica is strongly enlarged dorsad, with a long cornutus on the small submedial diverticulum, and with a row of long cornuti at the terminus (in G. plumbitincta the vesica is only slightly enlarged dorsad, and the median diverticulum is sclerotized apically, bears a cornutus, with 3���4 fine spinules close to the median diverticulum); the carina process bears 2���6 spines (in G. plumbitincta there are more than six spines). In the female genitalia, the new species (Fig. 11) has a large appendix bursae, and the corpus bursae is long and ovoid (in G. plumbitincta the corpus bursae is small and spherical; Fig. 12); the apophysis anteriores is approximately 4/7 the length of the apophysis posteriores (in G. plumbitincta it is almost 6/7 as long). Description. Adult (Figs 1���4). Wingspan 34���37 mm, length of forewing 15���18 mm in male for three individuals; 36 mm and 16 mm in female for two individuals. Head and labial palpus dark greyish brown; antennae filiform in both sexes, dark brown to ochreous. Thorax dark greyish brown, collar and tegulae mixed with golden-orange scales. Forewing broadly triangular with acute apex, slightly concaved subapically at outer margin; ground color of forewing deep golden-red; cell, subterminal and terminal line areas, lower third of the basal part of inner margin area suffused with plumbeous grey to dark brown; basal patch distinct, dark brown, with a conspicuous white posterior spot; basal line dark, light red, doubled, excurved; antemedial line red, doubled, weakly excurved, and obviously bending at 2A, outer line of antemedial line darker and broader than inner line; median line red and thin, strongly excurved below the cell; postmedial line doubled, excurved at M 3 then almost straight reaching the inner margin ca. 2/3 from wing base, inner line of postmedial line black, distinct, outer line of postmedial line smokebrown, indistinct; subterminal line doubled, smoke-brown, waved, with more or less golden-orange scales between the inner and outer lines of the subterminal line, much larger in apex region whereas the rest narrow; terminal line greyish-white, narrow; fringe dark brown; orbicular spot large, rounded, golden-red encircled with black; reniform spot irregularly rectangle-shaped, golden mixed with orange, surrounded by black, with three white patches of different sizes on the posterior part; the dark streak between the orbicular and reniform spots is present. Hindwing ground color brownish grey, terminal line lighter than ground color; veins indistinct; terminal line cream color; discal spot indistinct. Abdomen brownish grey. Male genitalia (Figs 7���9). Uncus narrow and weakly arc-shaped; pointed, hooked-shaped apically. Tegumen broad, with small square-shaped penniculi, hairy apically. Valva elongate, rounded at base then narrower; costa strongly sclerotized, reduced at middle part, swollen and protruded apically, with a slender, finger-shaped process that extending beyond ventral margin of valva; ampulla finger-shaped, slightly recurved; cucullus nearly rounded rectangular; sacculus triangular, strongly sclerotized, as wide as valva at its base; clasper sclerotized, straight, barshaped; harpe small, triangle-shaped. Vinculum robustly V-shaped. Juxta with a ventral-medial protrusion. Saccus broad, tongue-shaped. Aedeagus tube-shaped, distally weakly ventrad curved; caecum swollen, ca. 1/3 the length of aedeagus; carina sclerotized, with a row of 2���6 spines. Vesica membranous, obviously wrinkled, swollen at middle, and tapering to terminus; small submedial diverticulum with a long robust cornutus (lost in genit. prep. no. hhl- 4874-1 of a paratype, Fig 9), and with a row of long cornuti at terminus. Female genitalia (Fig. 11). Ovipositor lobes strong, sclerotized conical, acute; apophysis posteriores rather narrow; apophysis anteriores robust, pointed terminally, approximately 4/7 the length of apophysis posteriores; ostium bursae broad, strongly sclerotized, funnel-shaped; ductus bursae long, wrinkled, strongly sclerotized, tapering from anterior to posterior part, with a medial protuberance; corpus bursae long oval-shaped, with four signa bands in central position; appendix bursae sclerotized, oval-shaped, densely covered with wrinkles. Biology. Larvae attack the tender leaves and stalks of maize, and the attacked stalks always with distinct borer holes. The unnormal streaks, notches, holes, and the excreted frass can be seen when the infested stalks are unfolded, and they also are appearing in the growing tender leaves of affected plants (Figs 13���15). Eight larvae were collected on 20 VI 2021 and reared on maize stalks in the laboratory. They began pupating on 20 VIII 2021; adults began to emerge from 6 IX 2021, giving three males and two females (Fig. 16). Distribution. China (Guizhou Province). Etymology. The specific name is named after the type locality in Guizhou Province, China., Published as part of Wu, Jun, Yang, Mao-Fa & Han, Hui-Lin, 2022, A new species of the genus Gortyna Ochsenheimer, 1816 from China, with notes on the larval feeding habits (Lepidoptera, Noctuidae, Noctuinae: Apameini), pp. 587-592 in Zootaxa 5092 (5) on pages 588-591, DOI: 10.11646/zootaxa.5092.5.6, http://zenodo.org/record/5896529, {"references":["Hreblay, M. & Ronkay, L. (1997) New Noctuidae (Lepidoptera) species from Taiwan and the adjacent areas. Acta Zoologica Academiae Scientiarum Hungaricae, 43 (1), 21 - 83."]}

Genus Gortyna Ochsenheimer, 1816 Type species: Noctua flavago Denis & Schifferm��ller. Gortyna Ochsenheimer, 1816, Schmett. Eur. 4: 82. Cnephozeta Billberg, 1820, Enum. Ins. Mus. Billb.: 88. Ochria H��bner, [1821] 1816, Verz. bek. Schmett.: 233. Xanthoecia (Acronyctinae) Hampson, 1908, Cat. Lepid. Phalaenae Br. Mus. 7: 9 [key]. Xanthoecia (Acronyctinae) Hampson, 1910, Cat. Lepid. Phalaenae Br. Mus. 9: 32., Published as part of Wu, Jun, Yang, Mao-Fa & Han, Hui-Lin, 2022, A new species of the genus Gortyna Ochsenheimer, 1816 from China, with notes on the larval feeding habits (Lepidoptera, Noctuidae, Noctuinae: Apameini), pp. 587-592 in Zootaxa 5092 (5) on page 588, DOI: 10.11646/zootaxa.5092.5.6, http://zenodo.org/record/5896529, {"references":["Ochsenheimer, F. (1816) Die Schmetterlinge von Europa. Vol. 4. Gerhard Fleischer, Leipzig, 224 pp.","Billberg, G. J. (1820) Enumeratio Insectorum in Museo Gust. Joh. Billberg, Gadel, Stockholm, 138 pp. https: // doi. org / 10.5962 / bhl. title. 49763","Hampson, G. F. (1908) Catalogue of the Lepidoptera Phalaenae in the British Museum. Vol. 7. Taylor and Francis, London, 709 pp.","Hampson, G. F. (1910) Catalogue of the Lepidoptera Phalaenae in the British Museum. Vol. 9. Taylor and Francis, London, 552 pp."]}

