Search

To investigate which cytokines, chemokines and growth factors are involved in the immunopathogenesis of idiopathic uveitis, and whether cytokine profiles are associated with. Serum and aqueous humor (AH) samples of 75 patients with idiopathic uveitis were analyzed by multiplex immunoassay. Infectious controls consisted of 16 patients with ocular toxoplasmosis all confirmed by intraocular fluid analyses. Noninfectious controls consisted of 7 patients with Behçet disease related uveitis and 15 patients with sarcoidosis related uveitis. The control group consisted of AH and serum samples from 47 noninflammatory control patients with age-related cataract. In each sample, 27 immune mediators ± IL-21 and IL-23 were measured. In idiopathic uveitis, 13 of the 29 mediators, including most proinflammatory and vascular mediators such as IL-6, IL-8, IL-12, G-CSF, GM-CSF, MCP-1, IP-10, TNF-α and VEGF, were significantly elevated in the aqueous humor when compared to all controls. Moreover, IL-17, IP-10, and IL-21, were significantly elevated in the serum when compared to all controls. We clustered 4 subgroups of idiopathic uveitis using a statistical analysis of hierarchical unsupervised classification, characterized by the order of magnitude of concentrations of intraocular cytokines. The pathogenesis of idiopathic uveitis is characterized by the presence of predominantly proinflammatory cytokines and chemokines and vascular endothelial growth factor with high expression levels as compared to other causes of uveitis. There are indications for obvious Th-1/ IL21-Th17 pathways but also IL9-Th9 and increased IFN-γ-inducing cytokine (IL12) and IFN-γ-inducible CXC chemokine (IP-10). The combined data suggest that immune mediator expression is different among idiopathic uveitis. This study suggests various clusters among the idiopathic uveitis group rather than one specific uveitis entity.

The objective of this study was to assess the factors associated with anatomical and visual outcomes in patients presenting with Acanthamoeba keratitis (AK).This is a retrospective noncomparative interventional case series study comprising 44 eyes from 42 patients presenting with AK, treated with topical hexamidine diisethionate and topical polyhexamethylene biguanide, monitored between 2004 and 2008. AK was confirmed by polymerase chain reaction or direct microscopic examination. Correlation between clinical presentation and prognosis was assessed. Anatomical outcome was assessed according to the percentage of eyes requiring at least 1 surgical procedure in addition to topical treatment. Visual outcome was assessed by the best-corrected visual acuity at the end of follow-up.Polymerase chain reaction results were positive for Acanthamoeba in 40 of the 44 eyes (91%) and in 16 of the 44 eyes (36%) by direct microscopic examination. Confocal microscopy suggested the presence of Acanthamoeba in 12 of 19 eyes (63%). Amniotic membrane transplantation was performed in 8 eyes, penetrating keratoplasty in 4 eyes, and evisceration in 2 eyes. The average follow-up time was 10 months. Surgical treatment was significantly associated (P0.05) with time from symptom onset to diagnosis of30 days, an initial visual acuity of ≤20/200, an infiltrate size of3 mm, preperforating infiltrates, and corneal neovascularization. The average final visual acuity was 20/48 in eyes that did not require surgical treatment (n = 34) and 20/1702 in eyes that required at least 1 surgical procedure (n = 10; P0.0001).Late diagnosis, low initial visual acuity, corneal neovascularization, large infiltrates, and preperforated infiltrates were associated with surgical treatment in patients presenting with AK. Surgical intervention was associated with worse visual outcome.

