Search

Zika virus (ZIKV) infection during pregnancy leads to an increased risk of fetal growth restriction and fetal central nervous system malformations, which are outcomes broadly referred to as the Congenital Zika Syndrome (CZS). Here we infect pregnant rhesus macaques and investigate the impact of persistent ZIKV infection on uteroplacental pathology, blood flow, and fetal growth and development. Despite seemingly normal fetal growth and persistent fetal-placenta-maternal infection, advanced non-invasive in vivo imaging studies reveal dramatic effects on placental oxygen reserve accompanied by significantly decreased oxygen permeability of the placental villi. The observation of abnormal oxygen transport within the placenta appears to be a consequence of uterine vasculitis and placental villous damage in ZIKV cases. In addition, we demonstrate a robust maternal-placental-fetal inflammatory response following ZIKV infection. This animal model reveals a potential relationship between ZIKV infection and uteroplacental pathology that appears to affect oxygen delivery to the fetus during development., Zika virus infection during pregnancy can result in birth defects, but underlying pathogenesis at the maternal-fetal interface is unclear. Here, the authors use non-invasive in vivo imaging of Zika-infected rhesus macaques and show that infection results in abnormal oxygen transport across the placenta.

The latency-associated nuclear antigen (LANA) of the Kaposi's sarcoma-associated herpesvirus (KSHV) performs a variety of functions to establish and maintain KSHV latency. During latency, LANA localizes to discrete punctate spots in the nucleus, where it tethers viral episomes to cellular chromatin and interacts with nuclear components to regulate cellular and viral gene expression. Using highly sensitive tyramide signal amplification, we determined that LANA localizes to the cytoplasm in different cell types undergoing the lytic cycle of replication after de novo primary infection and after spontaneous, tetradecanoyl phorbol acetate-, or open reading frame 50 (ORF50)/replication transactivator (RTA)-induced activation. We confirmed the presence of cytoplasmic LANA in a subset of cells in lytically active multicentric Castleman disease lesions. The induction of cellular migration by scratch-wounding confluent cell cultures, culturing under subconfluent conditions, or induction of cell differentiation in primary cultures upregulated the number of cells permissive for primary lytic KSHV infection. The induction of lytic replication was characterized by high-level expression of cytoplasmic LANA and nuclear ORF59, a marker of lytic replication. Subcellular fractionation studies revealed the presence of multiple isoforms of LANA in the cytoplasm of ORF50/RTA-activated Vero cells undergoing primary infection. Mass spectrometry analysis demonstrated that cytoplasmic LANA isoforms were full length, containing the N-terminal nuclear localization signal. These results suggest that trafficking of LANA to different subcellular locations is a regulated phenomenon, which allows LANA to interact with cellular components in different compartments during both the latent and the replicative stages of the KSHV life cycle. IMPORTANCE Kaposi's sarcoma-associated herpesvirus (KSHV) causes AIDS-related malignancies, including lymphomas and Kaposi's sarcoma. KSHV establishes lifelong infections using its latency-associated nuclear antigen (LANA). During latency, LANA localizes to the nucleus, where it connects viral and cellular DNA complexes and regulates gene expression, allowing the virus to maintain long-term infections. Our research shows that intact LANA traffics to the cytoplasm of cells undergoing permissive lytic infections and latently infected cells in which the virus is induced to replicate. This suggests that LANA plays important roles in the cytoplasm and nuclear compartments of the cell during different stages of the KSHV life cycle. Determining cytoplasmic function and mechanism for regulation of the nuclear localization of LANA will enhance our understanding of the biology of this virus, leading to therapeutic approaches to eliminate infection and block its pathological effects.

Kaposi sarcoma (KS) is an unusual tumor composed of proliferating spindle cells that is initiated by infection of endothelial cells (EC) with KSHV, and develops most often in the setting of immunosuppression. Despite decades of research, optimal treatment of KS remains poorly defined and clinical outcomes are especially unfavorable in resource-limited settings. KS lesions are driven by pathological angiogenesis, chronic inflammation, and oncogenesis, and various in vitro cell culture models have been developed to study these processes. KS arises from KSHV-infected cells of endothelial origin, so EC-lineage cells provide the most appropriate in vitro surrogates of the spindle cell precursor. However, because EC have a limited in vitro lifespan, and as the oncogenic mechanisms employed by KSHV are less efficient than those of other tumorigenic viruses, it has been difficult to assess the processes of transformation in primary or telomerase-immortalized EC. Therefore, a novel EC-based culture model was developed that readily supports transformation following infection with KSHV. Ectopic expression of the E6 and E7 genes of human papillomavirus type 16 allows for extended culture of age- and passage-matched mock- and KSHV-infected EC and supports the development of a truly transformed (i.e., tumorigenic) phenotype in infected cell cultures. This tractable and highly reproducible model of KS has facilitated the discovery of several essential signaling pathways with high potential for translation into clinical settings.

Kaposi sarcoma herpesvirus (KSHV) is the etiologic agent of Kaposi sarcoma (KS) and certain rare B cell lymphoproliferative disorders. KSHV infection of endothelial cells (EC) in vitro increases expression of the inducible host-encoded enzyme heme oxygenase-1 (HO-1), which is also strongly expressed in KS tumors. HO-1 catalyzes the rate-limiting step in the conversion of heme into iron, biliverdin and the gasotransmitter carbon monoxide (CO), all of which share anti-apoptotic, anti-inflammatory, pro-survival, and tumorigenic activities. Our previous work has shown that HO-1 expression in KSHV-infected EC is characterized by a rapid yet transient induction at early times post-infection, followed by a sustained upregulation co-incident with establishment of viral latency. These two phases of expression are independently regulated, suggesting distinct roles for HO-1 in the virus life cycle. Here, we investigated the role of HO-1 during acute infection, prior to the onset of viral gene expression. The early infection phase involves a series of events that culminate in delivery of the viral genome to the nucleus. Primary infection also leads to activation of host innate immune effectors, including the pattern recognition receptor TLR4, to induce an antiviral response. It has been shown that TLR4-deficient EC are more susceptible to KSHV infection than wild-type controls, suggesting an important inhibitory role for TLR4 in the KSHV life cycle. TLR4 signaling is in turn subject to regulation by several virus-encoded immune evasion factors. In this report we identify HO-1 as a host protein co-opted by KSHV as part of a rapid immune evasion strategy. Specifically, we show that early HO-1 induction by KSHV results in increased levels of endogenous CO, which functions as a TLR4 signaling inhibitor. In addition, we show that CO-mediated inhibition of TLR4 signaling leads to reduced expression of TLR4-induced antiviral genes, thus dampening the host antiviral response and facilitating KSHV infection. Conversely, inhibition of HO-1 activity decreases intracellular CO, enhances the host antiviral response and inhibits KSHV infection. In conclusion, this study identifies HO-1 as a novel innate immune evasion factor in the context of KSHV infection and supports HO-1 inhibition as a viable therapeutic strategy for KS.

γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies.

Vascular endothelial cadherin (VE-cadherin) connects neighboring endothelial cells (ECs) via interendothelial junctions and regulates EC proliferation and adhesion during vasculogenesis and angiogenesis. The cytoplasmic domain of VE-cadherin recruits α- and β-catenins and γ-catenin, which interact with the actin cytoskeleton, thus modulating cell morphology. Dysregulation of the adherens junction/cytoskeletal axis is a hallmark of invasive tumors. We now demonstrate that the transmembrane ubiquitin ligase K5/MIR-2 of Kaposi's sarcoma-associated herpesvirus targets VE-cadherin for ubiquitin-mediated destruction, thus disturbing EC adhesion. In contrast, N-cadherin levels in K5-expressing cells were increased compared to those in control cells. Steady-state levels of α- and β-catenins and γ-catenin in K5-expressing ECs were drastically reduced due to proteasomal destruction. Moreover, the actin cytoskeleton was rearranged, resulting in the dysregulation of EC barrier function as measured by electric cell-substrate impedance sensing. Our data represent the first example of a viral protein targeting adherens junction proteins and suggest that K5 contributes to EC proliferation, vascular leakage, and the reprogramming of the EC proteome during Kaposi's sarcoma tumorigenesis.

Human cytomegalovirus (HCMV) accelerates transplant vascular sclerosis (TVS), a consequence of angiogenesis (AG) and wound repair (WR). While HCMV can be localized to TVS lesions, the low number of infected cells suggests a global effect on target tissues. We used microarray analysis followed by real-time-polymerase chain reaction (RT-PCR) in an RCMV-accelerated TVS rat cardiac transplant model to determine whether CMV activates host WR and AG factors. Dysregulated cellular genes in allografts from RCMV-infected recipients were compared to those from uninfected recipients and native hearts. We demonstrated that RCMV upregulates the genes involved in WR and AG, which was highest during the critical time of TVS acceleration (21-28 days). Using a standard in vitro AG assay, virus and serum-free supernatants collected at 48 h postinfection significantly induced endothelial cell (EC) migration, branching and tubule formation compared to supernatants from mock-infected cells. Supernatants from ultraviolet (UV)-inactivated RCMV-infected cells failed to induce AG, indicating that virus replication is required. Upregulation of WR and AG genes occurs during the critical period of CMV-accelerated TVS. Targeting these genes may prevent this process and improve allograft survival.

Kaposi sarcoma (KS) herpesvirus (KSHV) infection of endothelial cells (EC) is associated with strong induction of heme oxygenase-1 (HO-1), a stress-inducible host gene that encodes the rate-limiting enzyme responsible for heme catabolism. KS is an angioproliferative tumor characterized by the proliferation of KSHV-infected spindle cells, and HO-1 is highly expressed in such cells. HO-1 converts the pro-oxidant, proinflammatory heme molecule into metabolites with antioxidant, anti-inflammatory, and proliferative activities. Previously published work has shown that KSHV-infected EC in vitro proliferate in response to free heme in a HO-1-dependent manner, thus implicating virus-enhanced HO-1 activity in KS tumorigenesis. The present study investigated the molecular mechanisms underlying KSHV induction of HO-1 in lymphatic EC (LEC), which are the likely spindle cell precursors. In a time course analysis of KSHV-infected cells, HO-1 expression displays biphasic kinetics characterized by an early transient induction that is followed by a more sustained upregulation coincident with the establishment of viral latency. A viral microRNA miR-K12-11 deletion mutant of KSHV was found to be defective for induction of HO-1 during latency. A potential mechanism for this phenotype was provided by BACH1, a cellular HO-1 transcriptional repressor targeted by miR-K12-11. In fact, in KSHV-infected LEC, the BACH1 message level is reduced, BACH1 subcellular localization is altered, and miR-K12-11 mediates the inverse regulation of HO-1 and BACH1 during viral latency. Interestingly, the data indicate that neither miR-K12-11 nor de novo KSHV gene expression is required for the burst of HO-1 expression observed at early times postinfection, which suggests that additional virion components promote this phenotype., IMPORTANCE While the mechanisms underlying KSHV induction of HO-1 remain unknown, the cellular mechanisms that regulate HO-1 expression have been extensively investigated in the context of basal and pathophysiological states. The detoxifying action of HO-1 is critical for the protection of cells exposed to high heme levels. KS spindle cells are erythrophagocytic and contain erythrocyte ghosts. Erythrocyte degeneration leads to the localized release of heme, creating oxidative stress that may be further exacerbated by environmental or other cofactors. Our previous work showed that KSHV-infected cells proliferate in response to heme and that this occurs in a HO-1-dependent manner. We therefore hypothesize that KSHV induction of HO-1 contributes to KS tumor development via heme metabolism and propose that HO-1 be evaluated as a therapeutic target for KS. Our present work, which aimed to understand the mechanisms whereby KSHV induces HO-1, will be important for the design and implementation of such a strategy.

Background BST2/tetherin is an innate immune molecule with the unique ability to restrict the egress of human immunodeficiency virus (HIV) and other enveloped viruses, including Ebola virus (EBOV). Coincident with this discovery was the finding that the HIV Vpu protein down-regulates BST2 from the cell surface, thereby promoting viral release. Evidence suggests that the EBOV envelope glycoprotein (GP) also counteracts BST2, although the mechanism is unclear. Results We find that total levels of BST2 remain unchanged in the presence of GP, whereas surface BST2 is significantly reduced. GP is known to sterically mask surface receptors via its mucin domain. Our evaluation of mutant GP molecules indicate that masking of BST2 by GP is probably responsible for the apparent surface BST2 down-regulation; however, this masking does not explain the observed virus-like particle egress enhancement. We discovered that VP40 coimmunoprecipitates and colocalizes with BST2 in the absence but not in the presence of GP. Conclusions These results suggest that GP may overcome the BST2 restriction by blocking an interaction between VP40 and BST2. Furthermore, we have observed that GP may enhance BST2 incorporation into virus-like particles. Understanding this novel EBOV immune evasion strategy will provide valuable insights into the pathogenicity of this deadly pathogen.