Costasensora fibigeri sp. n. (Figs. 1–3, 8, 9) Type material. Holotype: male, Malaysia, Borneo, Sabah, Mt. Trusmadi, 20–25.viii.2016, H.L. Han & H. Geng, genit. prep. hhl-3598-1, coll. NEFU. Paratypes: 6 males, Malaysia, Borneo, Sabah, Mt. Trusmadi, 24.iv–2.v.2016, H.L. Han, coll. NEFU; 2 males, same data as holotype, coll. NEFU; 1 male, same collecting site as holotype, 1–6.x.2018, H.L. Han, genit. prep. hhl-4342-1, coll. NEFU. Diagnosis. Superficially C. fibigeri is similar to C. honeyi (Fig. 4, 11), but can be separated from this species by the following characters: in C. fibigeri the ground colour of the forewing is light whitish-yellow, slightly mixed with brownish-yellow in outer part of wing (in C. honeyi the ground colour of the forewing is whitish yellow, blurred); the basal patch of the forewing in costal area is broader than that in C. honeyi; the costal patch of in medial area in C. fibigeri is broader and square-shaped (in C. honeyi it is smaller and less expressed); the reniform spot in C. fibigeri is whitish-yellow, rather large and oblate (in C. honeyi it is white, small and indistinct); the hindwing in C. fibigeri is greyish-yellow (in C. honeyi the hindwing is grey); the discal spot is brown, expressed as a small dot (in C. honeyi the hindwing is darker brown, the discal spot is bigger, diffused, band-shaped). In the male genitalia, the valvae are strongly asymmetrical (in C. honeyi they are slightly asymmetrical (Fig. 9); the process of the sacculus in C. fibigeri is conical thorn-like but in C. honeyi it is absent; the saccus in C. fibigeri is narrow and long, but in C. honeyi it is broad and 2X shorter; the anellus plate is irregularly trapezoid, with a small apical extension (in C. honeyi it is long, spatulate, and with a rounded apical extension); in C. fibigeri the aedeagus is bent curved at a right angle while in C. honeyi the aedeagus is smoothly curved. Description. Adult (Figs 1–3). Wingspan 9.5–11.0 mm. Head. light brownish yellow. Thorax. Whitish-yellow; tegulae whitish-yellow; patagia dark brown. Forewing light whitish yellow to yellow mixed with brown scales; basal line very thin, indistinct; antemedial line light orange, waved, with 3—4 blackish brown small dots; median line light orange, smoothly curved, with over 10 blackish- brown small dots; postmedial line light orange, oblique, formed with several blackish brown small dots, folows to M 3, then incurved to inner margin; subterminal line somewhat darker, blackish brown, roundedat M 3 -Cu 1, light orange mixed with smoky brown in costal area, close to postmedial line down of M 3; terminal line blackish-brown; fringe smoky brown, mixed with some yellow and orange; reniform spot bright whitish yellow, rather large and oblate; costal area darker than ground colour; basal patch cylindrical, blackish-brown; medial patch in costal area large, square, thick; terminal area blackish brown. Hindwing greyish-yellow; discal spot brown, as small dot; outer margin of wing weakly incurved, angulate at Cu 2; fringe slightly lighter than ground colour, in basal part yellowish. Abdomen. Whitish yellow to brownish yellow, with tuft of yellow hairs at terminus. Male genitalia (Figs 9, 10). Tegumen fused with anellus plate, forming a circular ring in upper part. Vinculum asymmetrical, broader than tegumen, equal to tegumen in length. Saccus narrow, long, Y-shaped, deviated left. Valvae asymmetrical, extended apically, right valva (from dissection perspective) longer and broader than left one; process of sacculus conical spine-like process, extending downward near basal part of valva left process larger than right one; ampulla bilobed, asymmetrical, its left lobe tongue-like, setose, right lobe 1.5 X as broad as left one, apically rounded, with small, thorn-like, dorsal extension; digitus as long as valva, on right valva digitus is larger and broader than on left valva. Juxta large, sclerotized, its left part quadrangular, right part triangle. Anellus plate irregularly trapezoidal, with small apical extension. Aedeagus bentat a right angle, tapered apically. Vesica with small, short basal cornutus. Female genitalia. Unknown. Distribution. The species is distributed in East Malaysia: Borneo, Sabah (Trusmadi Mountain). Costasensora fibigeri inhabits montane meadows and open hills with woody shrubs and herbaceous plants in the zone of tropical rainforest. Probably several generations over the year. Specimens were captured at UV light in April, August and October. Etymology. The species name “ fibigeri ” is dedicated to the late Dr. Michael Fibiger who was an author, first explorer and developer of the classification of the family Micronoctuidae., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Costasensora Fibiger, 2010 and Asyprocessa Fibiger, 2010 from Malaysia and Cambodia (Lepidoptera, Erebidae, Hypenodinae, Micronoctuini) Taxonomic study of Micronoctuini. Contribution VI., pp. 95-100 in Zootaxa 5005 (1) on page 96, DOI: 10.11646/zootaxa.5005.1.9, http://zenodo.org/record/5141255

Genus Costasensora Fibiger, 2010 Costasensora Fibiger, 2010. Zootaxa, 2583: 53–54. Type species: Costasensora honeyi Fibiger, 2010. Type locality: Malaysia, Borneo, Sarawak. Holotype: male, NHM [BMNH]. Costasensora was described by Fibiger (2010) based on the type-species; some features of the male genitalia are added here to supplement the original description. Supplement to the original description (Figs 1–4, 9–11). Head and thorax. Labial palps porrect; third segment 1/3 of second, narrow. Head, patagia, anterior part of tegulae, prothorax, basal part of costa, costal part of forewing in medial, and terminal areas, including fringes, blackish-brown; medial spot in the costal area quadrangular in shape. Forewing ground colour whitish yellow; reniform stigma indistinct, small, white. Hindwing grey, with indistinct discal spot. Abdomen. Grey; with dorsal tuft on basal segment. Male genitalia. Tegumen short or regular, thick, with sclerotized ring in upper part; vinculum asymmetrical, thick and broad; saccus variable in shape, broad or narrow, Y or V-shaped, with or without medial crest, with or without long, thin, curved saccus; valvae might be asymmetrical, right valva 1.5X longer than left, or valvae equal in length, extended apically; process of sacculus conical prickle, extends downward or absent; ampulla setose, bilobed, asymmetrical, left lobe tongue-like; right lobe 1.5 to 2X as broad than left one, apically rounded, medially with small thorn-like dorsal extension; juxta large, sclerotized, with medial crest; asymmetrical: left part upper or under quadrangular in shape, right part apically pointed or triangle; anellus plate prominently asymmetrical, basally with lateral hornlike processes, distally long or regular, spatulate or irregularly trapezoid, with rounded, or weak, small apical extension; aedeagus smoothly curved or curved under right angle, tapering apically; vesica with minute cornutus. Female genitalia. Unknown., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Costasensora Fibiger, 2010 and Asyprocessa Fibiger, 2010 from Malaysia and Cambodia (Lepidoptera, Erebidae, Hypenodinae, Micronoctuini) Taxonomic study of Micronoctuini. Contribution VI., pp. 95-100 in Zootaxa 5005 (1) on page 95, DOI: 10.11646/zootaxa.5005.1.9, http://zenodo.org/record/5141255, {"references":["Fibiger, M. (2010) Revision of the Micronoctuidae (Lepidoptera: Noctuoidea). Part 3, Taxonomy of the Tactusinae. Zootaxa, 2583, 1 - 119. https: // doi. org / 10.11646 / zootaxa. 2583.1.1"]}

Asyprocessa ysbaei sp. n. Type material. Holotype: male, Cambodia, Prov. Mondulkiri, Keo Seima Wildlife Sanctuary, 8–10.xi.2011, Y.S. Bae et al., genit. prep. hhl-3589-1, coll. NEFU. Paratype: 1 male, Cambodia, Prov. Siem Rip, Phnom Kulen National Park, 15.ii.2013, Y.S. Bae et al., genit. prep. hhl-3725-1, coll. INU. Diagnosis. The adult of A. ysbaei superficially is similar to A. spinus (Fig. 8) but differs in the light yellowish-grey colour of the body (in C. spinus it is dark smoky-grey); the forewing is light brownish-yellow (in C. spinus the forewing is sallow, suffused with black to smoky-black); in A. ysbaei the basal area near the costal margin is brown (in C. spinus it is black); the antemedial line is rather indistinct, smoothly rounded (in C. spinus the antemedial line is distinct, waved medially); in A. ysbaei the costal region bears a large dark brown patch between the antemedial and postmedial lines (in C. spinus it is black); the terminal region is dark brown, mixed with pale red (in C. spinus it is black); the reniform is yellowish-white (in C. spinus it is yellow); in A. ysbaei the ground color of the hindwing is light brownish-grey (in C. spinus it is grey). The male genitalia of A. ysbaei are similar to those of A. wapi (Fig. 14), but differ, in the somewhat broader valvae (in C. wapi the valvae are somewhat narrower and curved; the process of the right sacculus is thick, rather long and curved from midd to apex (in C. wapi it is slightly shorter and straight), left valva bears a large bulge (in C. wapi it bears a small triangular bulge); the ampulla is rounded and mushroom-shaped (in C. wapi the ampulla is slightly swollen); the aedeagus is smoothly incurved (in C. wapi it is bent under the right angle); the vesica with long band of spinules (in C. wapi vesica with smaller band of spinules). Description. Adult (Fig. 5). Wingspan 9.5 mm. Head. Light greyish-yellow. Thorax and abdomen. More golden yellow than head; abdomenwith brush of pale hairs at termen. Forewing pale brownish-yellow, mixed with brown; basal line a brown patch at costal margin; antemedial line darker than wing ground colour, smoothly incurved, indistinct median line parallel to antemedial line, darker at costal margin; postmedial line smoothly curved, formed by yellowish-white small dots; subterminal line formed by dark yellowish-brown scales, mixed with red, waved; terminal line formed by brown and yellowish-brown scales; fringe yellowish-brown apically, smoky-grey posteriorly; reniform yellowish white, surrounded with halo-like ring; dark brown patch at costal area between antemedial and postmedial lines. Hindwing darker than forewing, grey; its outer margin incurved at M 2; tornal margin rather straight; fringe grey, basally yellowish at base; discal spot smoky-grey, indistinct, ringed. Male genitalia (Figs 12, 13). Vinculum slender, tapering towards apex. Valvae slightly asymmetrical, left valva narrower than right one; right sacculus broad and short, ventral process of sacculus gradually curved, slender; sacculus on left valva rather narrow, long, with bulge 2/3 away from base, ventral process on left sacculus missing. Costa of right valva broad, smoothly curved, distinct basally, integrated with sacculus; in left valva costa narrower, thin, fused with sacculus. Ampulla slightly asymmetrical, shovel shaped, covered with heavy hairs. Juxta weakly sclerotized, irregularly circular-shaped, with narrow triangular fold at upper half. Saccus V-shaped. Aedeagus curved, dorsally weakly sclerotized, and swollen at junction of ductus ejaculatorius; vesica with basal band of spinules. Distribution. The species is distributed in East Cambodia, Prov. Mondulkiri, Keo Seima Wildlife Sanctuary and Prov. Siem Rip, Phnom Kulen National Park. It inhabits montane semi-evergreen forest zone and occurs in forest meadows with woody shrubs and herbaceous plants. Probably several generations over the year. The specimens were captured by UV light in November and February. Etymology. The species name “ ysbaei ” is dedicated to the collector of type specimens of the species, Professor Y.S. Bae, a famous Microlepidoptera specialist in the Republic of Korea., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Costasensora Fibiger, 2010 and Asyprocessa Fibiger, 2010 from Malaysia and Cambodia (Lepidoptera, Erebidae, Hypenodinae, Micronoctuini) Taxonomic study of Micronoctuini. Contribution VI., pp. 95-100 in Zootaxa 5005 (1) on page 97, DOI: 10.11646/zootaxa.5005.1.9, http://zenodo.org/record/5141255