Purpose: To target the use of two biologic tests in the diagnostic of viral Herpesviridae anterior uveitis (AC) by the consideration of clinical behavior and delay of intraocular sampling.Methods: Aqueous humor samples were collected from 42 patients suspected of having AU of infectious origin at presentation. The diagnosis of infectious uveitis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and/or detection of Herpesviridae genomes with PCR. The data were compared with data of 16 uveitis control samples used to calculate the specificity of the tests.Results: Sixteen out of 42 eyes (38%) had a final diagnosis of anterior segment infectious uveitis of viral origin (Herpesviridae) confirmed by PCR positive result (5/14 eyes; 14 of the 16 eyes were tested by PCR) and/or specific intraocular antibody synthesis (14/16 eyes).Conclusions: While the GWC is progressively less often performed, these findings suggest that it still has a role in AU suspected of herpesvirus et...

Diagnosis of Acanthamoeba by microscopic examination, culture, and polymerase chain reactions (PCRs) has several limitations (sensitivity, specificity, lack of detection of several strains, cost of testing for discrimination among strains). We developed a new high-resolution melting real-time PCR (HRM) to detect and characterize Acanthamoeba infections. HRM performances were evaluated with strains from the American Type Culture Collection (ATCC) and with 20 corneal scrapings. The DNA extracted from specimens were amplified, detected, and characterized in 1 run using 2 original primers diluted in a solution containing an intercalating dye. Detection and molecular characterization of Acanthamoeba infections could be achieved in less than 2.5 h with a dramatic reduction in cost of reactants (postamplification procedures and radioactive or fluorescent-labeled molecular probes were unnecessary). HRM detection limits were 0.1 cyst/μL or less (including genotypes T5 and T11), and its sensitivity and specificity were higher than other molecular tests. For the tested strains from the ATCC, the HRM drafted 4 different profiles: Type I (genotypes T2 and T4), Type II (T5 and T7), Type III (T8), and Type IV (T1, T3, T6, T9, T11, T12, and T13).

Cholera toxin and isoproterenol (β-adrenergic receptor agonist) are largely used to enhance cell proliferation. The aim of the study was to assess the effects of cholera toxin and isoproterenol on growth and differentiation of cells cultured from human superficial limbal explants.Limbal epithelial cells were cultured from superficial limbal explantsin basal medium either supplemented with cholera toxin or isoproterenol for 3 weeks. Growth kinetics and morphometry were studied by light and confocal microscopy. Progenitor and differentiated epithelial cell markers were studied by immunocytochemistry, flow cytometry, Colony Formation Assay, and reverse transcription and polymerase chain reaction.Cell proliferation was significantly higher with 0.5 µg/ml (p = 0.049), 1 µg/ml (p = 0.005), and 2 µg/ml (p = 0.008) isoproterenol whereas, cholera toxin and 4 µg/ml isoproterenol did not significantly increase cell proliferation. Multilayered epithelial cell sheets were obtained in all culture conditions. Addition of isoproterenol resulted in smaller cell size (p0.05) 14 days after cells were cultured, whereas cholera toxin had no effects. Strong expression of cytokeratins 3 and 4/5/6/8/10/13/18 and lower expression of cytokeratin 19, vimentin, and Delta N p63α were observed after 3 weeks of culture with no significant differences in the percentage of positive cells according to culture medium. Colony-forming efficiencies were observed after 2 weeks in all culture condition but not after 3 weeks.Isoproterenol was more efficient than cholera toxin for enhancing cell proliferation and resulted in smaller cell size. It appears to be useful and safe for growing human limbal epithelial progenitors from limbal explants with no feeders before transplantation to patients with limbal deficiency.

Purpose The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. Design Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. Participants and Controls High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. Methods The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5′CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5′TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5′TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. Main Outcome Measures Detection of fungi in corneal samples by HRM. Results High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. Conclusions High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction. Financial Disclosure(s) The author(s) have no proprietary or commercial interest in any materials discussed in this article.

The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling.Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV).When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001).For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.