Kaposi sarcoma (KS), a multifocal neoplasm of the skin that can spread to visceral organs, is the most prevalent malignant tumor in acquired immuno deficiency syndrome (AIDS) patients. KS-associated herpesvirus (KSHV or HHV8) is considered the primary etiological factor of this malignancy, as well as of primary effusion lymphoma and multicentric Castleman's disease. KS lesions are characterized by proliferating spindle cells of endothelial cell (EC) origin. The action of the insulin-like growth factor (IGF) system has been implicated in many malignancies, and recent data have demonstrated that the IGF-I receptor (IGF-IR) is required for in vitro growth of the KS-derived KSIMM cell line. To examine whether the IGF pathway is also involved in KSHV-mediated transformation of ECs, we examined the expression and function of the IGF system in KSHV-infected, immortalized dermal microvascular EC (E-DMVEC). The expression of the insulin receptor (IR) was strongly induced in latently infected E-DMVEC, whereas the expression levels of the IGF-IR remained unchanged. Gene knockdown of IR, but not IGF-IR, prevented the characteristic focus formation seen in KSHV-infected E-DMVEC. Similarly, treatment with the IR-specific small-molecule inhibitor HNMPA-(AM(3)) inhibited postconfluent growth. These data suggest a role for the IR, but not the IGF-IR, in KSHV-induced transformation of vascular ECs.

The transmembrane ubiquitin ligase K5/MIR2 of Kaposi sarcoma herpesvirus (KSHV) mediates internalization and lysosomal degradation of glycoproteins involved in antigen presentation and co-stimulation. In endothelial cells (ECs), K5 additionally reduced expression of CD31/platelet–endothelial cell adhesion molecule (PECAM), an adhesion molecule regulating cell-cell interactions of ECs, platelets, monocytes, and T cells. K5 also reduced EC migration, a CD31-dependent process. Unlike other K5 substrates, both newly synthesized and pre-existing CD31 molecules were targeted by K5. K5 was transported to the cell surface and ubiquitinated pre-existing CD31, resulting in endocytosis and lysosomal degradation. In the endoplasmic reticulum, newly synthesized CD31 was degraded by proteasomes, which required binding of phosphofurin acidic cluster sorting protein-2 (PACS-2) to acidic residues in the carboxyterminal tail of K5. Thus, CD31, a novel target of K5, is efficiently removed from ECs by a dual degradation mechanism that is regulated by the subcellular sorting of the ubiquitin ligase. K5-mediated degradation of CD31 is likely to affect EC function in KS tumors.

Kaposi's sarcoma–associated herpesvirus (KSHV) is involved in the development of lymphoproliferative diseases and Kaposi's sarcoma. The oncogenicity of this virus is reflected in vitro by its ability to transform B cells and endothelial cells. Infection of dermal microvascular endothelial cells (DMVEC) transforms the cells from a cobblestone-like monolayer to foci-forming spindle cells. This transformation is accompanied by dramatic changes in the cellular transcriptome. Known oncogenes, such as c-Kit, are among the KSHV-induced host genes. We previously showed that c-Kit is an essential cellular component of the KSHV-mediated transformation of DMVEC. Here, we test the hypothesis that the transformation process can be used to discover novel oncogenes. When expression of a panel of KSHV-induced cellular transcripts was inhibited with antisense oligomers, we observed inhibition of DMVEC proliferation and foci formation using antisense molecules to RDC1 and Neuritin. We further showed that transformation of KSHV-infected DMVEC was inhibited by small interfering RNA directed at RDC1 or Neuritin. Ectopic expression of Neuritin in NIH 3T3 cells resulted in changes in cell morphology and anchorage-independent growth, whereas RDC1 ectopic expression significantly increased cell proliferation. In addition, both RDC1- and Neuritin-expressing cells formed tumors in nude mice. RDC1 is an orphan G protein–coupled receptor, whereas Neuritin is a growth-promoting protein known to mediate neurite outgrowth. Neither gene has been previously implicated in tumorigenesis. Our data suggest that KSHV-mediated transformation involves exploitation of the hitherto unrealized oncogenic properties of RDC1 and Neuritin.

Expression of Kaposi's sarcoma-associated herpesvirus (KSHV) lytic genes is thought to be essential for the establishment and progression of KSHV-induced diseases. The inefficiency of lytic reactivation in various in vitro systems hampers the study of lytic genes in the context of whole virus. We report here increased expression of KSHV lytic genes and increased release of progeny virus when synchronized cultures of body cavity-based lymphoma-1 cells are treated with a phorbol ester during S phase of the cell cycle.

CD16+ monocytes represent 5-10% of circulating monocytes in healthy individuals and are dramatically expanded in several pathological conditions including AIDS and HIV-1-associated dementia (HAD). CD16+ monocytes constitutively produce high levels of pro-inflammatory cytokines and neurotoxic factors that may contribute to the pathogenesis of these disorders. Monocyte recruitment into the central nervous system (CNS) and other peripheral tissues in response to locally produced chemokines is a critical event in immune surveillance and inflammation and involves monocyte arrest onto vascular beds and subsequent diapedesis. Here we investigate the ability of CD16+ monocytes to undergo transendothelial migration (TEM) under constitutive and inflammatory conditions. CD16+ monocytes underwent TEM across unstimulated human umbilical vascular (HUVEC) and brain microvascular endothelial (BMVEC) cell monolayers in response to soluble fractalkine (FKN/CX3CL1). Stimulation with tumor necrosis factor (TNF) and interferon-gamma (IFN-gamma) induced high and low expression of membrane-bound FKN on HUVEC and BMVEC, respectively, together with expression of VCAM-1 and intercellular adhesion molecule-1 (ICAM)-1. By contrast, only HUVEC expressed CD62E while BMVEC remained negative. Both CD16- and CD16+ monocyte subsets adhered to TNF/IFN-gamma-stimulated HUVEC with higher frequency than to unstimulated HUVEC. Monocyte chemoattractant protein-1 (MCP-1) triggered efficient TEM of CD16- monocytes across TNF/IFN-gamma-stimulated HUVEC, whereas soluble FKN failed to induce TEM of CD16+ monocytes across stimulated HUVEC. These results demonstrate that stimulation with TNF and IFN-gamma triggers expression of membrane-bound FKN on both HUVEC and BMVEC, but prevents TEM of CD16+ monocytes in response to soluble FKN. Thus, pro-inflammatory CD16+ monocytes may contribute to the pathogenesis of HAD and other inflammatory CNS diseases by affecting the integrity of the blood-brain barrier as a consequence of their massive accumulation onto inflamed brain vascular endothelial cells expressing FKN and other adhesion molecules.