Micronola jiangchenga sp. n. (Figs 5, 6, 11, 18b, 20) Type materials. Holotype: male, China, Prov. Yunnan, Pur, Jiangcheng, 1–2.viii.2018, legs. H.L. Han & M. R. Li, genit. prep. hhl-4299-1, coll. NEFU. Paratypes: 2 males with same data as holotype, genit. prep. hhl-4350, hhl-4355, coll. NEFU. Diagnosis. Superficially the new species is similar to M. yemeni (Fig. 4) but differs by somewhat broader forewing and light reddish-brown ground color (in M. yemeni the forewing shape is narrower, the ground colour is blackish-grey); the antemedial line double, yellowish brown, whitish-grey inside (in M. yemeni it is black, monotonous); the postmedial line smoothly curved, yellowish brown, whitish grey outside (in M. yemeni it is weakly waved, black, with light reddishbrown outer border); the subterminal line strongly waved, acute apically (in M. yemeni it is smoothly waved); the terminal line reddish-yellow (in M. yemeni it is black); fringe yellow to reddish-yellow (in M. yemeni it is dark grey); the outer margin of the hindwing slightly incurved at M 2 (in M. yemeni it is strongly incurved). In the male genitalia, the tegumen rather broad (in M. yemeni — narrow (Fig. 10); the anellus small, triangle, displaced left (in M. yemeni it is free, bigger, log-like subapically); the juxta flat, spade shaped, as wide as long (in M. yemeni it is slightly quadrangular, wider than its length); the digitus is weakly asymmetrical, on the left valva it is thumb shaped (in M. yemeni digitus on the left and right valvae are strongly asymmetrical, left one narrow, club shaped, curved); the ventral part of ampulla rounded, its dorsal part bearing finger-shaped extension, ampulla on the left valva is little smaller than on right valva (in M. yemeni ventral part of ampulla extended, its dorsal part with big lollipop shaped extension); aedeagus with a long, curved club-shaped tube close to ductus ejaculatorium (in M. yemeni it is short, bulge, shorter than coecum). Description. Adult (Figs 5–6). Wingspan 10.0– 12 mm. Head and thorax pale, yellowish-grey; abdomen yellowishgrey with reddish, bordered with yellow scales ventrally and in terminal part. Forewing light reddish-brown, mixed with light brown and reddish-yellow; basal line blackish, presents as spot at costal margin; antemedial line yellowish brown, smoothly excurved, whitish grey inside; postmedial line smoothly curved, yellowish brown, with whitish grey border outside; subterminal line light reddish brown, strongly waved to tornus, sharped apically, whitish grey outside; terminal line reddish yellow; fringe yellow to reddish yellow; reniform spot small, light whitish grey; subterminal and terminal areas, and costal area darker than ground color. The ground color of hindwing same as forewing; outer margin slightly incurved at M 2; discal spot indistinct. Male genitalia (Fig. 11). Tegumen broad, slender in apical part, 2X as long as vinculum. Vinculum V-shaped. Saccus small V-shaped. Anellus small, triangle, displaced to left. Juxta flat, spade-shaped, as long as wide, with ring at top. Valva asymmetrical, left valva somewhat broader; costa narrow, weak; sacculus broad, basally, slender to apical part of valvaa; digitus slightly asymmetrical on left and right valvae, thumb shaped, placed over ampulla, digitus on left valva larger than than that on right valva; ampullae asymmetrical, divided apically, left ampulla slightly larger than right ampulla, its ventral part rounded, dorsal part with tongue-shaped or finger-like extensions. Aedeagus short, strongly curved, semicircle, tapered towards apex; coecum short and broad, about 1/10X as long as aedeagus, with long, curved club-shaped extension close to ductus ejaculatorium. Female genitalia. Female unknown. Distribution (Fig. 18b). China, Prov. Yunnan, Jiangcheng. Bionomics (Fig. 20). The species was collected in August by a light trap in the broad-leaved forest with abundantce of ferns and shrubs. Etymology. The species name refers to the type-locality of a new species: Jiangcheng village in the Province Yunnan, China., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new Micronola Amsel, 1935 from China and Malaysia (Lepidoptera, Erebidae Hypenodinae, Micronoctuini). Taxonomic study of Micronoctuini. Contribution III., pp. 190-196 in Zootaxa 4999 (2) on page 193, DOI: 10.11646/zootaxa.4999.2.8, http://zenodo.org/record/5089576

Genus Micronola Amsel, 1935 Micronola Amsel, 1935, Veröffentlichung des Deutschen Kolonial und Uebersee Museum in Bremen 1: 215. Type species: Micronola wadicola Amsel, 1935 (Jordan, Jericho). References: Fibiger 2011: 113. Some features of the male genitalia are added here to supplement the original description with account of the genital structure of the new species. The terminology introduced by Fibiger (2011) is used for the description of the male genitalia. Supplement to Original Description. Head and thorax. Labial palps slightly upturned, 3 rd segment as long as 1/3 of 2 nd segment. Head, patagia, and thorax: dorsally beige or dark grey.. Wingspan: 7.5–16.0 mm. Ground colour of forewing beige or dark grey. Wing pattern with blackish crosslines. Reniform stigma: bright yellow, outlined in black. Hindwing: whitish beige or grey. Abdomen. light brown or dark grey. Male genitalia. Tergum and sternum of 8 th segment: slightly sclerotised, without processes. Tegumen, vinculum of normal proportions or tegumen 2x higher than vinculum. Ventral and dorsal margins of valva more heavily sclerotised than mid-valva; editum indicated by a long, subcostal row of hairlike setae. Clasper strongly curved. Ampullae divided apically; ventral part circular with long hair-like setae bent inwardly, dorsal part smaller. Digitus large; in some species strongly fused to the dorsal part of ampulla; shaped as prominent spine with setae or spines at tip. Juxta-anellus plate fused; juxta wider than long, somewhat quadrangular; anellus asymmetrical, constricted medially, with Y- or V-shaped cleft posteriorly. Aedeagus strongly curved upwards, tapered towards apex and coiled clockwise, coecum short. Female genitalia. Ovipositor quadrangular, with rounded corners. Apophyses anterior about 2/3 length of posterior apophyses. 7 th abdominal segment: heavily sclerotised; asymmetrical, shorter in right side. 8 th abdominal segment ventrally extended to anterior part of 7 th segment. Ostium slightly displaced to left. Antrum long, conical, curved and heavily sclerotised. Ductus bursae long; membranous; antrum and ductus bursae together 2–3X longer than anterior width of 7 th abdominal segment. Appendix bursae arising anteriorly from ductus bursae near antrum., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new Micronola Amsel, 1935 from China and Malaysia (Lepidoptera, Erebidae Hypenodinae, Micronoctuini). Taxonomic study of Micronoctuini. Contribution III., pp. 190-196 in Zootaxa 4999 (2) on page 190, DOI: 10.11646/zootaxa.4999.2.8, http://zenodo.org/record/5089576, {"references":["Amsel, H. G. (1935) Zur Kenntnis der Microlepidopterenfauna des sudlischen Toten Meer-Gebietes, nebst Beschreibung neuer Palastinischer Macro- und Microlepidoptera. Veroffentlichung des Deutschen Kolonial und Uebersee Museum in Bremen, 1, 203 - 221.","Fibiger, M. (2011) Revision of the Micronoctuidae (Lepidoptera: Noctuoidea). Part 4, Taxonomy of the subfamilies Tentaxinae and Micronoctuinae. Zootaxa, 2842 (1), 1 - 188. https: // doi. org / 10.11646 / zootaxa. 2842.1.1"]}

