Search

A growing number of metagenomics-based approaches have been used for the discovery of viruses in insects, cultivated plants, and water in agricultural production systems. In this study, sixteen blueberry root transcriptomes from eight clonally propagated blueberry plants of cultivar ‘Emerald’ (interspecific hybrid of Vaccinium corymbosum and V. darrowi) generated as part of a separate study on varietal tolerance to soil salinity were analyzed for plant viral sequences. The objective was to determine if the asymptomatic plants harbored the latent blueberry red ringspot virus (BRRV) in their roots. The only currently known mechanism of transmission of BRRV is through vegetative propagation; however, the virus can remain latent for years with some plants of ‘Emerald’ never developing red ringspot symptoms. Bioinformatic analyses of ‘Emerald’ transcriptomes using de novo assembly and reference-based mapping approaches yielded eight complete viral genomes of BRRV (genus Soymovirus, family Caulimoviridae). Validation in vitro by PCR confirmed the presence of BRRV in 100% of the ‘Emerald’ root samples. Sequence and phylogenetic analyses showed 94% to 97% nucleotide identity between BRRV genomes from Florida and sequences from Czech Republic, Japan, Poland, Slovenia, and the United States. Taken together, this study documented the first detection of a complete BRRV genome from roots of asymptomatic blueberry plants and in Florida through in silico analysis of plant transcriptomes.

Tomato mottle virus (ToMoV) is a single-stranded DNA (ssDNA) begomovirus transmitted to solanaceous crops by the whitefly species complex (Bemisia tabaci), causing stunted growth, leaf mottling, and reduced yield. Using a genetic repertoire of seven genes, ToMoV pathogenesis includes the manipulation of multiple plant biological processes to circumvent antiviral defenses. To further understand the effects of whitefly feeding and whitefly-transmitted ToMoV infection on tomato plants (Solanum lycopersicum &lsquo, Florida Lanai&rsquo, ), we generated comprehensive protein profiles of leaves subjected to feeding by either viruliferous whiteflies harboring ToMoV, or non-viruliferous whiteflies, or a no-feeding control. The effects of whitefly feeding and ToMoV infection were measured both locally and systemically by sampling either a mature leaf directly from the site of clip-cage confined whitefly feeding, or from a newly formed leaf 10 days post feeding (dpf). At 3 dpf, tomato&rsquo, s response to ToMoV included proteins associated with translation initiation and elongation as well as plasmodesmata dynamics. In contrast, systemic impacts of ToMoV on younger leaves 10 dpf were more pronounced and included a virus-specific change in plant proteins associated with mRNA maturation and export, RNA-dependent DNA methylation, and other antiviral plant processes. Our analysis supports previous findings and provides novel insight into tomato&rsquo, s local and systemic response to whitefly feeding and ToMoV infection.

The complete genome sequence of a bipartite begomovirus found in a Sida sp. plant growing in Bradenton, FL, was determined. The virus is a new strain of Sida golden mosaic Buckup virus (family Geminiviridae, genus Begomovirus). This is the first report of this virus in the United States and the first report outside Jamaica.

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

The location of tomato mottle virus (ToMoV) and cabbage leaf curl virus (CabLCV) (Geminiviridae, genus Begomovirus) in the whitefly vector Bemisia tabaci B-biotype (Homoptera: Aleyrodidae) was elucidated using a novel technique incorporating indirect immunofluorescent labeling in freshly dissected whiteflies. Begomoviruses were visualized in the whitefly by indirect-fluorescent-microscopy. Polyclonal and monoclonal primary antibodies were used to successfully detect both ToMoV and CabLCV. Both begomoviruses were located in the anterior region of the midgut and filter-chamber of adult whiteflies, with ToMoV detected in the salivary glands. CabLCV was detected at a greater frequency than ToMoV, with a positive detection of 16% (89 out of 560) for CabLCV and 3% (25 out of 840) for ToMoV. Possible sites involved in geminivirus transport from the gut lumen of whiteflies into the hemocoel were located in the filter-chamber and anterior portion of the midgut. The location of these begomoviruses suggests a possible scenario of virus movement through the whitefly, which is discussed.

In the summers of 2000 and 2001, tomato plants (Lycopersicon esculentum) with symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in fruit number, similar to those caused by Tomato yellow leaf curl virus (TYLCV), were seen in Henderson County, NC. In 2001, symptomatic plants appeared in a 40-A (18.2 ha) field in 12 foci of ≈12 plants each, at a total incidence of less than 1%. In August 2001, DNA was extracted from leaf samples from four symptomatic plants and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses. Two sets of primers were used to test for begomoviruses, AC1048 and PCRv181 (3,4), which amplify a 1,020-bp DNA product from a wide range of monopartite and bipartite (A component only) begomoviruses, and C473 and PTYC1v2406, which preferentially amplifies a 859-bp DNA product from the monopartite TYLCV (1,2). Fragments of the expected size were obtained from all four samples, and all PCR products were sequenced. The sequences of the 1,020-bp PCR product from each of the four samples were compared and found to be 100% identical. The same was found for the 859-bp products. These sequences were compared with equivalent regions of begomoviruses and were identical to sequences of TYLCV. Since the two primer sets amplify overlapping regions of the TYLCV genome, the 1,020 and 859-bp products generated by the two primer sets from one plant were combined to create a 1,464-bp sequence that represented approximately half of the TYLCV genome and encompasses the C4 ORF, the intergenic region, and most of the coat protein gene. This 1,464-bp sequence from North Carolina was 99.2 to 99.6% identical to TYLCV sequences reported from Cuba (GenBank Accession No. AJ223505), the Dominican Republic (GenBank Accession No. AF024715), and Florida, and 96.9 to 98.2% identical to TYLCV sequences reported from the Bahamas, Israel (GenBank Accession No. X15656), Jamaica (GenBank Accession No. U84146), Mexico (GenBank Accession No. AF168709), and Spain (GenBank Accession No. AF071228). Symptomatic plants appeared to be infected with an isolate of TYLCV that is most similar to TYLCV isolates reported from Florida and the northeastern Caribbean. To our knowledge, this is the first report of TYLCV in North Carolina. TYLCV may have been introduced on transplants since the infected plants showed symptoms at an early growth stage. The appearance of infected plants in clusters of limited size suggests no spread or very limited spread in the field. Reports of populations of the whitefly (Bemisia tabaci) vector in the field were not available since whiteflies are not normally a problem in this area due to the higher altitude and relatively cool temperatures characteristic of Henderson County. It is not clear at this time what threat TYLCV poses to tomato production in the county, though its appearance indicates that the geographic range of TYLCV is continuing to expand in the southeastern United States. References: (1) M. Ghanim et al. Virology 240:295, 1998. (2) M. K. Nakhla et al. Phytopathol. Mediterr. 32:163, 1993. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt et al. Phytopathology 86:1288, 1996.