AIDS-related B-cell non-Hodgkin's lymphoma (AIDS-NHL) is a significant cause of morbidity and mortality among individuals infected with human immunodeficiency virus type 1 (HIV-1). AIDS-NHL is clinically and histologically heterogeneous, but common features include an aggressive clinical course and frequent extranodal presentation. HIV-1 infection of nonimmune cells that interact with malignant B cells at extranodal sites may influence both the development and the clinical presentation of disease. Our previous studies have shown that coculture of B-lymphoma (BL) cells with HIV-1-infected endothelial cells (EC) leads to contact activation of EC and firm BL-cell adhesion. The key event promoting EC-BL-cell adhesion was HIV-1 upregulation of endothelial CD40, which allowed induction of vascular cell adhesion molecule 1 (VCAM-1) in a CD40-dependent manner. The present study was designed to identify the HIV-1 protein(s) that influence EC-BL-cell adhesion. When HIV-1 proteins were individually expressed in EC by using recombinant adenoviruses, cultured BL cells adhered exclusively to Vpu-transduced EC. As with HIV-infected EC, adhesive properties were linked to the capacity of Vpu to upregulate CD40, which in turn allowed efficient expression of VCAM-1. When EC were infected with an HIV-1 pseudotype lacking the Vpu gene, CD40 upregulation and BL-cell adhesive properties were lost, indicating an essential role for Vpu in EC-BL-cell interactions. Thus, these data reveal a novel function for HIV-1 Vpu and further suggest a role for Vpu in the development of AIDS-NHL at EC-rich extranodal sites.

Virology research and antiviral drug discovery are poised to benefit from the post-genomic revolution for three main reasons. First, viruses need the host to replicate and are therefore vulnerable to inhibition of cellular pathways. Knowledge of complete genomic sequences of both virus and host now permits the study of this interplay on a global scale. Combining transcriptomics and proteomics with large-scale gene knockdown experiments will enable the identification of novel antiviral targets. Second, massive parallel assay systems, such as DNA microarrays, which define the post-genomic era, will facilitate viral diagnostics. Third, the combination of genetics with genomics will enable the analysis of viral mutants and strains on an unprecedented scale. The dramatic effects of viral infection on host cell transcriptional patterns have been well-documented and will be briefly highlighted. In addition, we discuss recent trends that apply functional genomics methods to the discovery of new targets and therapies for viral disease.

CD16+ monocytes represent 5–10% of peripheral blood monocytes in normal individuals and are dramatically expanded in several pathological conditions including sepsis, human immunodeficiency virus 1 infection, and cancer. CD16+ monocytes produce high levels of proinflammatory cytokines and may represent dendritic cell precursors in vivo. The mechanisms that mediate the recruitment of CD16+ monocytes into tissues remain unknown. Here we investigate molecular mechanisms of CD16+ monocyte trafficking and show that migration of CD16+ and CD16− monocytes is mediated by distinct combinations of adhesion molecules and chemokine receptors. In contrast to CD16− monocytes, CD16+ monocytes expressed high CX3CR1 and CXCR4 but low CCR2 and CD62L levels and underwent efficient transendo-thelial migration in response to fractalkine (FKN; FKN/CX3CL1) and stromal-derived factor 1α (CXCL12) but not monocyte chemoattractant protein 1 (CCL2). CD16+ monocytes arrested on cell surface–expressed FKN under flow with higher frequency compared with CD16− monocytes. These results demonstrate that FKN preferentially mediates arrest and migration of CD16+ monocytes and suggest that recruitment of this proinflammatory monocyte subset to vessel walls via the CX3CR1-FKN pathway may contribute to vascular and tissue injury during pathological conditions.

Kaposi's sarcoma (KS), the most frequent malignancy afflicting AIDS patients, is characterized by spindle cell formation and vascularization. Infection with KS-associated herpesvirus (KSHV) is consistently observed in all forms of KS. Spindle cell formation can be replicated in vitro by infection of dermal microvascular endothelial cells (DMVEC) with KSHV. To study the molecular mechanism of this transformation, we compared RNA expression profiles of KSHV-infected and mock-infected DMVEC. Induction of several proto-oncogenes was observed, particularly the receptor tyrosine kinase c-kit. Consistent with increased c-Kit expression, KHSV-infected DMVEC displayed enhanced proliferation in response to the c-Kit ligand, stem cell factor (SCF). Inhibition of c-Kit activity with either a pharmacological inhibitor of c-Kit (STI 571) or a dominant-negative c-Kit protein reversed SCF-dependent proliferation. Importantly, inhibition of c-Kit signal transduction reversed the KSHV-induced morphological transformation of DMVEC. Furthermore, overexpression studies showed that c-Kit was sufficient to induce spindle cell formation. Together, these data demonstrate an essential role for c-Kit in KS tumorigenesis and reveal a target for pharmacological intervention.

Design: A selection of primary and transformed cell types were evaluated for their susceptibility to infection with human herpesvirus 8 (HHV-8)/Kaposi's sarcoma-associated herpesvirus. Methods: Sources of HHV-8 included Kaposi's sarcoma lesion punch biopsies that were either cocultured directly with target cells or that were first cocultured with human lymphocytes to derive HHV-8-containing fluids that were inoculated onto target cells. HHV-8 was also obtained from primary effusion lymphoma-derived cell lines. Techniques to detect infection included the PCR, immunofluorescence assays and in situ hybridization. Results: Susceptible cells included human umbilical cord blood mononuclear cells (UCMC), adult CD19 B cells, macrophages and certain endothelial cells of human and animal origin, including some that are transformed with human papilloma virus type 16 E6 and E7 genes. The infection of lymphocytes did not yield established lymphoblastoid cell lines (LCL) and virus infection persisted for only 4-7 days. However, long-term HHV-8 infection of UCMC could be achieved by coinfection with Epstein-Barr virus. HHV-8 could also infect UCMC LCL recently derived by Epstein-Barr virus transformation, but long-established LCL could not be infected with HHV-8. Conclusions: These data provide further biological evidence in cell culture for the limited cellular host range of HHV-8 to CD19 B cells, macrophages, and certain endothelial cells.

Human herpesvirus 8 (HHV8) infects Kaposi’s sarcoma (KS) spindle cells in situ, as well as the lesional endothelial cells considered to be spindle cell precursors. The HHV8 genome contains several oncogenes, suggesting that infection of endothelial and spindle cells could induce cellular transformation and tumorigenesis and promote the formation of KS lesions. To investigate the potential of HHV8 infection of endothelial cells to contribute to the development of KS, we have developed an in vitro model utilizing dermal microvascular endothelial cells that support significant HHV8 infection. In contrast to existing in vitro systems used to study HHV8 pathogenesis, the majority of dermal endothelial cells are infected with HHV8 and the viral genome is maintained indefinitely. Infection is predominantly latent, with a small percentage of cells supporting lytic replication, and latency is responsive to lytic induction stimuli. Infected endothelial cells develop a spindle shape resembling that of KS lesional cells and show characteristics of a transformed phenotype, including loss of contact inhibition and acquisition of anchorage-independent growth. These results describe a relevant model system in which to study virus-host interactions in vitro and demonstrate the ability of HHV8 to induce phenotypic changes in infected endothelial cells that resemble characteristics of KS spindle cells in vivo. Thus, our results are consistent with a direct role for HHV8 in the pathogenesis of KS.