Sensitive and specific laboratory tests adapted to ophthalmologic micro specimens are necessary for the clinical management of corneal ulcers (CU). The goal of this work is to analyze the correlation of diagnosis tests specificities with pricing policies for public laboratories. Human specimen procedures were extracted from the National Eye Center Laboratory registers in Paris, France with reimbursement values (pricing) confronting the National Social Security Services. According to cost of reactants and human resources, the official quotation for public laboratories for urinary tract diagnosis is 19 Euros (signals allowing for ruling-out negatives takes less than 2 min) and less than 27 Euros for a comprehensive laboratory diagnosis of CU, which includes testing for bacteria, fungi and protozoa (Acanthamoeba); antibacterial and antifungal susceptibility testing for positive cultures and adapted DNA extraction procedures for viral and protozoa PCR (>1 hour handling). Pricing calculations produced oversimplified conclusions for CU diagnosis, ignoring pathology differences, diagnosis procedures, risks and sphere of action. Comprehensive revision of cost assessment policies and diagnosis pricing should be implemented for specialized laboratories to maintain the quality of public medical care and avoid interruptions in the transmission of knowledge to younger generations. Key words: Aberration, cost assessment, laboratory diagnosis, public health, microbiological diagnosis ophthalmology.

Background: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. Methods: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. Results: The f-d-real-t PCR detects 0.1 cyst/μl or less of the 10 referenced strains (sensitivity slightly lower for Aastronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. Conclusion: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.

Background:Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).Material and methods:DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5′ATACGTAGGGTGCGAGCGTTGTCC; 5′TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95°C, 20 s and 45 cycles at 95°C, 3 s and 30 s at 60°C. DNA extraction yields were assessed in the same tube.Results:This test detects as few as 0.01 Equivalent PFU/μl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.Conclusion:The new real-time PCR is able to detect 0.01 Eq/CFU μl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

One component of control programmes to eliminate trachoma is the treatment of Chlamydia trachomatis infection. A diagnosis of trachoma is based on clinical grounds, but the signs of active trachoma do not always correlate with the presence of C. trachomatis. During a therapeutic trial, the level of C. trachomatis infection in children with active trachoma in Guinea and Pakistan was assessed using a qualitative commercially available PCR that targeted the C. trachomatis plasmid. The influence of the quality of specimens on the efficiency of the PCR was investigated using two quantitative real-time PCRs targeting the specific omp1 gene of C. trachomatis and human chromosomal DNA, respectively. C. trachomatis was detected in c. 23% of children (aged 1–10 years) who presented with clinically active trachoma. Controls showed that PCR-related problems did not influence this detection rate. For 14% of the positive samples, C. trachomatis was detected in only one eye, with a significantly lower mean load of bacteria. These results suggest that epidemiological and therapeutic surveys should be conducted by sampling and testing both eyes. Moreover, the high variability of the cell load observed in the conjunctival swabs suggests that the effectiveness of swabbing may be questionable.

Trachoma is a sight-threatening process triggered by infection of the conjunctiva with Chlamydiae. When this infection becomes chronic and is associated with poverty it triggers trachoma, the prime cause of infectious blindness in the world. Since the 1958 report indicating that the highest incidence of trachoma in Pakistan was found in the province of Punjab, no new trials have been published. In the present study, we assessed the prevalence of trachoma in 3968 children living in 11 rural villages in the district of Attock, Punjab, Pakistan. The children with trachoma were sampled to detect C. trachomatis by PCR.Children in rural villages in the district of Attock were examined for trachoma in February 2004. Samples were obtained by scraping, and DNA was extracted (MagnaPure-LC Robot) and amplified to detect C. trachomatis (Amplicor-Roche). The quality of sampling was assessed by quantifying the number of cells by real-time PCR.The prevalence of trachoma was 3.7% (0 to 6.2%). PCR was positive in 20% of samples from trachomatous children and the number of cells was always100/sample. The income levels, illiteracy, use of latrines, water supply, and the presence of animals close to dwellings were similar in all the villages. In Sujjenda, the prevalence was doubled in the warmest season.Trachoma was diagnosed in 3.7% of the children aged10 years. The low rates for positive PCR may be due to loss of the plasmid, the involvement of other Chlamydiae, or their absence in chronic infections. The results obtained here underestimate the prevalence of trachoma because most of the mothers (and babies) were not tested in the district of Attock.