Stenoloba wolfgangi Behounek & Kononenko, 2010 Zootaxa, 2678: 5, figs 5, 6. Type-locality: Indonesia, Sumatra, Prapat, Holzveg. Holotype: ZSM, Munchen. Material examined. 1 male, Borneo, Mt. Trusmadi, Jungle Girl Camp, 3-8.ii.2017, montane rainforest, about 1000 m, H.L. Han, genit. prep. hhl-3874-1. Distribution. Indonesia: Sumatra; Malaysia: Borneo (Sabah). It is reported for Borneo for the first time., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on page 346, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Behounek, G. & Kononenko, V. S. (2010) Fourteen new species of the genus Stenoloba Staudinger, 1892 from South East Asia (Lepidoptera: Noctuidae, Bryophilinae). Zootaxa, 2679 (1), 1 - 31. https: // doi. org / 10.11646 / zootaxa. 2679.1.1"]}

Stenoloba benjamini Behounek & Kononenko, 2010 (Figs 2, 10, 17) Zootaxa, 2678: 10, figs 21, 22, 44, 66. Type-locality: Indonesia, Sumatra, Prapat, Holzveg. Holotype: ZSM, Munchen. Material examined. 3 males, 2 female, Borneo, Mt. Trusmadi, Jungle Girl Camp, 1-6.x.2018, 20-25.vii.2016, 24.iv-2.v.2016, 3-8.ii.2017, montane rainforest, 800-1000 m, H.L. Han, genit. prep. hhl-4053-1, hhl-4052-1, hhl- 3846-2, hhl-3845-1, hhl-3876-1, hhl-3572-1, hhl-3571-1, hhl-3572-2. Distribution. Indonesia: Sumatra; Malaysia: Borneo (Sabah). It is reported for the first time from Borneo.

Stenoloba albibasis Behounek & Kononenko, 2010 Zootaxa, 2678: 6, figs 7, 8, 36, 59. Type-locality: Indonesia, Sumatra, Prov. Asahan, Aek Tarum, Gunnung Malay. Holotype: ZSM, Munchen. Material examined. 6 males, Borneo, Mt. Trusmadi, Jungle Girl Camp, 24.iv-2.v..2018, montane rainforest, about 1000 m, H.L. Han, genit. prep. hhl-3578-1, hhl-3573-1, hhl-3519-1, hhl-3575-1, 3520-1, hhl-3516-1. Distribution. Indonesia: Sumatra; Malaysia: Borneo (Sabah). It is reported for the first time from Borneo.

Stenoloba chlolographa Kononenko & Ronkay, 2001 (Figs 4, 12) Stenoloba chlorographa Kononenko & Ronkay, 2001. Insecta Koreana 18(2): 99, Figs 4, 25, 44. Type locality East Nepal, Koshi (NSMT). Stenoloba viridimicta, sensu Yoshimoto 1995 (nec Hampson 1910). Moths of Nepal, 3:69, pl.109, fig 2, text fig. 616. Note. The species was misidentified by Yoshimoto (1995) as S. viridimicta (Yoshimoto 1995, nec Hampson 1910), corrected by Kononenko & Ronkay (2001). Material examined. 1 male, China, Autonomic Region Xizang, Yigong, Shuangyu, 7.viii.2017, Hui-Lin Han, genit. prep. hhl-3551-1 (NEFU). Diagnosis (Figs 4, 12). Stenoloba chlorographa belongs to the S. viridimicta species - group (Kononenko & Ronkay 2001). Externally it resembles S. viridimicta Hampson, 1910 (Fig. 5), but can be distinguished by its larger size (28 mm vs 25 mm in S. viridimicta) somewhat broader shape of forewing (vs narrow, with parallel margings in S. viridimicta) and the forewing pattern with sharply defined subbasal field (vs sharply defined only in ventral half in S. viridimicta); missing of longitudinal black streaks parallel to costal margin of wing and black bordering of subbasal field (vs well expressed longitudinal black streaks in S. viridimicta) and presence of broad blackish-brown subapical patch and clear greenish apical mark (not presented in S. viridimicta). In the male genitalia (Fig. 12), S. chlorographa differs by the shape of valva, which is unlike to S. viridimicta, has parallel distal and ventral margins at its basal two third and gradually tapered in to thin, slightly curved, sticklike apical third; costa bears a sclerotised bar which terminates in the apical third of the valva. In S. viridimicta valva gradually tapered from its base to the apex, without sclerotised costal bar. Distribution and bionomics. This rare species had been known only from Nepal (Yoshimoto 1995, reffered as S. viridimicta; Kononenko & Ronkay 2001) and here it is reported for China from the Autonomic Region Xizang for the first time. The specimen was collected in first week of August in montane subtropical forest at troughly 2000 m. Its presence in Southwest China significantly extends its distribution eastward from the type-locality., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on page 345, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Kononenko, V. S. & Ronkay, L. (2001) A revision of the genus Stenoloba Staudinger, 1892 (Lepidoptera, Noctuidae, Bryophilinae) with description of 15 new species and 3 new subspecies from East Asia (II). Insecta Koreana, 18 (2), 95 - 121.","Yoshimoto, H. (1995) Noctuidae. In: Haruta, T. (Ed.). Moths of Nepal. Tinea, 14 (Supplement 2), 49 - 90.","Hampson, G. F. (1910) Catalogue of the Lepidoptera Phalaenae in the British Museum. Taylor and Francis, London, (Erastrianae) 10, i - xix, 1 - 829."]}

Stenoloba elegans A.E. Prout, 1928 Sarawak Museum Journal, 3: 462, Pl. 15: 2. Type-locality: Borneo, Sarawak, Mt. Poi. Holotype: BMNH, London. Holloway 1982: 88, Pl. 29: 4; Holloway 2009: 74, Pl. 2: 30, Figs 127, 128. Material examined. 1 male, 2 females, Borneo, Mt. Trusmadi, Jungle Girl Camp, 3-8.ii.2017, montane rainforest, 800-1000 m, H.L. Han, genit. prep. hhl-3848-1, hhl-3579-2, 3574-2 Distribution. Indonesia: Sumatra; Malaysia: Borneo (Saravak, Sabah)., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on page 346, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Prout, A. E. (1928) XXXII, Noctuid Moths from some of the Mountains of Sarawak. Sarawak Museum Journal, III (IV) Nr. 11, 461 - 503.","Holloway J. D. & Barlow, H. S. (1982) An introduction to the moths of South-East-Asia. Malay Nature Society, I - IX, 1 - 305.","Holloway, J. D. (2009) The Moths of Borneo 13: family Noctuidae, subfamilies Pantheinae (part), Bagisarinae, Acontiinae, Aediinae, Eustrotiinae, Bryophilinae, Araeopteroninae, Aventiinae, Eublemminae and further miscellaneous genera. Malayan Nature Journal, 62 (1 & 2), 1 - 240."]}

Stenoloba mediana, sp. n. (Figs 1, 9, 16) Type material. Holotype: male, Cambodia, Phnom Samkos Wildlife Sanctuary, N12º12 ′45.6′′ E102º53 º19.2′′, Alt. 839 m, 16.ii.2013, Bae Y.S., Ju Y.D, Park B.S., Lee H.J., genit. prep. hhl-3523-1. Paratype: female, same locality and collectors as the holotype, 17.ii.2013, genit. prep. hhl-3524-2 (NEFU). Diagnosis. The new species belongs to the S. futii species - group, which was not previously recorded in the continental part of the Southeast Asia. Stenoloba mediana is most similar to S. benjamini Behounek & Kononenko, 2010 (Figs 2, 10, 17), but differs from it by the more acute forewing shape, paler wings colouration with distinct, rather contrasting pattern formed by thin black crosslines, a double antemedial line with prominent blackish suffusion; the thorax bears a crest formed by brown and red scales, and the patch of reddish scales on tornal edge of the wing in subbasal field. In these characters it also differs from other Indonesian species of the S. futii species group. In the male genitalia, S. mediana differs from S. benjamini and other related species by the more massive, broader, short uncus, and the somewhat broader and more massive valva; the less elongate sacculus, which is more quadrangular and massive compared with S. benjamini and other species of S. futti- group; in the aedeagus the vesica broadly tubular, curved ventrally, much wider and stronger than in S. benjamini. In the female genitalia S. mediana differs fom S. benjamini by somewhat broader and shorter antrum and more circulate corpus bursae (elongate in S. benjamini). Description. Adult (Fig. 1). Wingspan: male, 20 mm, female 22 mm. Head and thorax pale greenish; thoracic crest expressed, brown, surrounded with reddish scales; ground colour of forewing pale olive-grey suffused with ash; costal area from base of wing to subapical mark pale salad-green; basal field pale-greenish in costal area, white bordered with black line in medial area; subbasal field whitish with red scales along in tornal margin of wing; antemedial line twin, black, suffused with blackish scales; submedial line marked on costal area and joined with antemedial line; medial field behind antemedial line whitish, suffused with reddish-grey scales around reniform; orbicular spot not expressed, reniform, B-shaped, weakly expressed in blackish scales; postmedial line thin, black, twin in costal field, bordered outside by white line or suffusion; subterminal and terminal fields weakly separated by diffused whitish line and grey dashes; subterminal streak prominent, black; subterminal area suffused with pale ash-grey scales; terminal line expressed as broken row of small black streaks; cilia grey terminally, whitish basally. Hindwing grey-brown, darker towards apex, paler grey, basally and around ventral margin; discal spot and transversal line grey, traceable; cilia grey and whitish. Male genitalia. (Fig. 9). Uncus vestigial, short, more massive and, broader than in S. benjamini (Fig. 10) tegumen and vinculum thin, length of tegumen about 2X higher than that of vinculum; juxta shield-like, transtilla with weakly sclerotized plates; valva massive, somewhat broader and less curved compared with S. benjamini, with almost parallel margins from mid toward apex and quadrangular-rounded on apical margin, bearing one strong spine on apex; saccular plate slightly extending above edge of valva; aedeagus rather short and massive; vesica broadly tubular, curved ventrally, wide, without additional diverticula or scobination. Female genitalia. (Fig. 16). Papillae anales small, rather weak, apophyses posterior slightly shorter than apophyses anterior, antrum rather large and broad. (Fig. 17), ductus bursae broad and short; corpus bursae rounded, with prominent lateral appendix bursae. Etymology. The species name refers to characteristic feature of its forewing pattern—broad, distinct, oblique medial fascia. Distribution. The species is known only from its type locality Phnom Samkos Wildlife Sanctuary, Cambodia. Two specimens were collected in mid-February from the montane tropical forest at altitude 839 m., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on pages 343-344, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Behounek, G. & Kononenko, V. S. (2010) Fourteen new species of the genus Stenoloba Staudinger, 1892 from South East Asia (Lepidoptera: Noctuidae, Bryophilinae). Zootaxa, 2679 (1), 1 - 31. https: // doi. org / 10.11646 / zootaxa. 2679.1.1"]}