Angiogenesis is a critical factor in the growth and dissemination of solid tumors. Indeed, tumor vasculature is abnormal and contributes to the development and spread of malignancies by creating a hostile microenvironment. The alternative SDF-1/CXCL12 receptor, CXCR7, is frequently and specifically expressed in tumor-associated vessels. In this study, we examine the role of endothelium-expressed CXCR7 in tumor vascular dysfunction by specifically examining the contribution of CXCR7 to endothelial cell (EC) proliferation. We demonstrate that CXCR7 expression is sufficient to drive post-confluent growth in EC cultures. Further, we provide a novel mechanism for CXCR7-mediated proliferation via proteasomal degradation of the tumor suppressor protein Rb. These findings identify a heretofore unappreciated role for CXCR7 in vascular dysfunction and confirm this receptor as a plausible target for anti-tumor therapy.

We have undertaken a genetic strategy to map Vpu regions necessary for BST-2 antagonism and viral egress. This approach is based on our identification of an egress-defective Vpu variant encoded by an HIV-1 subtype C strain. We constructed a series of chimeric Vpu molecules made from the Vpu C variant and Vpu B from a standard laboratory strain. The TM domain from the inactive Vpu C, which contains multiple non-conserved residues, was responsible for a significant decrease in egress activity and BST-2 downregulation, confirming the functional importance of the Vpu TM domain. However, for complete inactivation, both the N-terminus and TM domain from the inactive Vpu C molecule were required, suggesting a new role for the Vpu N-terminus. In addition, determinants in the C-terminus of Vpu B that may be involved in efficient TGN accumulation were also necessary for enhanced viral egress but are missing or non-functional in Vpu C.

Although the transcription factors IRF-3 and IRF-7 are considered master regulators of type I interferon (IFN) induction and IFN stimulated gene (ISG) expression, Irf3−/−×Irf7−/− double knockout (DKO) myeloid dendritic cells (mDC) produce relatively normal levels of IFN-β after viral infection. We generated Irf3−/−×Irf5−/−×Irf7−/− triple knockout (TKO) mice to test whether IRF-5 was the source of the residual induction of IFN-β and ISGs in mDCs. In pathogenesis studies with two unrelated positive-sense RNA viruses (West Nile virus (WNV) and murine norovirus), TKO mice succumbed at rates greater than DKO mice and equal to or approaching those of mice lacking the type I IFN receptor (Ifnar−/−). In ex vivo studies, after WNV infection or exposure to Toll-like receptor agonists, TKO mDCs failed to produce IFN-β or express ISGs. In contrast, this response was sustained in TKO macrophages following WNV infection. To define IRF-regulated gene signatures, we performed microarray analysis on WNV-infected mDC from wild type (WT), DKO, TKO, or Ifnar−/− mice, as well as from mice lacking the RIG-I like receptor adaptor protein MAVS. Whereas the gene induction pattern in DKO mDC was similar to WT cells, remarkably, almost no ISG induction was detected in TKO or Mavs−/− mDC. The relative equivalence of TKO and Mavs−/− responses suggested that MAVS dominantly regulates ISG induction in mDC. Moreover, we showed that MAVS-dependent induction of ISGs can occur through an IRF-5-dependent yet IRF-3 and IRF-7-independent pathway. Our results establish IRF-3, -5, and -7 as the key transcription factors responsible for mediating the type I IFN and ISG response in mDC during WNV infection and suggest a novel signaling link between MAVS and IRF-5., Author Summary Host pathogen sensors, including those of the Toll-like receptor and RIG-I like receptor (RLR) families, detect viral infection in cells. Signaling through these receptors triggers expression of type I interferon (IFN) and IFN-stimulated genes (ISGs), in part through the IRF family of transcription factors. Previous studies with West Nile virus (WNV) showed that IRF-3 and IRF-7 control IFN expression in fibroblasts and neurons, whereas macrophages and myeloid dendritic cells (mDC) retained the ability to induce IFN-β without IRF-3 and IRF-7. In the current study, we generated Irf3−/−×Irf5−/−×Irf7−/− (TKO) mice to characterize the contributions of specific IRF transcription factors to IFN and ISG induction in response to WNV infection in cells and in mice. We found that induction of IFN and ISGs was largely abolished in TKO mDC, but sustained in TKO macrophages. Because IFN and ISG induction also was absent in mDC lacking MAVS, a key mediator of RLR signaling, our results suggest a novel signaling link between IRF-5 and MAVS. This study establishes the molecular pathways responsible for IFN induction in mDC and suggests a cross-talk between IRF-5 and RLR signaling pathways.

Two infectious molecular clones of human immunodeficiency virus type 1, NL4-3 and JR-CSF, differ in their abilities to productively infect human brain capillary endothelial (HBCE) cells. The phenotypes of recombinants between these two molecular strains were examined to identify viral sequences responsible for the difference in HBCE cell tropism between the two parental strains. Our results indicate that HBCE cell tropism maps to a region that encompasses the C1 region of env and includes overlapping reading frames for the accessory genes vpr, vpu, tat, and rev. This region was unique for HBCE cell tropism and did not cosegregate with either macrophage or T-cell line tropism. However, several recombinant clones displayed dual tropism for both HBCE cells and macrophages. These endothelial cell- and macrophage-tropic strains may have a unique pathogenic advantage by entering the brain via HBCE cells and subsequently infecting microglial cells with high efficiency, leading to the induction of human immunodeficiency virus dementia.

The majority of human immunodeficiency virus (HIV)-seropositive patients develop bone marrow abnormalities associated with hematopoietic malfunction during the progression of disease. One important manifestation of HIV-associated hematopoietic dysfunction is that after myelosuppression, bone marrow recovery, a process known to be mediated in part by the production of stromal cell-derived hematopoietic growth factors, is impaired. We sought to test the hypothesis that bone marrow stromal cells are infected by HIV-1 in vivo and that production of certain stromal cell-derived hematopoietic growth factors is deficient as a consequence. In this report, we demonstrate that bone marrow microvascular endothelial cells (MVEC), a key element of the stroma, are the predominant cells infected by HIV (5% to 20%) in bone marrow stromal cultures obtained from 11 consecutive HIV-seropositive patients. Although HIV-infected stromal cultures enriched for MVEC constitutively express normal levels of interleukin (IL)-4, IL-6, granulocyte (G)-colony-stimulating factor (CSF), granulocyte-macrophage (GM)-CSF, tumor necrosis factor (TNF)- alpha, transforming growth factor (TGF)-beta, and Steel factor, IL-1 alpha-induced release of IL-6 and G-CSF is significantly reduced in these cultures. These observations suggest that HIV infection of bone marrow MVEC reduces the capacity of hematopoietic stroma to respond to regulatory signals that normally augment blood cell production during periods of increased demand.