Polyclonal rabbit antisera were produced to the coat protein of Bean golden mosaic virus Brazil isolate (BGMV), Cabbage leaf curl virus (CabLCV), Tomato yellow leaf curl virus (TYLCV), and Tomato mottle virus (ToMoV), all expressed in Escherichia coli by the pETh expression vector. The expressed coat protein of each virus was purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis for use as an immunogen. The antisera to BGMV, CabLCV, TYLCV, and ToMoV reacted in indirect (plate-trapping) enzyme-linked immunosorbent assay (ELISA) with extracts from begomovirus-infected tissue. The antisera to BGMV, CabLCV, TYLCV, and ToMoV also reacted specifically with the test begomovirus antigens in leaf imprint blots and Western blots. The CabLCV and TYLCV antisera were used to detect Bean golden yellow mosaic virus antigens by immunogold labeling of thin sections of infected bean tissues. In tissue blot immunoassays, the TYLCV antiserum reacted well with TYLCV antigens but not with ToMoV antigens, while CabLCV antiserum reacted well with ToMoV antigens and weakly with TYLCV antigens. The results indicate that polyclonal antisera prepared to expressed begomovirus coat proteins were useful for the detection of begomoviruses in an array of assays.

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of Bemisia tabaci, an efficient vector of ToCV. Total nucleic acids were extracted (1) from middle-aged and mature leaves from two symptomatic plants, as well as from healthy tomato, Physalis wrightii infected with ToCV, and Nicotiana benthamiana infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato. Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic tomato plants and ToCV-infected P. wrightii, but not in those from healthy tomato or TICV-infected N. benthamiana. TICV was only detected in TICV-infected N. benthamiana. Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5′ ATGGAGAACAGT GCCGTTGC 3′; Reverse Primer: 5′ TTAGCAACCAGTTATCGATGC 3′). All samples from symptomatic tomato and ToCV-infected P. wrightii produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes. To our knowledge, this is the first report of ToCV in Israel. References: (1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) G. C. Wisler et al. Phytopathology 88:402, 1998.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence ( Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

Virus-like symptoms of leaf deformation and rugosity, especially of younger leaves, and a mild mosaic were observed on fresh market common (green) bean (Phaseolus vulgaris L.) plants in Hendry County in southwest Florida in December of 2007 and again in February of 2008. All bean fields were adjacent to watermelon fields in which Cucurbit leaf crumple virus (CuLCrV), Squash vein yellowing virus (SqVYV), and Papaya ringspot virus type W (PRSV-W) infections had previously been confirmed (fall of 2007) by PCR, reverse transcription (RT)-PCR, and/or ELISA. Whiteflies, Bemisia tabaci, were observed on both bean and watermelon plants in December and February. Fifteen samples (eleven with symptoms) were collected in December and two (both with symptoms) in February. Initial ELISA assays using commercially available antisera for potyviruses or Cucumber mosaic virus (Agdia, Elkhart, IN) were negative. Total nucleic acids were extracted and used for PCR testing. All samples tested negative by RT-PCR using specific primers for SqVYV, PRSV-W, and Cucurbit yellow stunting disorder virus, and degenerate primers for potyviruses. Ten of fifteen December samples (ten of eleven symptomatic samples) and both February samples yielded PCR products of the expected size with the degenerate begomovirus primers, PAR1c496/PAL1v1978, which amplify a portion of the begomovirus A component (3). PCR products from three December and both February samples were cloned and sequenced. The 1,159-nt PCR products shared 99% identity with each other and 96% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF256200 and AF224760, respectively). Additional degenerate begomovirus primers PBL1v2040/PCRc154, which amplify a 381-nt portion of the hypervariable region of the begomovirus B component (3), and AC1048/AV494, which amplify a 533-nt portion of a conserved region of the coat protein gene (4), were used to confirm the identity of CuLCrV in the three December samples. The PBL1v2040/PCRc154 PCR products shared 98 to 99% identity with each other and 94 to 95% identity with the corresponding region of B component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF327559 and AF224761, respectively), whereas the AC1048/AV494 PCR products shared 99% identity with each other and 97% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates. Nucleic acid dot-blot hybridization assays of sap from homogenized leaves of the three December samples (from which the PCR product clones were obtained) with a digoxigenin-labeled CuLCrV cDNA probe also confirmed the presence of CuLCrV. Although CuLCrV has been reported to experimentally infect common bean and tobacco (2), to our knowledge, this is the first report of CuLCrV infecting any noncucurbit host in Florida. This finding suggests that CuLCrV may be more widely distributed than previously known in Florida (1) and that common bean (and potentially other legumes) are potential reservoirs for CuLCrV. References: (1) F. Akad et al. Plant Dis. 92:648, 2008. (2) J. K. Brown et al. Phytopathology 92:734, 2002. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Glycans possess significant chemical diversity; glycan binding proteins (GBPs) recognize specific glycans to translate their structures to functions in various physiological and pathological processes. Therefore, the discovery and characterization of novel GBPs and characterization of glycan–GBP interactions are significant to provide potential targets for therapeutic intervention of many diseases. Here, we report the biochemical, functional, and structural characterization of a 130-amino-acid protein, Y3, from the mushroom Coprinus comatus. Biochemical studies of recombinant Y3 from a yeast expression system demonstrated the protein is a unique GBP. Additionally, we show that Y3 exhibits selective and potent cytotoxicity toward human T-cell leukemia Jurkat cells compared with a panel of cancer cell lines via inducing caspase-dependent apoptosis. Screening of a glycan array demonstrated GalNAcβ1–4(Fucα1–3)GlcNAc (LDNF) as a specific Y3-binding ligand. To provide a structural basis for function, the crystal structure was solved to a resolution of 1.2 A, revealing a single-domain αβα-sandwich motif. Two monomers were dimerized to form a large 10-stranded, antiparallel β-sheet flanked by α-helices on each side, representing a unique oligomerization mode among GBPs. A large glycan binding pocket extends into the dimeric interface, and docking of LDNF identified key residues for glycan interactions. Disruption of residues predicted to be involved in LDNF/Y3 interactions resulted in the significant loss of binding to Jurkat T-cells and severely impaired their cytotoxicity. Collectively, these results demonstrate Y3 to be a GBP with selective cytotoxicity toward human T-cell leukemia cells and indicate its potential use in cancer diagnosis and treatment.