Purpose The objective of this study was to identify fungi species isolated in contact lenses boxes from January 2000 to November 2012 and to compare with fungi species found in corneal samples over the same period. Methods Retrospective study from January 2000 to November 2012. Over the same period, were analyzed isolates from 68 patients with clinical signs of keratomycosis confirmed by corneal samples culture. The temporal analysis (over the last 12 years) of the isolates was performed using the chi2 test pattern. Results 456/2433 contact lenses boxes fungi (18.7%). Non-filamentous fungi (yeasts) were isolated in 280 boxes (61.3%), including 85% of Candida (46% Candida parapsilosis) and 15% of other non-filamentous fungi. Filamentous fungi were isolated in 200 boxes (43.8%): Fusarium sp. (46.5%), Penicillium (23%), Aspergillus (12%)other filamentous fungi (18.5%). Fusarium sp. were isolated in 51.4% of patients with clinical signs of keratomycosis. A significant increase in filamentous fungi (chi2 = 6.4 p

International audience; The aims of this study were to determine whether human limbal explant cultures without feeder cells result in expansion of epithelial progenitors and to estimate the optimal expansion time for progenitor cells. Limbal explants from ten human corneas were cultured for 7, 9, 11, 14, 18, and 21 days. Limbal explants from two corneas were enzymatically dissociated or directly cultured for 14 days. Progenitor cells were characterized by their ability to form colonies, by immunocytochemistry, and by quantitative real-time polymerase chain reaction. Colonies were identified after 9, 11, 14, and 18 days of culture, but not after 21 days. The number of colonies per explant was significantly higher after 14 days than after 9 and 21 days. The mean percentage of seeded cells giving rise to clones was 4.03% after 14 days of culture and 0.36% for non-cultured dissociated limbal epithelial cells. The number of cells giving rise to clones per cornea significantly increased from an average of 2275 for non-cultured cells to 24266 for cells cultured for 14 days. Immunocytochemical analysis detected positive staining for cytokeratin (CK) 3, CK5/6/8/10/13/18, CK19, vimentin, p63, and p63α, in both cultures and clones. CK3 expression increased significantly with culture time. Transcript expression was observed for CK3, CK19, vimentin, and Delta N p63α at each culture time point, both in cultures and clones. The optimal culture time for limbal explants in cholera toxin-free Green medium without feeder cells was 14 days leading to the expansion of progenitors.

International audience; PURPOSE: We examined, retrospectively, the efficacy of voriconazole in Fusarium eye infections. METHODS: Voriconazole-treated patients with proven or probable keratitis or endophthalmitis from the voriconazole database (9 patients) and six French ophthalmology departments (15 patients) were included. Sociodemographic features, predisposing factors, history of corneal trauma, associated ocular conditions, other diseases and prior therapies were analysed. Investigator-determined success was defined as infection resolution with medical treatment. Failure was no response or persistent infection and required surgery. RESULTS: Most patients were Caucasian (83 %) and male (71 %). The infection was keratitis (63 %) or endophthalmitis (37 %) and proven in 23 (96 %). Prior therapy included topical and/or systemic amphotericin (46 %), fluconazole (17 %) or others (33 %), often in combination. Causative fungi were Fusarium solani (14, 58 %), Fusarium moniliforme (1), Fusarium oxysporum (1) and Fusarium spp. (8). Voriconazole was administered systemically, topically and/or by intraocular injection, and 16 patients (67 %) received salvage and eight primary therapy. The overall response was 67 % (73 % keratitis and 56 % endophthalmitis) but seven patients required adjunctive surgery. However, response was 63 % for eight primary therapy patients and 69 % for 16 salvage therapy patients. Response by species was Fusarium solani 64 % (9/14) and all others 80 % (8/10). In 13 patients (77 %), voriconazole was used in combination (response 69 vs. 64 % alone) with topical [amphotericin B 10/24 (42 %), caspofungin 5 (21 %), natamycin 1 (4 %)] and systemic agents [caspofungin 3 (13 %), amphotericin 2 (8 %)]. CONCLUSIONS: Topical and systemic voriconazole appears to be effective alone or in combination with other agents for treating severe Fusarium keratitis or endophthalmitis.