Stimulation of monocytes/macrophages with activated nonadherent cells allows productive nonlytic growth of human cytomegalovirus (HCMV), but the viral replication cycle is delayed relative to replication of HCMV in human fibroblasts. Analysis of infected monocyte-derived macrophage (MDM) mRNA for major immediate-early (MIE 86, 72, and 55) and late (pp65 and gB) gene expression by reverse transcription PCR indicates that transcription peaks at 3 and 7 days postinfection (dpi), respectively. In contrast, in human fibroblast controls, mRNA for MIE and late gene expression peaked at 5 and 48 h postinfection, respectively. Consistent with reverse transcription PCR experiments, double-label antibody experiments first detected MIE antigen expression at 12 h postinfection, peaking at 3 dpi, and late (pp65 or gB) antigen expression at 5 dpi, peaking at 7 dpi. MIE antigen was not detected between 3 and 7 dpi but reappeared and was coexpressed with pp65 in enlarged MDM nuclei at 7 dpi. After 7 dpi, macrophages with numerous vacuoles containing large amounts of pp65 and gB were observed in culture. These vacuoles were frequently seen at cellular contact points, suggesting that cell-to-cell transfer of virus was the major mode of viral transmission. Consistent with this observation, infectious virus was recovered from MDM cellular lysates but not culture supernatant. The delayed growth and compartmentalization of HCMV in macrophages may allow the cell to accommodate the viral replication cycle without cell lysis. In addition, the macrophage may function as a vehicle for cell-to-cell transmission of HCMV.

CXCR7 was recently characterized as an alternative receptor for the chemokine CXCL12/SDF-1, previously thought to bind and signal exclusively through CXCR4. We recently identified CXCR7 as a key cellular factor in the endothelial cell (EC) dysfunction associated with KSHV infection. CXCL12 signaling is critically associated with tumor growth, angiogenesis and metastasis in several diverse tumors and is one of the most studied chemokine/chemokine receptor interactions in cancer systems. The tumorigenic activity of the CXCL12 signaling axis offers an attractive target for therapeutic intervention in multiple cancers including Kaposi’ sS arcoma (KS). However, most of the research to date was based on the assumption that CXCR4 was the sole CXCL12 receptor, and thus focused on the development of CXCR4-targeted treatments. CXCR4 participates in important homeostatic functions including hematopoiesis and mucosal immunity, while CXCR7 is rarely expressed in normal adult cells. As a result, CXCR7 may be a more specific chemotherapeutic target for tumor cells and tumor-associated vasculature with fewer adverse effects than treatments targeting CXCR4. CXCR7 is poorly studied throughout the cancer literature and although CXCR7 expression has been found in tumor-associated vasculature, no studies comprehensively examine the biology of CXCR7 in EC and its implications for tumor biology. We seek to define th er ole of CXCR7-mediated CXCL12 signaling in EC biology, and in the context of KSHV infection, in order to determine potential contributions of CXCR7 signaling to KSHV-mediated EC transformation and KS tumorigenesis. We demonstrate that CXCR7 is strongly expressed on LANA+ spindle cells in KS biopsy tissue at all stages of tumor progression. We further demonstrate that CXCR7 induction by KSHV in vitro is specific to lymphatic EC lineages and occurs coincident with the acquisition of spindle morphology. Detailed examination of CXCR7 functions in EC biology reveals multiple roles for CXCR7 that could impact KS tumorigenesis, including effects on cellular proliferation, junctional integrity, cell survival and metastatic capacity. Specifically, we determine that CXCR7 expression results in a loss of PECAM/CD31 expression, perturbing the formation and maintenance of EC monolayers. Moreover, CXCR7+ EC display significant SDF-1 dependent hypermotility, as measured via Electrical Cell-Substrate Impedence Sensing (ECIS). We also demonstrate that SDF-1 signaling through CXCR7 expression is enhanced in EC undergoing anchorage-deprivation, affecting EC cell survival and invasion into SDF-1 rich niches. Taken together, these results demonstrate that CXCR7 is a novel KSHV-induced oncogene with the capacity to influence multiple aspects of KS pathogenesis including tumor growth, seeding and metastasis.

The cellular protein BST-2/CD317/Tetherin has been shown to inhibit the release of HIV-1 and other enveloped viruses from infected cells. The HIV-1 accessory protein Vpu binds to both BST-2 and βTrCP, a substrate-recognition subunit for the SCF (Skip1-Cullin1-F-box protein) E3 ubiquitin ligase complex. This interaction leads to both the degradation of BST-2 and the enhancement of viral egress. Recently BST-2 was shown to be ubiquitinated in this process. Here we have confirmed the Vpu- and βTrCP-dependent multi/polyubiquitination of BST-2. Ubiquitinated BST-2 accumulated in cells treated with a lysosomal inhibitor but not a proteasomal inhibitor. Additionally, we observed that a BST-2 mutant deleted for its cytosolically exposed lysine residues is also ubiquitinated. Subsequent experiments suggested that Vpu promotes BST-2 ubiquitination upon amino acid residues bearing hydroxyl- but not thiol-bearing side chains. However, a BST-2 mutant bearing substitutions for its cytoplasmically exposed Ser, Thr, and Lys residues was still down-regulated, ubiquitinated, and degraded in a Vpu-dependent manner. Our results suggest that Vpu may target either the BST-2 cytoplasmic Tyr residues or the NH(2) terminus itself for ubiquitination.

We have demonstrated that human brain capillary endothelial (HBCE) cells, unlike umbilical or aortic endothelial cells are permissively infected by HIV. HIV infection of HBCE cells is noncytolytic and is mediated by a CD4- and GalCer-independent mechanism, implying that HBCE cell tropic strains utilize a unique receptor. The V3 loop of gp120 appears to be important in this reaction. T-cell tropic but not brain-derived macrophage tropic HIV strains selectively infect brain endothelium suggesting that T-cell tropism is important for HIV entry through the blood-brain barrier (BBB). The ability of HIV to infect cells that compose the BBB implies that the virus may be directly involved in the BBB dysfunction observed in AIDS patients. HIV infection of HBCE cells may allow the flow of cytokines or toxic metabolites from the circulating blood into the brain parenchyma either by disrupting tight junctions or by altering the ability of the cells to regulate transport of substances across the BBB by transcytosis. HIV infection may also result in endothelial cell-induced astrocytosis by release of cytotoxic substances or modulation of abluminal surface antigens which contact astrocytic foot processes. Finally, HIV infection of the brain endothelium could facilitate virus entry to the CNS either by infection of HBCE cells or via entry of HIV-infected leucocytes. The establishment of our in vitro HIV-HBCE cell system will allow us to explore the potential mechanisms which mediate AIDS dementia.