Victrix (Micromima) noloides, sp. n. (Figs 6, 7, 14, 18) Type material. Holotype: China, male, Chongqing, Jiangjin, Mt. Simian, 12-13.vii. 2018, H.L. Han & C.Zhang, genit. prep. hhl-4070-1. Paratype: 1 female, same locality and collectors, genit. prep. hhl-4071-2. Diagnosis. The new species, a characteristic representative of the genus Victrix (Noctuidae, Bryophlilinae), superficially resembles species of the genus Nola Leach (Nolidae) by virtue of the simple white ground colour and blackish forewing pattern. It is similar to Victrix sinensis Han, Behounek & Kononenko (Figs 8, 15, 19), but differs from it by the pure white ground colour of forewing (milky-white ground colour of forewing in V. sinensis) and less expressed and less contrasting forewing pattern. In the male genitalic structure, it differs by having a smaller straight harpe and narrower juxta, in the shape of valva, which is gradually constricted to apex which bears a small sclerotised extension, and shape of vesica which bears a smaller cornutus than V. sinensis. In the female genitalia it differs by a broader ovipositor, broader antrum, more strongerly curved cervix bursae and less developed sclerotised patch on the caudal surface of the corpus bursae. Description. Adult (Figs 6, 7). Wingspan 22–23 mm. Antennae simple, filiform; labial palps short, 3rd segment about half the length of 2nd, proboscis very small, vestigial; head and thorax covered with pure white scales. Ground colour of forewing pure white with light dusting of separate blackish scales, especially well expressed in medial and subterminal fields; main elements of wing pattern blackish, contrasting with white ground colour. Basal and sub-basal lines marked on basal, costal area and subcostal areas on Cu vein as wide blackish dashes; antemedial lines marked as black dusting and three dashes in costal, subcostal and tornal areas, in the medial area they may be hardly visiable except as thin interrupted line of black scales; medial field white, with medial shadow, expressed as wide blackish dash in costal area and blackish cell between orbicular and reniform spots; orbicular and reniform white, or not expressed, however in some specimens hardly visible, part of cell between orbicular and reniform shadowed with black; subterminal line, double, dentate, thin in costal part of wing; subterminal field not separated from terminal one, slightly dusted with blackish scales, with darker subterminal mark in costal area and blackish dusting in mid; subterminal line not expressed; terminal line as interrupted row of weak black transversal streaks; cilia speckled, pure white between veins, black opposite veins. Hindwing brownish-grey, darker in outer part; discal spot hardly traceable; cilia whitish-grey, with grey marks opposite veins. Male genitalia. (Fig. 14). Uncus straight, cylindrical; tegumen wide, somewhat shorter than vinculum; transtilla well expressed, ribbon-like, broad; juxta deltoid, extended basally; valva wide basally, gradually constricted apically; sacculus broad; harpe moderate, flat, broad basally, constricted apically; top of valva abrupt, cucullus somewhat pointed, bearing short pointed extension. Aedeagus straight, thinner and longer than in V. sinensis; vesica everted perpendicularly to aedeagus tube, broad tube-like, bearing sub-apical diverticulum with one flat nail-like cornutus. Female genitalia. (Fig. 18). Ovipositor small, papillae anales moderate, quadrangular, broader than in V. sinensis; apophyseposteriores and anteriores weak, thin, equal in length; antrum rather broad, folded; ductus bursae with strongly bent sclerotised ribbon; corpus bursae rounded, with sclerotised fold in caudal part; ductus seminalis arising near sclerotised fold in middle of corpus bursae. Etymology. The species name refers to its superficial similarity with representatives of the genus Nola (Nolidae). Distribution. The species is known only from its type locality in the Simian Mountain in Jiangjin District of Chongqing City.

Stenoloba pendleburyi Holloway, 2009 Moths of Borneo 13, Malayan Nature Journal 62(1&2): 75, Pl. 2: 32, Figs 132, 133. Type-locality: Malaya: Kuala Lumpur Gardens. Holotype: BMNH, London. Material examined. 1 female, Borneo Jungle Girl Camp, 3-8.ii.2017, montane rainforest, about 1000 m, H.L. Han, genit. prep. hhl-3522-2. Distribution. Malaysia Peninsular, Borneo (Holloway 2009), Sumatra., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on pages 345-346, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Holloway, J. D. (2009) The Moths of Borneo 13: family Noctuidae, subfamilies Pantheinae (part), Bagisarinae, Acontiinae, Aediinae, Eustrotiinae, Bryophilinae, Araeopteroninae, Aventiinae, Eublemminae and further miscellaneous genera. Malayan Nature Journal, 62 (1 & 2), 1 - 240."]}

Genus Victrix Staudinger, 1879 Victrix Staudinger, 1879, in Romanoff, Horae Societatis Entomologicae Rossicae. 14: 489. Type-species: Victrix karsiana Staudinger, 1879, by monotypy. Type-locality [Turkey]: Armenia, Kars. Synonymy: Oederemia Hampson; Amelia Wagner; Amelina Draudt. Note. Victrix is a Palaearctic genus of the subfamily Bryophilinae containing 45 described species (including one, described hereby). The centre of diversity of the genus apparently is Central Asian region. The European and partially Asian faunas of Victrix were revised by Varga & Ronkay (1989, 1991) and Fibiger et al. 2009 with detailed diagnosis, history and synonymy of the genus. The genus is divided into the five subgenera: Victrix (s. str.), Chytobrya Draudt, Polyobria Hampson, Rasihia Kocak, and Micromima Matov, Fibiger & Ronkay (in Fibiger et al. 2009). Chinese species of the genus Victrix have been reviewed by Han et al. 2011 and Han & Kononenko 2017. The generic diagnosis and checklist of species have been provided. A total of 16 species of Victrix are known from China including the following species. A new species of Victrix belonging to the subgenus Micromima is described below., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on pages 346-347, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Staudinger, O. (1879) Quelques observations sur les Lepidopteres de la partie du Haut-Plateau Armenien, comprise entre Alexandropol, Kars et Erzeroum. Horae Societatis Entomologicae Rossicae, 14, 483 - 495.","Varga, Z. & Ronkay, L. (1989) Taxonomical notes on the genus Victrix Staudinger, 1879 (Lepidoptera: Noctuidae). I. Description of a new subgenus, two new species and a new subspecies. Nota Lepidopterologica, 12 (1), 65 - 82.","Varga, Z. & Ronkay, L. (1991) Taxonomical notes on the Genus Victrix Stgr. 1879. II. The subgenus Rasihia Kocak, 1989. Nota Lepidopterologica, 14 (2), 144 - 170.","Fibiger, M, Ronkay, L., Steiner, A. & Zilli, A. (2009) Pantheinae, Dilobinae, Acronicitinae, Nolinae, Eustrotiinae, Acontiinae, Metoponiinae, Heliothinae and Bryophilinae. Noctuidae Europaea, 11. Entomological press, Soro, 504 pp.","Han, H. L., Kononenko, V. S. & Behounek, G. (2011) Three new species of the subfamily Bryophilinae from China (Lepidoptera, Noctuidae). Zootaxa, 3108 (1), 53 - 63. https: // doi. org / 10.11646 / zootaxa. 3108.1.4"]}

Two new species of the genus Stenoloba Staudinger, 1892 (S. mediana, sp. n. and S. fuscobrunnea, sp. n.) are described from Cambodia and Laos respectively, and a new species of the genus Victrix Staudinger, 1879 (V. noloides, sp. n.) from China is described. Stenoloba chlorographa Kononenko & Ronkay, 2001 is reported for the first time from China (Xizang), and new distributional data for recently described Stenoloba species from Malaysia are presented.