Purpose To assess the influence of culture time on maintenance of limbal epithelial progenitors in the explant culture system. Methods Limbal epithelial cells were cultured from 2-mm2 human limbal explants in cholera toxin-free medium with no feeders for 9-21 days. Expression of differentiation and progenitor markers was assessed by immunochemestry and RT-PCR. The clonal growth ability of cultured epithelial cells at each time of culture and with murine 3T3 feeders or human corneal stromal feeders was evaluated by determining colony forming efficiency (CFE). Results The average number of cultured cells obtained after 7, 14, and 21 days was, respectively, 500, 60489, and 195949. Expression of broad spectrum cytokeratins, CK3, CK19, vimentin, p63, and ABCG-2 was observed at all culture time points by immunocytochemistry and RT-PCR. Epithelial colonies were observed at 9, 11, 14 and 18 of culture but not at 21 days, both with murine 3T3 feeders and human corneal stromal feeders. Higher number of colonies was obtained when limbal epithelial cells were cultured with murine 3T3 feeders than with human corneal stromal feeders. The highest number of colonies was obtained at 14 days of culture with murine 3T3 feeders. The average cell Feret diameter (µm)/circularity for clones obtained from 11-, 14-, and 18-day primary cultures were, respectively, 38.4/0.76, 34.2/0.80, and 45.7/0.72 (p

Purpose To assess the clinical relevance of tear anti-herpes simplex virus (HSV) antibody measurement for the diagnosis of herpes simplex keratitis. Methods Records of 364 patients clinically suspect of HSV-related keratitis who had tear anti-HSV IgG assessment (tear-quantified anti-HSV IgG/filtrated IgG ratio) in our institution between January 2000 and August 2008 were retrospectively analyzed. Patients were classified into 4 groups as follows: group 1, anti-HSV IgG negative in serum and tears; group 2, anti-HSV IgG negative in tears and positive in serum; group 3, anti-HSV IgG nonsignificantly positive in tears and positive in serum; and group 4, anti-HSV IgG significantly positive in serum and tears. Randomly selected patient charts from each group were reviewed for clinical data. Results The prevalence of anti-HSV IgG in blood increased with age from >70% before 20 years to 95% after 70 years. The prevalence of anti-HSV IgG in tears increased with age from 20% before 20 years to >50% after 70 years. The presence (either significant or not) of anti-HSV IgG in tears was significantly associated with decreased corneal sensation, presence of stromal opacities, and with neurotrophic keratitis. Logistic regression showed no significant association between age and clinical signs except for herpetic ulcers and herpetic necrotizing keratitis. Conclusions Tear production of anti-HSV IgG increases with age, and it is associated with sequelae of herpes simplex keratitis. Conversely, it is poorly associated with clinical signs of acute herpes simplex keratitis.