The Potyvirus genus is one of the largest genera of plant viruses and encompasses many economically important pathogens. While a number of degenerate primers for use in broad spectrum RT-PCR assays have been published, it is not clear which of these primers would be the most useful for use by plant diagnostic laboratories. Twelve sets of primers were tested for their ability to detect nine potyviruses in a two-step RT-PCR. Viruses were extracted from different host backgrounds and were selected to represent eight clades plus one species between clades (sensu Gibbs and Ohshima, 2010). Results of this study indicated that the primers CIFor/CIRev produced easily detectable amplicons from all nine potyviruses without non-specific amplification, false positives, or false negatives. CIFor/CIRev produced single amplicons from potyvirus-infected tissues which could be sequenced directly without gel purification to identify the virus to species.

Four genomovirus genomes were recovered from thrips ( Echinothrips americanus ) collected in Florida, USA. These represent four new species which are members of the Gemycircularvirus ( n = 2), Gemyduguivirus ( n = 1), and Gemykibivirus ( n = 1) genera. This is the first record, to our knowledge, of genomoviruses associated with a phytophagous insect.

Euphorbia mosaic virus (EuMV) was found in a symptomatic passionfruit ( Passiflora edulis ) plant from Homestead, Florida, USA, as well as in the symptomatic weed Euphorbia heterophylla . This is the first identification of EuMV in Florida and the United States and the first report of a natural infection of passionfruit by EuMV.

The genome sequence of Southern tomato virus in asymptomatic Solanum lycopersicum ‘Sweet Hearts’ (STV-Florida) in Florida was assembled from small RNAs sequenced by Illumina RNA-seq. The STV-Florida genome shared 99.0 to 99.9% similarity with full genome sequences from Bangladesh, China, Mexico, and the United States (Mississippi and North Carolina).

Bemisia tabaci has had a colorful nomenclatural past and is now recognized as a species complex. This new species framework has added many new areas of research including adding new insight into the virus transmission specificity of the species in the B. tabaci species complex. There is a wide disparity in what is known about the transmission of plant viruses by different members of the B. tabaci species complex. In this paper, we have synthesized the transmission specificities of the plant viruses transmitted by species belonging to the complex. There are five genera of plant viruses with members that are transmitted by species of the B. tabaci species complex. The transmission of viruses belonging to two of these, Begomovirus and Crinivirus, are well studied and much is known in regards to the relationship between species and transmission and etiology. This is in contrast to viruses of the genera, Torradovirus and Carlavirus, for which very little is known inregards to their transmission. This is the first attempt to integrate viral data within the new B. tabaci species complex framework. It is clear that matching historical transmission data with the current species framework is difficult due to the lack of awareness of the underlying genetic diversity within B. tabaci. We encourage all researchers to determine which species of B. tabaci they are using to facilitate association of phenotypic traits with particular members of the complex. © 2014 Society of Chemical Industry

The complete genome of a variant of the multi-segmented (+) RNA virus blueberry necrotic ring blotch virus (BNRBV), which has not been assigned to a genus, was obtained from foliar red lesions on southern highbush blueberries grown in Alachua Co., Florida. The genome organization of this variant, BNRBV-RL, is the same as that of BNRBV: four genomic segments and seven ORFs (one ORF on each of RNA 1, RNA 2, and RNA 4 and as many as four ORFs on RNA 3). BLAST analysis revealed nucleic acid sequence identities of 89 %, 90 %, 90 % and 86 % to BNRBV RNA 1, RNA 2, RNA 3 and RNA 4, respectively. Phylogenetic analysis of the amino acid sequence of the putative RdRp domain indicated that BNRBV-RL was closely related to BNRBV and less related to citrus leprosis virus type C and three other mite-transmitted viruses. The nucleotide and amino acid sequence differences between BNRBV-RL and BNRBV combined with differences in symptom expression in blueberry would suggest that BNRBV-RL is a strain of BNRBV.

Background In Africa and Asia, sugarcane is the host of at least seven different virus species in the genus Mastrevirus of the family Geminiviridae. However, with the exception of Sugarcane white streak virus in Barbados, no other sugarcane-infecting mastrevirus has been reported in the New World. Conservation and exchange of sugarcane germplasm using stalk cuttings facilitates the spread of sugarcane-infecting viruses. Methods A virion-associated nucleic acids (VANA)-based metagenomics approach was used to detect mastrevirus sequences in 717 sugarcane samples from Florida (USA), Guadeloupe (French West Indies), and Réunion (Mascarene Islands). Contig assembly was performed using CAP3 and sequence searches using BLASTn and BLASTx. Mastrevirus full genomes were enriched from total DNA by rolling circle amplification, cloned and sequenced. Nucleotide and amino acid sequence identities were determined using SDT v1.2. Phylogenetic analyses were conducted using MEGA6 and PHYML3. Results We identified a new sugarcane-infecting mastrevirus in six plants sampled from germplasm collections in Florida and Guadeloupe. Full genome sequences were determined and analyzed for three virus isolates from Florida, and three from Guadeloupe. These six genomes share >88% genome-wide pairwise identity with one another and between 89 and 97% identity with a recently identified mastrevirus (KR150789) from a sugarcane plant sampled in China. Sequences similar to these were also identified in sugarcane plants in Réunion. Conclusions As these virus isolates share

Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640–750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (, This project is funded by grants from the National Science Foundation’s Systematic Biology and Biodiversity Inventories Program (DEB-1025915 to MB, DEB-1025901 to JEP). Authors would like to thank all the collaborators who provided whitefly specimens, including Jorge Gonzales (Guatemala), Moshe Lapidot (Israel), Bill Wintermantel (USA), James D. McCright (USA), Eric Portales (Guatemala), Esvin Salguero (Guatemala), Sakata Seed of Guatemala, and Sakata Seed of South America, We acknowledge support by the CSIC Open Access Publication Initiative through its Unit of Information Resources for Research (URICI).