Like the other more well-characterized post-translational modifications (phosphorylation, methylation, acetylation, acylation, etc.), the attachment of the 76 amino acid ubiquitin (Ub) protein to substrates has been shown to govern countless cellular processes. As obligate intracellular parasites, viruses have evolved the capability to commandeer many host processes in order to maximize their own survival, whether it be to increase viral production or to ensure the long-term survival of latently infected host cells. The first evidence that viruses could usurp the Ub system came from the DNA tumor viruses and Adenoviruses, each of which use Ub to dysregulate the host cell cycle (Scheffner et al., 1990; Querido et al., 2001). Today, the list of viruses that utilize Ub includes members from almost every viral class, encompassing both RNA and DNA viruses. Among these, there are examples of Ub usage at every stage of the viral life cycle, involving both ubiquitination and de-ubiquitination. In addition to viruses that merely modify the host Ub system, many of the large DNA viruses encode their own Ub modifying machinery. In this review, we highlight the latest discoveries regarding the myriad ways that viruses utilize Ub to their advantage.

Dear Sir, Kaposi’s sarcoma (KS) is the most common cancer in individuals with AIDS. Histologically, tumor cells form irregular, slit-like vascular structures. Numerous inflammatory cells are commonly present within KS tumors. In all clinical forms of KS, tumor cells and endothelial cells lining slit-like structures are infected with the KS-associated herpesvirus (KSHV) [1,2]. Tumor cells within KS express CD68 and CD34 as well as VEGFR-3, podoplanin, and LYVE-1. The last three are expressed by lymphatic endothelial cells [2]. CCL21 is usually expressed by lymphatic endothelial cells, and not blood vessel endothelial cells, as well, but its expression in KS has not been studied in detail. CCL21 is chemotactic for CCR7+ leukocytes, including lymph node (LN)-homing T cells and mature dendritic cells, and is critical for normal trafficking of these cells to LNs [3,4]. In this report, we show that CCL21 is expressed by round and spindle-shaped cells within KS tumors. We also show that KS tumors contain collections of CCR7+ cells, including inflammatory leukocytes. In addition, we demonstrate up-regulation of CCL21 in normal human dermal microvascular endothelial cells (HDMEC), which are putative precursor cells for KS spindle cells, following KSHV infection in vitro. The Institutional Review Boards at both Oregon Health & Science University and the VA Medical Center in Portland, Oregon approved the protocol. CCL21 and CCR7 expression was assessed in skin tissue obtained from healthy volunteers and from five patients with KS by immunohistochemistry. Five-μm sections were incubated with either goat polyclonal anti-human 6Ckine IgG antibody (Ab) (R&D systems) or mouse monoclonal anti-human CCR7 IgM Ab (BD Biosciences) for 1 hr. Slides were then incubated with either biotinylated anti-goat IgG (Vector Laboratories) or biotinylated anti-mouse IgM (Vector Laboratories) for 30 min and Vectastain Elite ABC kit (Vector Laboratories). HDMEC were immortalized by infection with the recombinant retrovirus LXSN16 E6E7 derived from the amphotropic retrovirus-packaging cell line PA317 as previously described [5]. Immortalized HDMEC were infected with KSHV as previously described [5]. Briefly, BCBL-1 cells (AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases) were exposed to tetradecanoyl phorbol acetate (20 ng/mL) for 48 hr and cell-free KSHV inocula were obtained. Virus inocula were added to HDMEC for 4 hr in the presence of Polybrene (2 μg/ml) followed by the addition of equal volumes of heparin-free culture medium for an additional 12 hr or overnight. For each experiment, mock infections were performed in parallel with BCBL-1 supernatants exposed to UV light to inactivate KSHV. Quantitative real-time RT-PCR was performed as previously described [6] using RNA extracted from KSHV-infected or mock-infected HDMEC with Trizol® (Invitrogen). Primer sequences used were as follows: CCL21 (sense), 5’- TGCTCCATCCCAGCTATCCT -3’; CCL21 (anti-sense), 5’- GGTCTGCACATAGCTCTGCCT -3’, LANA (sense), 5’- CCAGGAAGTCCCACAGTGTTC -3’; LANA (anti-sense), 5’- GCCACCGGTAAAGTAGGACTAGAC -3’. Primers for GAPDH were purchased (Applied Biosystems). Western blot was performed as previously described [7]. The Abs used in this study were goat polyclonal anti-human CCL21 Ab (R&D systems), mouse monoclonal anti-rabbit GAPDH Ab (Research Diagnostics Inc.), rabbit polyclonal anti-ERK1/2 Ab, and rabbit polyclonal anti-phosphorylated ERK1/2 Ab (Cell Signaling Technology). As expected, some areas within dermis of normal skin and KS tumors showed small rings of CCL21 positive cells, which were also positive for podoplanin, a marker for lymphatic endothelial cells (Fig. 1a and data not shown). KS skin incubated with no primary antibody showed no stained cells (Fig. 1b). By contrast, many round and spindle-shaped cells within dermal tumors from all five patients with KS stained positive for CCL21 (Fig. 1c, d and data not shown). Infiltrating inflammatory leukocytes showed no evidence of CCL21 positivity (Fig. 1c, d and data not shown). Fig. 1 KS tumors contain CCL21+ spindle cells and CCR7+ cells (x 80). (a) CCL21+ dermal lymphatic endothelial cells (in brown) in normal skin. (b) Serial section of a KS specimen (also shown in c) incubated with no primary antibody showing no background staining. ... CCR7 is the only known receptor for CCL21 [3]. Spleen tissue, served as a positive control, showed CCR7+ cells as expected (Fig. 1e). KS tumors incubated with no primary antibody showed no stained cells (Fig. 1f). By contrast, we consistently found collections of CCR7+ cells, including inflammatory leukocytes scattered within KS tumors, suggesting that CCL21 expressed in KS lesions was functionally active (Fig. 1g, h and data not shown). We next examined whether KSHV infection could up-regulate CCL21 expression within HDMEC. Using real-time RT-PCR, we first established high levels of infection in HDMEC by quantifying mRNA expression of KSHV LANA, a KSHV latent-cycle gene expressed in all KSHV-infected cells. As expected, in four separate experiments, LANA mRNA was expressed at levels 500-7,000 times higher than background levels measured in mock-infected HDMEC (Fig. 2a). In these same four mRNA samples, CCL21 mRNA was expressed at levels 20-1,300 times levels detected in mock-infected HDMEC (Fig. 2b). There was no correlation between LANA and CCL21 expression, probably because of different regulation of these two genes. We also detected up-regulation of CCL21 protein in KSHV-infected endothelial cells by Western blotting (Fig. 2c). Fig. 2 KSHV infection of immortalized HDMEC induces CCL21 mRNA and protein expression and phosphorylation of Erk1/2. On four separate occasions, immortalized HDMEC were infected with KSHV or inactivated KSHV (i.e., mock-infection) and both (a) KSHV LANA and ... CCL21 expression by HDMEC is increased by oncostatin M (OSM). We have previously shown that MAPK signaling is important in CCL21 expression of HDMEC induced by OSM [7]. KSHV infection of immortalized HDMEC up-regulates phosphorylation of Erk1/2 (Fig. 2d). We postulate that CCL21 secreted by KS spindle cells may recruit CCR7+ cells into KS tumors rather than allow these cells to migrate to their normal destination (i.e., LNs). In this manner, KS tumors may act as “decoys” for LN-homing cells, which could in turn potentially lead to generation of abnormal immune responses to KSHV-infected cells. Further investigation is needed to explore this possible immune surveillance escape hypothesis. KS is rich in cytokines and chemokines [8,9]. One of the cytokines found in abundance in KS is OSM [8]. OSM has been shown to act a potent mitogen for KS cells in vitro [9]. Interestingly, both OSM treatment and KSHV infection of HDMEC up-regulate CCL21 expression and phosphorylation of Erk1/2. It would be very interesting to examine whether MAPK inhibitors reduce CCL21 expression and phosphorylation of Erk1/2 in KSHV-infected HDMEC, as we previously showed in OSM-treated HDMEC [8]. The anecdotal case report of Kaposi’s sarcoma demonstrating complete clinical response after administration of sorafenib, an inhibitor of MAPK-mediated proliferation, encourages further investigation in this direction [10].