Purpose Acanthamoeba keratitis (AK) is a sight-threatening infection. Classic PCR enhanced sensitivity but required post-amplification procedures, increasing contamination risks. The reported real-time PCRs are unable to detect all the genotypes associated with pathology. We present a new strategy validated American Type Cell Collection strains and corneal scrapings. Methods A were detected by a fast PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green. Sequences selected in the mitochondrion were: forward primer: 5‘GCAGTCGCGGTAATACGA; reverse: 5’ACCACCTACGCACCCTTTACA and probe: 6-FAM-AGTGTTATTCGCATTGACTGGGTGTAA-TAMRA. Results The new test detects all A with different lab equipment (1 cyst or less/specimen). A.astronyxis signals are inferior to others; however, primers diluted in SYBR Green mix (without probe) detect 0.1 cyst/µl or less of this strain. For clinical samples microscopic examination and cultures detected 6 out 10 but f-d-real-t PCR 100% with results confirmed by SYBR Green. Other PCRs bracketing different regions (ribosome) detected 80 % and produced false positives for samples containing Salmonella lexinton, C. sporulans, S. marcescens and Propionibacteria. Conclusion Highly sensitive diagnosis is necessary to administrate efficient treatments at the onset of AK. The strains from the ATCC with higher sensitivity and specificity than techniques previously reported. New approaches based on High Resolution Melting r-t PCR are in development in the CHNO to detect and molecularly characterize in one run different strains of protozoa and Fungi infecting the eye.

Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE.The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared.The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative.The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.

Background: The early microbiological diagnosis of corneal infections may prevent the condition from worsening. Aim: To study the potential interferences of oxybuprocain and fluorescein solutions used by ophthalmologists on the performances of the real-time polymerase chain reaction (PCR) carried out as routine test for diagnosis of keratitis. Methods: Quantified suspensions of Herpes simplex virus (HSV1), Varicella zoster virus (VZV), Cytomegalovirus (CMV) and Acanthamoeba with and without oxybuprocain or fluorescein added before DNA extraction were tested by real-time PCR. Results: The capacities of the real-time PCR to detect HSV, VZV, CMV and Acanthamoeba were reduced by oxybuprocain and fluorescein. Both products diluted to 1/16 reduced the PCR detection capacities for more than 2 logs (DNA copies/sample). Conclusions: The simultaneous introduction of fluorescein or topical anaesthetics into the tubes containing the specimens to be tested by PCR may lead to false negative results. Because corneal specimens for microbiological diagnosis of keratitis are obtained after topical administration of anaesthetics and corneal staining with fluorescein, ophthalmologists should be aware to rinse the eye surface intensively with appropriate eye solutions to minimise the risks of misdiagnosis.

Tests available for molecular diagnosis of chlamydial infections detect Chlamydiatrachomatis, but do not find other Chlamydia species associated with genital, ophthalmic, cardiovascular, respiratory or neurological diseases. The routine detection of all Chlamydia species would improve the prognosis of infected people and guide therapeutic choices.To design and validate a sensitive, specific, reproducible, inexpensive and easy-to-perform assay to quantify most Chlamydia species.Primers and probe were selected using the gene coding for the 16S rRNA. The detection limits were assessed for suspensions of Chlamydia trachomatis, Chlamydia psittaci and Chlamydia pneumoniae. The performance of this test was compared with that of two commercial kits (Amplicor-Roche and Artus) on 100 samples obtained from children with trachoma.The detection capacities for Chlamydia trachomatis of the broad-range real-time polymerase chain reaction (PCR) were similar or slightly better than those obtained with commercial kits (0.2 copies of DNA/microl). Only the broad-range PCR identified specimens containing Chlamydia psittaci and Chlamydia pneumoniae. The commercial kits and the broad-range assay detected Chlamydia species in 5% and in 11%, respectively, of samples from children with trachoma.This new real-time PCR offers a sensitive, reproducible assay that produces results in3 h. With panels of quantified Chlamydia species, this real-time PCR can be run with all real-time PCR equipment. Larger trials are needed to confirm the utility of this test in diagnosis and for therapeutic follow-up.