A begomovirus causing mottling and leaf deformation in tomato from the State of Mérida was cloned and sequenced. The virus has a bipartite genome comprised of a DNA-A (2,572 nucleotides) and a DNA-B (2,543 nucleotides) with a genome organization typical of New World begomoviruses. Both components share a common region of 115 nucleotides with 98 % sequence identity. Phylogenetic analysis indicated that while no virus sequences were closely related, the A component was distantly related to those of two other tomato-infecting viruses, tomato leaf deformation virus and Merremia mosaic virus; and the DNA-B, to those of pepper huasteco yellow vein virus and Rhynchosia golden mosaic Yucatan virus. The DNA-A and DNA-B sequences were submitted to GenBank (accession no. AY508993 and AY508994, respectively) and later accepted by the International Committee on Taxonomy of Viruses as the genome of a member of a unique virus species with the name Tomato yellow margin leaf curl virus (TYMLCV). Tomato (Solanum lycopersicum L. 'Fl. Lanai') plants inoculated with cloned TYMLCV DNA-A and DNA-B became systemically infected and showed chlorotic margins and leaf curling. The distribution of TYMLCV in tomato-producing states in Venezuela was determined by nucleic acid spot hybridization analysis of 334 tomato leaf samples collected from ten states using a TYMLCV-specific probe and confirmed by PCR and sequencing of the PCR fragment. TYMLCV was detected in samples from the states of Aragua, Guárico, and Mérida, suggesting that TYMLCV is widely distributed in Venezuela.

A new system for inoculation of plants with begomoviral DNA without cloning or the use insect vectors is described. Total DNA extracted from begomovirus-infected plants was amplified by rolling circle amplification (RCA) using the bacteriophage phi29 DNA polymerase, and inoculated to plants by particle bombardment. Infection rates of up to 100% were obtained using this technique. This technique successfully inoculated all the begomoviruses evaluated: five bipartite (Bean golden yellow mosaic virus, Cabbage leaf curl virus, Squash leaf curl virus, Tomato mottle virus, Watermelon chlorotic stunt virus) as well as one monopartite (Tomato yellow leaf curl virus). The success of the technique was not dependent upon plant species. Four species from three plant families [Phaseolus vulgaris (bean), Solanum lycopersicum (tomato), Cucurbita pepo (squash), and Citrullus lanatus (watermelon)], could all be inoculated by this technique. The success of the method was not dependent upon either the type or the age of the source of virus. Infectious DNA was obtained successfully from fresh, freeze-dried or desiccated plant material, from squashes of plant leaves on FTA cards, as well as from the insect vector. Plant material collected and dried as long as 25 years ago yielded infectious DNA by this method. In summary, this method can be used to obtain infectious DNA of single-stranded circular DNA viruses that can be activated for purposes of completing Koch's postulates, for preservation of pure virus cultures, and for many other applications where infectious DNA is required.

A syndrome has been recognized on leatherleaf fern (Rumohra adiantiformis) in Costa Rica for many years that causes widespread damage but has not been described in the literature. A full description of the syndrome, termed fern distortion syndrome (FDS), is reported here, along with evidence that FDS is a new disease and that it is associated with endophytic fluorescent pseudomonads but not with any other major groups of pathogens or pests. The main aboveground symptoms of FDS are twisting and distortions of fronds, which make the fronds unmarketable. In advanced cases of FDS, fronds are often thickened, new frond growth ceases or slows dramatically, and uneven sporulation is apparent on the underside of fronds. Symptoms of FDS belowground are reduced diameter of rhizomes and reduced overall root mass. The incidence of FDS in Costa Rica was typically over 80%, and severity typically ranged from 1.26 to 2.48 using a 0 to 3 rating scale in fields propagated vegetatively with rhizomes from fields with FDS. In contrast, in three fields planted 1.5 to 4 years previously with rhizomes derived from tissue culture, incidence and severity were markedly lower: 23 to 34% and 0.24 to 0.36, respectively. Paired sampling of symptomatic and asymptomatic plants revealed significantly greater populations of fluorescent pseudomonads inside rhizomes of symptomatic plants.

The impact of trademarked and commercial products on settling of adults of the sweetpotato whitefly, Bemisia tabaci (Gennadius), was studied in the laboratory. A no-choice bioassay using leaf disks of tomato, Solanum esculentum L., was developed to evaluate the impact of concentration series of products on settling of B. tabaci adults. The concentration of each product that would reduce settling by 50% (SC50) was estimated for each product using standard probit analyses, and the values were compared with that of Ultra-Fine Oil, a paraffinic oil product that is known to reduce settling of whitefly adults. Twenty-two trademarked products and 42 other products were evaluated in the laboratory bioassay. Based upon comparisons of fiducial limits of the respective SC50 values, Dawn detergent and E-RASE jojoba oil were the only trademarked products that were as effective as Ultra-Fine Oil in reducing settling of B. tabaci adults. Of the nontrademarked products, 25 were similar to Ultra-Fine Oil, although cedar, geranium, ginger, Hamlin (citrus), patchouli, olive and wintergreen oils, as well as citronellal and limonene, had ratios of respective SC50 values with that of Ultra-Fine Oil of approximately 1.5 or less. Combinations of limonene and citronellal with either olive oil or Ultra-Fine Oil were 15 and 30 times, respectively, more effective than Ultra-Fine Oil alone. Candidate products and combinations of products were further evaluated on tomato seedlings in no-choice screenhouse trials for effects on oviposition and on transmission of Tomato yellow leaf curl virus (family Geminiviridae, genus Begomovirus, TYLCV) by B. tabaci. Ultra-Fine Oil and olive oil reduced oviposition and transmission of TYLCV in the screenhouse trials. Ginger oil and limonene reduced oviposition in at least one screenhouse trial but did reduce transmission of TYLCV. The laboratory bioassay provided a rapid and relatively easy method to compare products for reducing settling of B. tabaci adults. Even though the reduced settling indicated in the laboratory bioassays was not always reflected in reduced oviposition or TYLCV transmission in the screenhouse trials, the bioassay was useful in rapidly identifying products that reduce settling and that could be investigated further.