Genus Stenoloba Staudinger, 1892 Stenoloba Staudinger, 1892, in Romanoff, Mémoires sur les Lépidoptéres 6: 381. Type-species: Dichagyris jankowskii Oberthür, 1884, Etudes d’Entomologie 10: 28, Pl. 3: 5, by monotypy. Type-locality: [Russia, Primorye terr.], Sidemi. Synonymy: Neothripa Hampson; Lepidopyga Warren; Conicochita Hampson. Stenoloba Staudinger is an exclusively East Asian genus of the subfamily Bryophilinae distributed from India to Indonesia, China, Japan, the Korean peninsula and south of the Russian Far East. The genus demonstrates high species richness in East Asia. The centre of diversity of Stenoloba is apparently Southwest and South China (incl. Taiwan Isl.) and adjacent regions of neighbouring countries in the Indochina peninsula, Malaysia and Indonesia. Most species occurring in the Indochina peninsula are recorded from the northeast of the peninsula. Only two species are known from Thailand and only two from Laos, and, until now, not one Stenoloba species was known from Cambodia. The descriptions of two new species from Cambodia and Laos follow. The diagnosis and taxonomic history of Stenoloba have been presented by Kononenko & Ronkay (2000), Han & Kononenko (2009, 2018), Holloway (2009), and Behounek & Kononenko (2010). The genus was originally described as monotypic based on the externally odd type-species Dichagyris jankowskii Oberthür, 1884 (Staudinger 1892). The global revision of Stenoloba was published by Kononenko & Ronkay (2000, 2001) with 47 recognized species, 25 of them new. Subsequently, 47 new taxa were described by various authors (Chang 1991; Chen 1999; Ronkay 2001; Sohn & Han 2005; Han & Lü 2007; Han & Kononenko 2009, 2015, 2018; Holloway 2009; Behounek & Kononenko 2010; Han et al. 2011; Pekarsky 2011; Sohn & Tzuo 2012 (synonymised); Pekarsky & Saldatis 2013; Pekarsky et al. 2013; Saldaitis & Volynkin 2020). Including species described by Saldaitis & Volynkin (2020) and in this publication, the genus at present, includes 96 species in 14 species-groups.., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on page 343, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Staudinger, O. (1892) Die Macrolepidopteren des Amurgebiets. I. Theil. Rhopalocera. Sphinges, Bombyces, Noctuae. Memoires sur les Lepidopteres, 6, 83 - 638, 10 pls. [in German]","Kononenko, V. S. & Ronkay, L. (2000) A revision of the genus Stenoloba Staudinger, 1892 (Lepidoptera, Noctuidae, Bryophilinae) with description of 25 new species and 3 new subspecies from East Asia (I). Insecta Koreana, 17 (3), 137 - 174.","Holloway, J. D. (2009) The Moths of Borneo 13: family Noctuidae, subfamilies Pantheinae (part), Bagisarinae, Acontiinae, Aediinae, Eustrotiinae, Bryophilinae, Araeopteroninae, Aventiinae, Eublemminae and further miscellaneous genera. Malayan Nature Journal, 62 (1 & 2), 1 - 240.","Behounek, G. & Kononenko, V. S. (2010) Fourteen new species of the genus Stenoloba Staudinger, 1892 from South East Asia (Lepidoptera: Noctuidae, Bryophilinae). Zootaxa, 2679 (1), 1 - 31. https: // doi. org / 10.11646 / zootaxa. 2679.1.1","Kononenko, V. S. & Ronkay, L. (2001) A revision of the genus Stenoloba Staudinger, 1892 (Lepidoptera, Noctuidae, Bryophilinae) with description of 15 new species and 3 new subspecies from East Asia (II). Insecta Koreana, 18 (2), 95 - 121.","Chang, B. S. (1991) Illustration of moths in Taiwan (5). National Taiwan Museum, Taipei, 336 pp. [in Chinese]","Chen, Y. X. (1999) Lepidoptera, Noctuidae. In: Zhu H. F. et al. (Eds) Fauna Sinica Insect, Vol. 16. Science Press, Beijing, 1596 pp.","Ronkay, L. (2001) New Stenoloba Staudinger, 1892 species from Taiwan and Vietnam (Lepidoptera: Noctuidae, Bryophilinae). Annales Historico-Naturales Musei Nationalis Hungarici, 93, 219 - 229.","Han, H. L. & Lu, L. - S. (2007) A new species, Stenoloba motuoensis sp. nov. from China (Lepidoptera, Noctuidae s. l.). Tinea, 20 (1), 6 - 8.","Han, H. L., Kononenko, V. S. & Behounek, G. (2011) Three new species of the subfamily Bryophilinae from China (Lepidoptera, Noctuidae). Zootaxa, 3108 (1), 53 - 63. https: // doi. org / 10.11646 / zootaxa. 3108.1.4","Pekarsky, O. (2011) A new Stenoloba Staudinger species from China (Lepidoptera, Noctuidae, Bryophilinae). ZooKeys, 108, 67 - 72. https: // doi. org / 10.3897 / zookeys. 108.1208","Saldaitis, A. & Volynkin, A. V. (2020) Two new Stenoloba Staudinger, 1892 from Yunnan, southwestern China (Lepidoptera, Noctuidae, Bryophilinae). Zootaxa, 4755 (3), 545 - 552. https: // doi. org / 10.11646 / zootaxa. 4755.3.6"]}

Stenoloba fuscobrunnea, sp. n. (Figs 3, 11) Type material. Holotype: male, Laos, Namha, 22.iii.2016. Xing Yue, Liu, genit. prep. hhl-3844-1 (NEFU). Paratype: 1 male (in worn condition) same locality, data and collector. Diagnosis. Judging by wing pattern and the characteristic structure of the male genitalia this new species belongs to the Stenoloba futti species-group, althouth it has no closely related species and occupies a special place in the group. It is the second species of the S. futti species–group in continental Southeast Asia. Externally it differs from other species in the S. futti –group by its somewhat larger size (27 mm vs 20-22), brown or olive brown ground colour of forewing with intensive ash-grey dusting in medial, subterminal and terminal areas, and elements of the wing pattern formed by thin black lines. In the male genitalia it differs in the presence of a very large spatulate subscaphium and the vesica armed with two robust short cornuti on broad base (these characters are not recorded in any other species of the group). The other male genitalic characters (shape and arming of valva, vestigial uncus, thin tegumen and vinculum) correspond to the ground plan of male genitalia in the S. futti species–group (Behounek & Kononenko 2010). Description. Adult (Fig. 3). Wingspan: male, 27 mm. Head and thorax brown-grey, patagia bordered by darkbrown; thoracic crest expressed, dark reddish-brown. Ground colour of forewing dark brown with olive-grey suffusion in costal and tornal areas and light ash-grey dusting in medial, subterminal and terminal areas; basal field olive-grey, bordered with thin black mark; subbasal field pale olive-grey bordered with thin w-like subbasal line; antemedial line double, black, bordered inside by a diffused brown line; in the costal area it is weakly expressed and joined with subbasal line by black streak; medial line marked in costal and ventral areas by black streaks; medial field behind antemedial line olive-grey in costal and central areas, suffused with whitish and grey scales around reniform to apical angle; orbicular and reniform spots faint; orbicular rounded, reniform very faint, marked by blackish and whitish scales; postmedial line thin, black; subterminal and terminal fields in costal area weakly separated by diffuse grey line, in rest of wing by brown band; subterminal streak prominent, contrasting, black; subterminal area whitish in costal area, suffused with whitish and grey scales; terminal line expressed as broken row of small blackish streaks; cilia grey-brown, basally whitish. Hindwing pale yellowish-grey, paler basally and around ventral margin, darker grey-browntoward outer margin; discal spot and transversal lines visible; cilia whitish, checkered with grey. Male genitalia. (Fig. 11). Uncus vestigial, extremely small, scaphium sclerotised, strongly developed, appearing as a spatulate, medially wide sclerotised plate with long neck, acute apically; tegumen and vinculum, almost equal in length; juxta plate-like, extended vertically, twice as long as wide; transtilla with sclerotized plates; valva 2.5 as wide basally as in apical third, gradually tapered apically, bearing one strong apical spine; saccus broad, massive, U-like; sacculus rather short, massive, saccular plate rounded, not extending costa of valva; aedeagus moderate in length, massive, vesica broadly tubular, with two broad sub-basal diverticula, bearing two robust short spine-like cornuti on broad base. Female unknown. Etymology. The species name refers to its characteristic forewing colouration with brown ground colour and intensive pale ash-grey with greenish tint suffusion in central to apical part of forewing. Distribution. The species is known only from its type locality — Namha National Biodiversity Park, Laos. One specimen was collected in last week of March in tropical forest., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on pages 344-345, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Behounek, G. & Kononenko, V. S. (2010) Fourteen new species of the genus Stenoloba Staudinger, 1892 from South East Asia (Lepidoptera: Noctuidae, Bryophilinae). Zootaxa, 2679 (1), 1 - 31. https: // doi. org / 10.11646 / zootaxa. 2679.1.1"]}