Introduction Biological samples, pharmaceuticals or food contain proteins, lipids, polymers, ammoniums and macromolecules that alter the detection of infectious agents by DNA amplification techniques (PCR). Moreover the targeted DNA has to be released from the complex cell walls and the compact nucleoprotein matrixes and cleared from potential inhibitors. The goal of the present work was to assess the efficiency of enzymatic pretreatments on infectious agents to make DNA available for further extraction and amplification. Methods Staphylococcus epidermidis, Streptococcus mitis, Propionibacterium acnes, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger and Fusarium solani were mixed with an internal control virus and treated with: 1) proteinase K; 2) lyticase and 3) lyticase followed by proteinase K. DNAs was manually extracted using the QIAmp DNA Mini kit or the MagNA Pure Compact automate. DNA extraction yields and the inhibitors were assessed with a phocid Herpesvirus. Bacterial detection was performed using TaqMan real-time PCR and yeasts and filamentous Fungi with HRM (real-time PCR followed by high-resolution melting analysis). Results Viral DNA was released, extracted and detected using manual and automatic methods without pre enzymatic treatments. Either the manual or the automatic DNA extraction systems did not meet the sensitivity expectations if enzymatic treatments were not performed before: lyticase for Fungi and Proteinase K for Bacteria. The addition of lyticase and proteinase K did not improve results. For Fungi the detection after lyticase was higher than for Proteinase K, for which melting analysis did not allow fungal specification. Discussion Columns and magnetic beads allowed collecting DNA and separate PCR inhibitors. Detection rates cannot be related to DNA-avidity of beads or to elution but to the lack of proteolysis.

Arterial allografts can be used for in situ treatment of prosthetic graft infection. The purpose of this in vitro study was to compare the resistance of allografts and synthetic prostheses to infection by five strains of bacteria and to study antibiotic treatments designed to reduce allograft infection. Fresh and cryopreserved allografts were compared with synthetic prostheses made of various biomaterials including PTFE, plain Dacron, gelatine-sealed Dacron, and gelatine-sealed, rifampicine-bonded Dacron. Allografts were used with or without treatment using an antibiotic containing gentamycine, lincomycine, and vancomycine. The bacterial strains tested were Escherichia coli, Staphylococcus aureus, slime-producing Staphylococcus epidermidis, non-slime-producing Staphylococcus epidermidis, and Pseudomonas aeruginosa. Infection was evaluated by counting the number of adherent bacteria on the allograft or synthetic material after rinsing and ultrasonication. Statistical analysis was achieved using nonparametric Mann-Whitney tests. Results showed that allografts not treated with antibiotics were highly susceptible to bacterial infection. Antibiotic treatment decreased infection. Application of antibiotic after thawing cryopreserved allografts led to a significant decrease. None of the biomaterials tested provided sufficient protection against bacteria resistant to the antibiotics used.

A 68-year-old woman presented with a painless inflammation of the right superior eyelid that had started several weeks before. The clinical diagnosis concluded in canaliculitis and the solid concretions were surgically extracted from the superior canalicula. The anaerobic bacteria Fusobacterium nucleatum sp. nucleatum was isolated. Signs dramatically regressed two weeks after surgery followed by one course of oral amoxicillin and clavulanic acid associated with topical tobramycin. The clinical signs had disappeared two months later.

A single systemic injection of 75 micrograms colchicine/100 g body weight increases the permeability to inorganic phosphate of both fast gastrocnemius and extensor digitorum longus muscles and of the slow soleus muscle. In the two fast muscles, there is a significant interaction between colchicine treatment and 5-d- or 30-d- surgical denervation. In the slow soleus muscle there is no interaction between 5-d-colchicine treatment and the initial decrease in phosphate flow due to 5-d-surgical denervation but a significant interaction between colchicine treatment and the secondary increase in phosphate permeability observed after a 30-d-surgical denervation. Thirty days after a single systemic injection of colchicine the muscle phosphate metabolism is still perturbed especially in the slow soleus muscle in which the initial decrease in radioactive uptake associated with a 5-d-surgical denervation is inapparent. It is proposed that colchicine induces denervation-like alterations in the Pi- and POAS metabolism of skeletal muscles through mechanisms which are also activated -- partly or entirely -- by surgical denervation. These alterations do not result from the interruption of the axonal flow. A direct effect on the muscle membrane seems less likely than a disinhibition or activation of the muscle protein synthesis system.