Background Plant viruses in the genus Begomovirus, family Geminiviridae often cause substantial crop losses. These viruses have been emerging in many locations throughout the tropics and subtropics. Like many plant viruses, they are often not recognized by plant diagnostic clinics due in large part to the lack of rapid and cost effective assays. An isothermal amplification assay, Recombinase polymerase amplification (RPA), was evaluated for its ability to detect three begomoviruses and for its suitability for use in plant diagnostic clinics. Methods for DNA extraction and separation of amplicons from proteins used in the assay were modified and compared to RPA manufacturer’s protocols. The modified RPA assays were compared to PCR assays for sensitivity, use in downstream applications, cost, and speed. Results Recombinase polymerase amplification (RPA) assays for the detection of Bean golden yellow mosaic virus, Tomato mottle virus and Tomato yellow leaf curl virus (TYLCV) were specific, only amplifying the target viruses in three different host species. RPA was able to detect the target virus when the template was in a crude extract generated using a simple inexpensive extraction method, while PCR was not. Separation of RPA-generated amplicons from DNA-binding proteins could be accomplished by several methods, all of which were faster and less expensive than that recommended by the manufacturer. Use of these modifications resulted in an RPA assay that was faster than PCR but with a similar reagent cost. This modified RPA was the more cost effective assay when labor is added to the cost since RPA can be performed much faster than PCR. RPA had a sensitivity approximate to that of ELISA when crude extract was used as template. RPA-generated amplicons could be used in downstream applications (TA cloning, digestion with a restriction endonuclease, direct sequencing) similar to PCR but unlike some other isothermal reactions. Conclusions RPA could prove useful for the cost effective detection of plant viruses by plant diagnostic clinics. It can be performed in one hour or less with a reagent cost similar to that of PCR but with a lower labor cost, and with an acceptable level of sensitivity and specificity. Electronic supplementary material The online version of this article (doi:10.1186/s12985-016-0504-8) contains supplementary material, which is available to authorized users.

The three Andean states of Mérida, Táchira, and Trujillo in Venezuela produce tomatoes (Lycopersicon esculentum) year-round with a high frequency of virus-like symptoms. Polymerase chain reaction amplification using degenerate primers detected begomoviruses in 18% of leaf samples collected from tomato plants showing virus-like symptoms in commercial fields in these states between 1993 and 1994. A comparison of the sequences of the amplified DNA products revealed a diversity of begomovirus sequences in tomato plants from this region. Partial A component sequences (approximately 1,100 bp) clustered in four groups based on BLAST, GAP, phylogenetic analyses of the nucleic acid sequences, and comparisons of iteron sequences with known begomoviruses. Two groups of sequences were closely related to Potato yellow mosaic virus—Venezuela strain tomato and Tomato Venezuela virus, respectively, begomoviruses previously reported from other Venezuelan states. The other two groups of sequences appear to belong to two new begomovirus species.

Yang, Y., Sherwood, T. A., Patte, C. P., Hiebert, E., and Polston, J. E. 2004. Use of Tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer TYLCV resistance in tomato. Phytopathology 94:490-496. Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), ∆2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and Rep∆2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to ∆2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

Whitefly-transmitted viruses belonging to the genus Begomovirus (family Geminiviridae) represent a substantial threat to agricultural food production. The rapid evolutionary potential of these single-stranded DNA viruses combined with the polyphagous feeding behavior of their whitefly vector (Bemisia tabaci) can lead to the emergence of damaging viral strains. Therefore, it is crucial to characterize begomoviruses circulating in different regions and crops globally. This study utilized vector-enabled metagenomics (VEM) coupled with high-throughput sequencing to survey begomoviruses directly from whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Begomoviruses were detected in all locations, with the highest diversity identified in Guatemala where up to seven different species were identified in a single field. Both bipartite and monopartite viruses were detected, including seven new begomovirus species from Guatemala, Puerto Rico, and Spain. This begomovirus survey extends the known diversity of these highly damaging plant viruses. However, the new genomes described here and in the recent literature appear to reflect the outcome of interactions between closely-related species, often resulting from recombination, instead of unique, highly divergent species., This project is funded by grants from the National Science Foundation’s Systematic Biology and Biodiversity Inventories Program (DEB-1025915 to MB, DEB-1026095 to SD, DEB-1025901 to JEP). We acknowledge support by the CSIC Open Access Publication Initiative through its Unit of Information Resources for Research (URICI).

Background In the early 2000s, two cucurbit-infecting begomoviruses were introduced into the eastern Mediterranean basin: the Old World Squash leaf curl virus (SLCV) and the New World Watermelon chlorotic stunt virus (WmCSV). These viruses have been emerging in parallel over the last decade in Egypt, Israel, Jordan, Lebanon and Palestine. Methods We explored this unique situation by assessing the diversity and biogeography of the DNA-A component of SLCV and WmCSV in these five countries. Results There was fairly low sequence variation in both begomovirus species (SLCV π = 0.0077; WmCSV π = 0.0066). Both viruses may have been introduced only once into the eastern Mediterranean basin, but once established, these viruses readily moved across country boundaries. SLCV has been introduced at least twice into each of all five countries based on the absence of monophyletic clades. Similarly, WmCSV has been introduced multiple times into Jordan, Israel and Palestine. Conclusions We predict that uncontrolled movement of whiteflies among countries in this region will continue to cause SLCV and WmCSV migration, preventing strong genetic differentiation of these viruses among these countries.