Stenoloba futii Kononenko & Ronkay, 2000 Insecta Koreana, 17(3):165, fig. 22, 49, 49a, 67. Type-locality: Malaysia, Pahang state, Cameron Highlands, Tanah Rata. Holotype: male HNHM, Budapest. Material examined. 1 males, 2 females, Borneo, Mt. Trusmadi, Jungle Girl Camp, 20-25.viii.2016, 24.iv-2.v.2016, montane rainforest, 800-1000 m, H.L. Han, genit. prep. hhl-3848-1, hhl-3574-2, hhl-3579-2. Distribution. Myanmar; Indonesia: Sumatra, Java; Malayan Peninsula and Borneo (Sabah). It is reported for the first time from Borneo., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Two new species of Stenoloba Staudinger, 1892 and one Victrix Staudinger, 1879 from East Asia and China (Lepidoptera, Noctuidae, Bryophlilinae), pp. 342-352 in Zootaxa 4951 (2) on page 346, DOI: 10.11646/zootaxa.4951.2.7, http://zenodo.org/record/4683760, {"references":["Kononenko, V. S. & Ronkay, L. (2000) A revision of the genus Stenoloba Staudinger, 1892 (Lepidoptera, Noctuidae, Bryophilinae) with description of 25 new species and 3 new subspecies from East Asia (I). Insecta Koreana, 17 (3), 137 - 174."]}

Bellulia fuscis Han & Kononenko sp. n. (Figs 14, 29) Type material. Holotype: male, Cambodia, Prov. Mondul Kiri, Seima Biodiversity Conservation Area, 3-8.vii.2009, Y.S. Bae et al., genit. prep. hhl-2348-1, coll. NEFU. Diagnosis. This species is similar to B. basalia Fibiger, 2010 (Fig. 13) and B. wui Fibiger, 2008 (Fig. 16), but differs from both species in the reddish-brown ground colour of the forewing (in B. basalia it is blackish-brown; in B. wui greyish-brown); the inner line of the antemedial line is very thin (in B. basalia and in B. wui it is more distinct), outer line bordering the antemedial line is broad medially (in B. basalia and B. wui it is regular); inner line of the postmedial line presents as a distinct broad black patch on the costal margin (in B. basalia black patch not expressed; in B. wui black patch weakly expressed); the reniform spot is small and irregular, yellow (in B. basalia larger, rounded, and muddy yellow; in B. wui it is small and white). In the male genitalia of B. fuscis (Fig. 29) the ventral part of the tegumen fused to the fultura superior with prominent extensions, the right apically furcate (in B. basalia, Fig. 28), the left one is pig ear-shaped, extended apically, sharp); the left sacculus is as broad as the basal part of valva (in B. basalia it is narrower than the valva); the vesica bears five cornuti of equal size (in B. basalia the vesica bears six cornuti of increasing size). Description. Adult (Fig. 14). Wingspan 11.0-12.2 mm. Head and abdomen blackish; thorax slightly russet, mixed with black. Forewing brownish and light russet, with black and dark brown scales throughout; basal line black, distinct, present only at costal margin; antemedial line black, double, smoothly curved, its inner line slender and indistinct, outer line broad medially; postmedial line black, double, waved, its outer line thin, indistinct, inner line as broad patch in costal area; subterminal line double, weakly waved, its inner line slightly darker than ground colour, thin, indistinct, outer line broad and black between costa and M2, otherwise indistinct; terminal line black; fringe same as ground colour; costal area smoky-black, with cyan and some whitish-grey, and slightly darker than reminder of wing; reniform spot small, irregular with yellow scalling, outlined with black. Hindwing lighter than forewing; discal spot present, tinged dark; outer margin slightly incurved at M2; fringe same as ground colour, mixed with greyish yellow basally. Male genitalia (Fig. 29). Tegumen broad, slightly longer than vinculum; ventrally fused to fultura superior with a prominent, log-shaped, curved process on each side, left one longer than right, pig-ear shaped apically, right process furcate. Vinculum broader than tegumen, V-shaped. Saccus broad V- shaped. Juxta ring-shaped, sclerotized, with full circular opening at center. Valva broad, weakly asymmetrical, left valva broader and shorter than right; sacculus slightly asymmetrical, left valva slightly shorter than right, about 3/5 as long as valva, somewhat narrower than base of valva, right sacculus broader than base of valva; ampullae slightly asymmetrical, rounded, with heavy setae, right ampulla slightly larger than left; costa thick and arched, broader on right valva. Aedeagus with coecum 1/4 as long as aedeagus, sclerotized, inbarely curved posteriorly; ductus ejaculatorius with large swelling; vesica with five tiny sclerotized cornuti medially. Female genitalia. Female unknown. Etymology. The species name derived from the Latin “ fuscus ” (brown) and refers to the brown colouration of the adult of the new species. Distribution. Cambodia (Prov. Mondul Kiri).

Bellulia jiaxuanae sp. n. (Figs 7, 22) Type materials. Holotype: male, China, Prov. Yunnan, Mt. Gaoligong, Baihualing, 30.vii-2.viii.2014, H.L. Han, genit. prep. hhl-3537-1, coll. NEFU. Paratype: 1 male with same data as holotype, coll. NEFU. Diagnosis. Superficially this species is similar to B. bibella Fibiger, 2011 (Fig. 8), but can be distinguished by the following characters: the ground colour of the forewing is lighter; the basal line is indistinct (in B. bibella it is distinct); the antemedial line waved, its outer line darker than the inner line (in B. bibella it is smoothly curved, similar to a fused double line); the postmedial line is more slender (; the subterminal line appears with round straw spot in apical area (in bibella it is bar or wedge-shaped). In the male genitalia of B. jiaxuanae (Fig. 22), the ventral part of the tegumen is fused with the fultura superior with a prominent process, rather longer and broader than in B. bibella; the sacculus in the left valva is broader, as long as the valva (in B. bibella it is narrower and shorter than the valva); the right ampulla is curved, bar-shaped (in B. bibella it is disc-shaped apically); the terminal part of the aedeagus is bent at a right angle, smoothly raised dorsally (in B. bibella the aedeagus is smoothly curved posteriorly, with raised hump). Description. Adult (Fig. 7). Wingspan 12.5-13.0 mm. Head grey; thorax and abdomen light, greyish brown with yellowish grey patagia, reddish grey on mesothorax; abdomen with tuft of black scales on second segment. Forewing greyish brown with darker brown and black pattern; basal line blackish brown, slender, indistinct, slightly waved; antemedial line blackish brown to black, double, incurved in discal cell and Cu-A2, its outer line broader and darker than inner line; postmedial line blackish brown to black, double, slender, from costal arched around inner margin of discal cell, then incurved towards inner margin; subterminal line black, formed by rounded spots between costa and M2, otherwise indistinct; terminal line black; fringe same as ground colour; basal, postmedial line areas darker towards costa, mixed with small white scales; reniform spot yellowish-white, outlined with black. Hindwing lighter than forewing; discal spot tinged, dark. Male genitalia (Fig. 22). Tegumen narrow, about 4/3 as long as vinculum; its ventral part fused to fultura superior with prominent, log-shaped and curved process on each side, with swollen rounded apex, left one longer than right, in right process apex irregularly trifid; basal part of right process broader than left. Vinculum thicker than tegumen, V-shaped. Saccus short, U-shaped, broad. Juxta sclerotized, with circular ring. Valvae rather narrow, strongly asymmetrical, left one shorter than right; sacculus asymmetrical, left one broader and shorter than right, as long as valva, right sacculus about 1/3 length of valva, apically rounded; ampullae asymmetrical, curved, bar-shaped, with heavy setae, right one larger and broader than left; costa thick and arched, right one significantly broader than left. Aedeagus with coecum about 1/5 length of aedeagus, medially slightly waved, terminally bent at right angle, slightly swollen apically; vesica with five small sclerotized cornuti. Female genitalia. Female unknown. Etymology. The species named by Chinese women’s name “ Jiaxuan ” and dedicated to the first daughter of the first author. Distribution. China (Prov. Yunnan: Gaoligong Mt.). The species was collected in the tropical rainforest zone., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Six new species of the genus Bellulia Fibiger, 2008 from China and Cambodia (Lepidoptera, Erebidae, Hypenodinae). Taxonomic study of Micronoctuini Contribution III, pp. 117-130 in Zootaxa 4938 (1) on pages 122-123, DOI: 10.11646/zootaxa.4938.1.6, http://zenodo.org/record/4561447