Full-length sequences of a bipartite begomovirus were obtained from a plant of Jatropha multifida in Florida showing symptoms of foliar mosaic, distortion and necrosis. Sequences of four clones each of a DNA-A and DNA-B were obtained, which showed very low sequence diversity among themselves. The clones were infectious when biolistically inoculated to J. multifida, Phaseolus vulgaris and Nicotiana tabacum, but not to J. curcas. The DNA-A sequences had less than 89 % pairwise identity scores with the DNA-A of other begomoviruses. The DNA-A appeared to be a recombinant in that 18 % of the DNA-A (470 nt) had a pairwise identity score of 91.98 % with RhRGMV, indicating that this portion most likely originated from a virus closely related to RhRGMV. The remaining 82 % of the DNA-A had lower identity scores with TbMoLCV (87.84 %) and RhRGMV (87.46 %), which suggests that this part of the component originated from an undescribed virus. There was no evidence for recombination in the DNA-B. Equivalent sequences of the DNA-A had the highest identity score (94.18 %) with a 533-nt sequence obtained from J. multifida from Puerto Rico in 2001 (GenBank accession no. AF058025). Pairwise comparison, recombination and phylogenetic analysis, and biology suggest that these clones are those of jatropha mosaic virus first reported from Puerto Rico. This is the first report of the complete genome sequence of jatropha mosaic virus.

Adult whiteflies, Bemisia tabaci (Gennadius), collected from the field were screened for viral pathogens using a cell line from the silverleaf whitefly, B. tabaci, B biotype (syn. B. argentifolii). Homogenates from the field-collected whiteflies were applied to cell cultures and checked for cytopathic effects (CPE). Cells were observed to develop cytoplasmic inclusions and to have a change in morphology. Cells displaying CPE were observed using a transmission electron microscope and found to be infected with a virus. The virus particles had an icosahedral shape and an approximate size of 120-130 nm. The virus was observed in defined areas of the cytoplasm adjacent to the cell nucleus. Analysis using polymerase chain reaction, Southern blot hybridization, and DNA sequencing confirmed that the virus discovered infecting the whitefly cell cultures was an iridovirus. Sequence analysis showed that the amplimer (893 bp) had a 95% homology to the invertebrate iridescent virus type 6 major capsid protein gene. Discovery of new viruses of whiteflies may provide renewed interest in using pathogens in the development of innovative management strategies. This is the first report of an iridescent virus isolated from whiteflies, B. tabaci, collected from the field.

El virus del mosaico dorado amarillo de la habichuela (BGYMV) es un geminivirus transmitido por moscas blancas (Género: Bemisia). Este virus causa pérdidas económicas considerables en la habichuela común (Phaseolus vulgaris L.). Las técnicas serológicas como ELISA, se han utilizado ampliamente en la detección de viruses. Se evaluaron tres anticuerpos monoclonales existentes (3F7, 2G5 y 5C5) en la detección del BGYMV en varias líneas de habichuela en Puerto Rico. El anticuerpo monoclonal 3F7 resultó el más efectivo en detectar el virus en tejidos de habichuela de la línea DOR 364 y los cultivares susceptibles Top Crop y Quest. Sin embargo, no fue efectivo en detectar el virus en la línea DOR 303 aún en presencia de síntomas típicos.También se evaluaron muestras de Macroptilium lathyroides, una maleza que puede ser reservorio del virus. Las pruebas de ELISA resultaron inconclusas en la detección de geminiviruses en M. lathyroides. Se utilizó la reacción en cadena de la poíimerasa (PCR) para complementar el diagnóstico de! BGYMV en M. lathyroides y líneas de habichuela con síntomas de virosis pero negativas a la prueba de ELISA. Se utilizaron tíos pares de iniciadores en las pruebas de PCR, específicos para Begomovirus como el BGYMV. Utilizando PCR fue posible detectar el virus en los tejidos de la línea DOR 303 y en M. lathyroides.

The whitefly Bemisia tabaci (Gennadius) is a widely distributed pest of many important food and fiber crops. This whitefly is also a vector of more than 70 plant-infecting viruses. A cell line was established in vitro using embryonic tissues from the eggs of Bemisia tabaci (Gennadius), B biotype (pseudonym B. argentifolii Bellows & Perring), and referred to as ‘Btb(Ba)97, Hunter-Polston’. Cell cultures were successfully inoculated with begomovirus (BGMV and ToMoV)-infected tomato plant sap. Embryonic tissues were seeded into Kimura's modified medium and kept at a temperature of 24°C. Continuous cell cultures were established and have since undergone 92 passages in 25-cm 2 flasks. Cell doubling time is approximately 3 days and the cells have been successfully revived after 1 year after storage at −80°C. The cell population is monolayers of predominately fibroblast with some epithelial cells. Begomoviruses (bean golden mosaic begomovirus, BGMV, and tomato mottle begomovirus, ToMoV) were inoculated to the cell cultures independently and detected by labeling by an indirect immunofluorescence technique. The viruses were detected bound to the cell membranes and within the cell cytoplasm. This is the first report of a continuous cell line established from a species of whitefly and its inoculation with two begomoviruses. The successful inoculation of whitefly cell cultures with begomoviruses shown in our results represents great promise for the development of systems that allow researchers to achieve a better understanding of the complex relationship between begomoviruses and their whitefly vectors.

Tomato plants treated with plant growth-promoting rhizobacteria (PGPR), applied as an industrially formulated seed treatment, a spore preparation mixed with potting medium (referred to as powder), or a combined seed-powder treatment, were evaluated under field conditions for induced resistance to Tomato mottle virus (ToMoV). The PGPR strains used, based on their ability to induce resistance in previous experiments, included Bacillus amyloliquefaciens 937a, B. subtilis 937b, and B. pumilus SE34. Experiments were conducted in the fall of 1997 and the spring and fall of 1998 at the University of Florida's Gulf Coast Research & Education Center, Bradenton. All plants were rated for symptoms and analyzed for the presence of ToMoV DNA at 40 days after transplant (dat). Whitefly densities were determined on individual plants in each trial, and marketable fruit yields were determined at least two times during each trial. The highest level of protection occurred in the fall 1997 trial when, at 40 dat, ToMoV disease severity ratings were significantly less in all PGPR powder-based treatments than in either of the seed or control treatments. Detection of viral DNA using Southern dot blot analyses correlated with symptom severity ratings, as did fruit yields. A reduction in ToMoV symptom severity ratings and incidence of viral DNA were also observed for some PGPR treatments in the spring 1998 trial, although corresponding yield responses were not apparent. Little or no resistance was observed in the fall 1998 trial. No differences in disease severity, detection of ToMoV DNA, or yield occurred among treatments in any of the trials at 80 dat. These data show that up to 40 dat under natural conditions of high levels of vector-virus pressure, some PGPR treatments resulted in reduced ToMoV incidence and disease severity and, in some cases, a corresponding increase in fruit yield. The use of PGPR could become a component of an integrated program for management of this virus in tomato.

Polston, J. E., McGovern, R. J., and Brown, L. G. 1999. Introduction of tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Dis. 83:984-988. In July 1997, symptoms characteristic of tomato yellow leaf curl virus (TYLCV-Is) were observed on one tomato plant in a field in Collier C ounty, Florida, and on several tomato plants in a retail garden center in Sarasota, Florida. Amplification with three sets of primers, analysis of amplified fragments using restriction enzyme digestion, and hybridization with a clone of TYLCV-Is indicated that TYLCV-Is was present in symptomatic plants. The sequence of a 1,300-bp amplified fragment was 99% identical to TYLCV-Is from the Dominican Republic and 98% identical to an isolate from Israel. It appears that TYLCV-Is entered the United States in Dade County, Florida, in late 1996 or early 1997. Subsequently, infected tomato transplants produced for retail sale at two Dade County fac ilities were rapidly distributed via retail garden centers throughout the state. Infected plants purchased by homeowners and pl aced in and around homes appeared to be the source of TYLCV-Is for nearby commercial nurseries and production fields. It appears that transplants have played a role in the movement of this and probably other geminiviruses. A number of regulatory procedures, as well as field management practices, were implemented in the 1997-98 production season to minimize the movement of TYLCV-Is within and out of the state.

Tobacco plants (Nicotiana tabacum ‘Xanthi’) were transformed with a binary vector containing the coat protein gene of tomato mottle begomo-virus (ToMoV) modified by the deletion of 30 nucleotides in the 5′ end. The R1 generation was screened for resistance to ToMoV by inoculation with viruliferous whiteflies. Fifteen days after inoculation, symptom development was recorded weekly for up to 120 days using a visual scale, and ToMoV infection was confirmed by polymerase chain reaction and enzyme-linked immunosorbent assay. The response to high inoculation levels of ToMoV varied and ranged from susceptibility to immunity. The transgene transcript was detected by northern blot analysis; however, the transgene product could not be detected by protein blot analysis using antisera reactive with ToMoV coat protein. The lack of detection of the transgene product in resistant plants suggests that it is not involved in eliciting the resistance response and that resistance may be mediated by the transgene transcript.

Whiteflies are a key pest of crops in open-field production throughout the tropics and subtropics. This is due in large part to the long and diverse list of devastating plant viruses transmitted by these vectors. Open-field production provides many challenges to manage these viruses and in many cases adequate management has not been possible. Diseases caused by whitefly-transmitted viruses have become limiting factors in open-field production of a wide range of crops, i.e., bean golden mosaic disease in beans, tomato yellow leaf curl disease in tomato, cassava mosaic disease and cassava brown streak disease in cassava, and cotton leaf crumple disease in cotton. While host resistance has proven to be the most cost-effective management solution, few examples of host resistance have been developed to date. The main strategy to limit the incidence of virus-infected plants has been the application of insecticides to reduce vector populations aided to some extent by the use of selected cultural practices. However, due to concerns about the effect of insecticides on pollinators, consumer demand for reduced pesticide use, and the ability of the whitefly vectors to develop insecticide-resistance, there is a growing need to develop and deploy strategies that do not rely on insecticides. The reduction in pesticide use will greatly increase the need for genetic resistance to more viruses in more crop plants. Resistance combined with selected IPM strategies could become a viable means to increase yields in crops produced in open fields despite the presence of whitefly-transmitted viruses.

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species(5), are vectors of many plant viruses. Several genera of these whitefly-transmitted plant viruses (Begomovirus, Carlavirus, Crinivirus, Ipomovirus, Torradovirus) include several hundred species of emerging and economically significant pathogens of important food and fiber crops (reviewed by(9,10,16)). These viruses do not replicate in their vector but nevertheless are moved readily from plant to plant by the adult whitefly by various means (reviewed by(2,6,7,9,10,11,17)). For most of these viruses whitefly feeding is required for acquisition and inoculation, while for others only probing is required. Many of these viruses are unable or cannot be easily transmitted by other means. Therefore maintenance of virus cultures, biological and molecular characterization (identification of host range and symptoms)(3,13), ecology(2,12), require that the viruses be transmitted to experimental hosts using the whitefly vector. In addition the development of new approaches to management, such as evaluation of new chemicals(14) or compounds(15), new cultural approaches(1,4,19), or the selection and development of resistant cultivars(7,8,18), requires the use of whiteflies for virus transmission. The use of whitefly transmission of plant viruses for the selection and development of resistant cultivars in breeding programs is particularly challenging(7). Effective selection and screening for resistance employs large numbers of plants and there is a need for 100% of the plants to be inoculated in order to find the few genotypes which possess resistance genes. These studies use very large numbers of viruliferous whiteflies, often several times per year. Whitefly maintenance described here can generate hundreds or thousands of adult whiteflies on plants each week, year round, without the contamination of other plant viruses. Plants free of both whiteflies and virus must be produced to introduce into the whitefly colony each week. Whitefly cultures must be kept free of whitefly pathogens, parasites, and parasitoids that can reduce whitefly populations and/or reduce the transmission efficiency of the virus. Colonies produced in the manner described can be quickly scaled to increase or decrease population numbers as needed, and can be adjusted to accommodate the feeding preferences of the whitefly based on the plant host of the virus. There are two basic types of whitefly colonies that can be maintained: a nonviruliferous and a viruliferous whitefly colony. The nonviruliferous colony is composed of whiteflies reared on virus-free plants and allows the weekly availability of whiteflies which can be used to transmit viruses from different cultures. The viruliferous whitefly colony, composed of whiteflies reared on virus-infected plants, allows weekly availability of whiteflies which have acquired the virus thus omitting one step in the virus transmission process.