Bellulia diannana sp. n. (Figs 15, 30) Type materials. Holotype: male, Cambodia, Kep, 11.ii.2015, Y.S. Bae et al., genit. prep. hhl-3538-1, coll. INU. Pratypes: Cambodia: 1 male, Keo Seima Wildlife Sanctuary, 1.vii.2011, Y.S. Bae et al.; 1 male, Kep, 16-17.vii.2012, Y.S. Bae et al.; 3 males, Kep, 19.viii.2013, Y.S. Bae et al.; 1 male, Kep, 5.ii.2014, Y.S. Bae et al.; 3 males, Kohkong, 7.ii.2014, 9.ii.2015, Y.S. Bae et al.; China: 1 male, Prov. Yunnan, Simao, Manxieba, 22.vii.2012, H.L. Han, X.X. Jin & H. Geng. Diagnosis. Externally this species is similar to B. suffusa (Fig. 12), but differs from in the light greyish-brown ground colour of the forewing (in B. suffusa it is dark); the basal line is distinct (in B. suffusa it is indistinct); antemedial line distinct (in B. suffusa - distinct); the space between inner and outer bordering lines of the postmedial line is only little darker than the ground colour (in B. suffusa it is greyish); the reniform spot is small (in B. suffusa it is much larger and outlined with black). The male genitalia structure B. diannana (Fig. 30) is close to B. suffusa and B. fuscis (Fig. 29), but differs by in its broader tegumen (in B. suffusa and B. fuscis the tegumen is narrow); fused withto the fultura superior with prominent processes that are not furcate (in B. suffusa and B. fuscis the right process is furcate); the juxta is ovoid, with a walnut-shaped circle opening in the center (in B. suffusa and B. fuscis the opening is circular); the ampullae are larger than in B. fuscis; aedeagus bears a small and triangular horn at the apex (not present in either B. suffusa or B. fuscis); the vesica bears seven tiny cornuti of varying size (B. suffusa and B. fuscis each have five similarly sized cornuti). Discription. Adult (Fig. 15). Wingspan 11.5-13.2 mm. Head, thorax and abdomen yellowish brown. Forewing pale yellowish brown, with black and dark-brown scaling; basal line black, arched, distinct, broader near costal margin; antemedial line double, arched, its inner bordering line ochreous brown, slender, outer bordering line black to blackish-brown, broader between costal and inner veins of discal cell, otherwise slender; postmedial line black, double, waved, distinct, fused to broad patch in costal area; subterminal line double, slightly waved, its inner line thin, present as only as small dot at costal margin; otherwise somewhat darker than ground colour, outer line broad and black between costa and M2, otherwise indistinct; terminal line black; fringe same as ground colour; reniform spot small, whitish yellow. Hindwing greyish brown, darker than forewing; discal spot tinged with dark, indistinct; outer wing margin weakly incurved at M2; fringe lighter than ground colour, greyish-yellow at base. Male genitalia (Fig. 30). Tegumen narrow, 5/4 as long as vinculum; its ventral part fused to fultura superior with prominent, log-shaped, curved processes on each side, left process longer than righttapered apically, right process scraping knife shape, apically sharp, triangular prism-shape basally. Vinculum thick, broad, V shaped. Saccus broad, V-shaped. Juxta ovoid, sclerotized, with walnut-shape rounded opening in center. Valva broad, slightly asymmetrical; sacculus weakly asymmetrical, right sacculus somewhat shorter and broader than left, 2/3 as long as valva, broader than base of valva, left sacculus same width as basae of valva; ampullae slightly asymmetrical, rounded, covered with heavy setae, right ampullae slightly larger than left; costa thick and arched, thinner in right valva than in left. Aedeagus with coecum 1/4 as long as aedeagus, sclerotized, strongly curved in posteriorly, with a small and triangular horn at apex; ductus ejaculatorius swollen; vesica with seven tiny variously sized medial cornuti. Female genitalia. Female unknown. Etymology. The species name is the combination of two Chinese words, it refers to Yunnan Province which is called “Dian” for shortness in Chinese, and South which called “ Nan ”. The name indicates South of Yunnan. Distribution. China (Prov. Yunnan); Cambodia (Prov. Kep and Prov. Kohkong)., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Six new species of the genus Bellulia Fibiger, 2008 from China and Cambodia (Lepidoptera, Erebidae, Hypenodinae). Taxonomic study of Micronoctuini Contribution III, pp. 117-130 in Zootaxa 4938 (1) on pages 128-129, DOI: 10.11646/zootaxa.4938.1.6, http://zenodo.org/record/4561447

Bellulia tenebrosa sp. n. (Figs 2, 18) Type materials. Holotype: male, Cambodia, Prov. Mondul Kiri, Seima Biodiversity Conservation Area, 1- 3.vii.2011, Y.S. Bae et al., genit. prep. hhl-3720-1, coll. NEFU. Paratype: 1 male with same data as holotype, genit. prep. hhl-3724, coll. INU. Diagnosis. This species is superficially is similar to B. kareni (Fig. 1), but can be distinguish by the following characters: the forewing is rather broad (much narrover in B. kareni); the basal line is distinct (in B. kareni it presents only on the costal margin); the antemedial line is broad and waved (in B. kareni it is smoothly curved); postmedial line bears big costal marks (in B. kareni with small costal blackish-brown mark); subterminal line broad, with grains (in B. kareni it is thin and smooth); the hindwing is less darker than forewing (in B. kareni ratherit is lighter than forewing, with weakly metallic luster). In the male genitalia of B. tenebrosa (Fig. 18) the tegumen much broader than in B. kareni the ventral part of the tegumen is fused to the fultura superior bearing a prominent, log-like processes on each side which are thinner than in B. kareni (Fig. 17); in the right valva the process of costa is short and straight, cone-shaped, protrudes from the exterior half of the costa (in B. kareni it is horn-shaped, protrudes from the medial part of the costa); the sacculus is apically rounded (in B. kareni it is a narrow liguliform process); the aedeagus narrower than in B. kareni and B. clara (Fig. 19). Description. Adult (Fig. 2). Wingspan 9-10 mm. Head and thorax yellowish grey, mixed with yellow scales on patagium; abdomen yellowish grey, with yellow terminal part. Forewing grey to yellowish grey; basal line greyish brown; antemedial line dark greyish brown, mixed with black, waved at discal cell and near 1A+2A; median line absent; postmedial line greyish brown, slender, with blackish brown speck on costal area, arched and slightly waved; subterminal line brown, broad, incurved from costal margin to M3, then slightly waved, oblique interiorly; terminal line a row of small brown dots; fringe yellowish grey; basal area yellowish brown; subterminal area dark yellowish brown, with black scales; reniform spot yellowish white, with small and black to dark blackish brown dot. Hindwing dark yellowish grey to yellowish brown; discal spot darkly tinged; outer margin slightly incurved; fringe greyish yellow. Male genitalia (Fig. 18). Tegumen narrow, about twiceas long as vinculum,; ventrally fused to fultura superior, with prominent, stick-like, apically rounded process, fused on both sides, the left one shorter than right. Vinculum slender, V-shaped. Saccus short, V-shaped. Juxta eye-shaped, sclerotized, with full circle opening on left side in upper part. Valva broad, asymmetrical, left one narrower than right; sacculus asymmetrical, left sacculus narrow, about half length of valva, right one shorter than left, smoothly rounded apically; process of sacculus slender, straight; ampullae asymmetrical,, smoothly curved, right one larger than left, with heavy setae; process of costa in right valva short and straight, cone-shaped, protrudingfrom apical half of costa. Aedeagus with coecum about 1/6 as long as entire aedeagus; its basal third straight, distal two-thirds hardly curved, gradually tapered, rounded apically, slightly swollen at ductus ejaculatorius., Female genitalia. Unknown. Etymology. The species name derived from the Latin word “ tenebris ” (dark) and refers to colouration of the adult in the B. kareni species-group. Distribution. Cambodia (Prov. Mondul Kiri: Seima Biodiversity Conservation Area). The species was collected in the tropical rainforest zone., Published as part of Han, Hui Lin & Kononenko, Vladimir S., 2021, Six new species of the genus Bellulia Fibiger, 2008 from China and Cambodia (Lepidoptera, Erebidae, Hypenodinae). Taxonomic study of Micronoctuini Contribution III, pp. 117-130 in Zootaxa 4938 (1) on pages 118-120, DOI: 10.11646/zootaxa.4938.1.6, http://zenodo.org/record/4561447, {"references":["Fibiger, M. (2008) Revision of the Micronoctuidae (Lepidoptera: Noctuoidea). Part 2, Taxonomy of the Belluliinae, Magninae, and Parachrostiinae. Zootaxa, 1867 (1), 1 - 136. https: // doi. org / 10.11646 / zootaxa. 1867.1.1","Fibiger, M., Han, H. L. & Kononenko, V. S. (2011) Five new species and one new subspecies of Micronoctuidae from China, with a checklist of Chinese species, including Taiwan (Lepidoptera: Noctuoidea, Micronoctuidae). Zootaxa, 2777 (1), 41 - 53. https: // doi. org / 10.11646 / zootaxa. 2777.1.3"]}