Tomato chlorotic spot virus (TCSV) is a tospovirus, similar to but distinct from other tospoviruses currently present in Florida. Like these viruses, TCSV is transmitted by thrips and is able to replicate in both the vector and the plant. TCSV was first reported in Florida in 2012 in tomato plants in Miami-Dade and Lee Counties, but it may have been in the state for several years. Prior to 2012, TCSV was only known to occur in Brazil and Argentina. It is not known how this virus was introduced into Florida. This 5-page fact sheet was written by Jane E. Polston, Erin Wood, Aaron J. Palmateer, and Shouan Zhang, and published by the UF Department of Plant Pathology, May 2013. http://edis.ifas.ufl.edu/pp306

The internal anatomy of the anterior alimentary canal of the whitefly, Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae) B-biotype, was examined by light, scanning, and transmission electron microscopy to elucidate the location and number of precibarial and cibarial gustatory sensilla. Elucidation of the epipharyngeal organ complex within the precibarium revealed 10 precibarial sensilla located proximal to where the paired maxillary stylets diverge on their retraction. The sensory organ complex within the cibarium consists of 8 sensilla, 6 on the epipharyngeal sclerite with 2 found within the hypopharyngeal sclerite. Fine structure investigation revealed the individual neurons to terminate at sensillar pores, which allow direct contact with passing fluids, thus supporting a chemosensory function. Ultrastructure of the neurons is similar to that of precibarial and cibarial gustatory chemosensilla found in other piercing-sucking insects. Their importance to whitefly feeding is discussed.

A tospovirus was identified in tomato plants from two counties in Florida by reverse transcription-PCR and sequencing of portions of the S, M and L genomic segments. The predicted amino-acid sequences of the N protein of PCR products from four plant samples were >96% identical to those of TCSV. Partial nucleic acid sequences of the L and M RNA were >97% identical to those reported for TCSV isolates. Extracts from field samples infected test plants and produced symptoms similar to those reported for TCSV. This is the first report of an isolate of TCSV in Florida and in the USA.

Solanum viarum Dunal (tropical soda apple), an introduced and rapidly spreading weed, currently infests over 60 000 ha in Florida. Approximately 220 plants were sampled in seven stands of S. viarum in south‐west and west central Florida during 1992 and 1993 to determine the occurrence of nine viruses which can infect solanaceous crops. Virus detection utilized a double antibody sandwich‐enzyme linked immunosorbent assay, or a nucleic acid spot hybridization assay. The viruses detected included cucumber mosaic virus (CMV), potato leaf roll virus (PLRV), potato virus Y (PVY), tobacco etch virus (TEV), tomato mosaic virus (ToMV), and tomato mottle virus (TMoV). Transmission of PVY and ToMV from S. viarum produced a range of symptoms in pepper, tobacco, and tomato. Isolates of TEV from pepper, and PVY and TMoV from tomato were transmitted to S. viarum. Solanum viarum was also naturally infected in the field by Altemaria solani Sorauer and infested by Colorado potato beetles (Leptinotarsa decenlineata...

Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed "vector-enabled metagenomics" (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral diseases.

A new geminivirus, tomato mottle virus (TMoV), affecting tomato production in Florida has been cloned and sequenced. Sequence analysis of the cloned replicative forms of TMoV revealed four potential coding regions for the A component [2601 nucleotides (nt)] and two for the B component (2541 nt). Comparisons of the nucleotide sequence of the TMoV genome with those of other whitefly-transmitted geminiviruses indicate that TMoV is a typical bipartite geminivirus of the New World and is closely related to but distinct from abutilon mosaic virus.

Experimental investigations into virus recombination can provide valuable insights into the biochemical mechanisms and the evolutionary value of this fundamental biological process. Here, we describe an experimental scheme for studying recombination that should be applicable to any recombinogenic viruses amenable to the production of synthetic infectious genomes. Our approach is based on differences in fitness that generally exist between synthetic chimaeric genomes and the wild-type viruses from which they are constructed. In mixed infections of defective reciprocal chimaeras, selection strongly favours recombinant progeny genomes that recover a portion of wild-type fitness. Characterizing these evolved progeny viruses can highlight both important genetic fitness determinants and the contribution that recombination makes to the evolution of their natural relatives. Moreover, these experiments supply precise information about the frequency and distribution of recombination breakpoints, which can shed light on the mechanistic processes underlying recombination. We demonstrate the value of this approach using the small single-stranded DNA geminivirus, maize streak virus (MSV). Our results show that adaptive recombination in this virus is extremely efficient and can yield complex progeny genomes comprising up to 18 recombination breakpoints. The patterns of recombination that we observe strongly imply that the mechanistic processes underlying rolling circle replication are the prime determinants of recombination breakpoint distributions found in MSV genomes sampled from nature.

Coat proteins of several different plant viruses were transferred from entire leaves of infected hosts to nitrocellulose membranes in 2 min using a hydraulic laboratory press. Protein transfer was even across the leaf as evidenced by India ink staining of blots. Coat proteins of four different viruses were detected using virus specific IgG. The presence of viral coat proteins was observed as small intense spots whose distribution was irregular and coincided most frequently with the presence of chlorosis on the leaves. Detection was sensitive, and accurately reflected the distribution of virus symptoms across leaves.

Polston, J. E., Cohen, L., Sherwood, T. A., Ben-Joseph, R., and Lapidot, M. 2006. Capsicum species: Symptomless hosts and reservoirs of Tomato yellow leaf curl virus. Phytopathology 96:447-452. Five Capsicum species were tested for susceptibility to Tomato yellow leaf curl virus (TYLCV) and the mild strain of TYLCV (TYLCV-Mld). TYLCV was able to infect 30 of 55 genotypes of C. annuum, one of six genotypes of C. chinense, one of two genotypes of C. baccatum, and the only genotype of C. frutescens tested but was unable to infect the one genotype of C. pubescens tested. This is the first evidence for the susceptibility of C. baccatum, C. chinense, and C. frutescens to TYLCV. Unlike TYLCV isolates, TYLCV-Mld was unable to infect C. chinense. No host differences were observed between the Israeli and Florida isolates of TYLCV. None of the Capsicum species showed symptoms after infection with TYLCV or TYLCV-Mld. TYLCV was detected in fruits of C. annuum, but whiteflies were unable to transmit virus from fruits to plants. Whiteflies were able to transmit both TYLCV and TYLCV-Mld from infected pepper plants to tomato plants. Pepper plants in research plots were found infected with TYLCV at rates as much as 100%. These data demonstrate the ability of some genotypes of pepper to serve as reservoirs for the acquisition and transmission of TYLCV and TYLCV-Mld.