The interferon-induced BST-2 protein has the unique ability to restrict the egress of HIV-1, Kaposi's sarcoma–associated herpesvirus (KSHV), Ebola virus, and other enveloped viruses. The observation that virions remain attached to the surface of BST-2-expressing cells led to the renaming of BST-2 as “tetherin”. However, viral proteins such as HIV-1 Vpu, simian immunodeficiency virus Nef, and KSHV K5 counteract BST-2, thereby allowing mature virions to readily escape from infected cells. Since the anti-viral function of BST-2 was discovered, there has been an explosion of research into several aspects of this intriguing interplay between host and virus. This review focuses on recent work addressing the molecular mechanisms involved in BST-2 restriction of viral egress and the species-specific countermeasures employed by various viruses.

Kaposi sarcoma (KS) is a multi-focal angioproliferative disease driven by infection of cells by Kaposi sarcoma herpesvirus/human herpesvirus-8 (KSHV/HHV8). KSHV/HHV8 infection activates numerous sequential and parallel signaling pathways creating an angiogenic–inflammatory state that leads to the development of Kaposi sarcoma. These pathways can be grouped into KSHV/HHV8- specific pathways and cellular growth/angiogenic pathways that are “pirated” by KSHV/HHV8. Advances in our understanding of the pathogenesis of KS parallel the clinical development of signal transduction inhibitors. This chapter reviews the signaling pathways active in KSHV/HHV8-infected cells and discusses the use of clinical inhibitors of these pathways in the treatment of KS.

K3/MIR1 and K5/MIR2 of Kaposi's sarcoma-associated herpesvirus (KSHV) are viral members of the membrane-associated RING-CH (MARCH) ubiquitin ligase family and contribute to viral immune evasion by directing the conjugation of ubiquitin to immunostimulatory transmembrane proteins. In a quantitative proteomic screen for novel host cell proteins downregulated by viral immunomodulators, we previously observed that K5, as well as the human immunodeficiency virus type 1 (HIV-1) immunomodulator VPU, reduced steady-state levels of bone marrow stromal cell antigen 2 (BST2; also called CD317 or tetherin), suggesting that BST2 might be a novel substrate of K5 and VPU. Recent work revealed that in the absence of VPU, HIV-1 virions are tethered to the plasma membrane in BST2-expressing HeLa cells. By targeting BST2, K5 might thus similarly overcome an innate antiviral host defense mechanism. Here we establish that despite its type II transmembrane topology and carboxy-terminal glycosylphosphatidylinositol (GPI) anchor, BST2 represents a bona fide target of K5 that is downregulated during primary infection by and reactivation of KSHV. Upon exit of the protein from the endoplasmic reticulum, lysines in the short amino-terminal domain of BST2 are ubiquitinated by K5, resulting in rapid degradation of BST2. Ubiquitination of BST2 is required for degradation, since BST2 lacking cytosolic lysines was K5 resistant and ubiquitin depletion by proteasome inhibitors restored BST2 surface expression. Thus, BST2 represents the first type II transmembrane protein targeted by K5 and the first example of a protein that is both ubiquitinated and GPI linked. We further demonstrate that KSHV release is decreased in the absence of K5 in a BST2-dependent manner, suggesting that K5 contributes to the evasion of intracellular antiviral defense programs.

Kaposi sarcoma (KS) is intimately linked to several aspects of the host immune system. KS development is linked to immunodeficiency in several clinical-epidemiological settings. The development of KS at local inflammatory sites has also been documented. Inflammatory cells are almost always present within KS lesions. Depending upon the inflammatory milieu, KS lesions may progress or regress. Not surprisingly, iatrogenic manipulation of host immunity with drugs may provoke KS growth and/or flare. Given the close association between KS and the immune system, the etiologic agent Kaposi Sarcoma Herpesvirus has developed a variety of mechanisms to evade the host immune system, all of which have cleverly evolved to promote oncogenesis and viral persistence.

The primary roles attributed to the human immunodeficiency virus type 1 (HIV-1) Vpu protein are the degradation of the viral receptor CD4 and the enhancement of virion release. With regard to CD4 downregulation, Vpu has been shown to act as an adapter linking CD4 with the ubiquitin-proteasome machinery via interaction with the F-box protein βTrCP. To identify additional cellular βTrCP-dependent Vpu targets, we performed quantitative proteomics analyses using the plasma membrane fraction of HeLa cells expressing either wild-type Vpu or a Vpu mutant (S52N/S56N) that does not bind βTrCP. One cellular protein, BST-2 (CD317), was consistently underrepresented in the membrane proteome of cells expressing wild-type Vpu compared to the proteome of cells expressing the Vpu mutant. To verify the biological relevance of this phenotype for HIV pathogenesis, we showed that in T cells infected with HIV-1, BST-2 downregulation occurred in a Vpu-dependent manner. Recently, BST-2 has been identified as the interferon-inducible cellular factor Tetherin, which restricts HIV virion release in the absence of Vpu. We address here the unresolved mechanism of Vpu-mediated BST-2 downregulation. Our data show that the presence of wild-type Vpu reduced cell surface and total steady-state BST-2 levels, whereas that of the mutant Vpu had no effect. In addition, treatment of cells with the lysosome acidification inhibitor concanamycin A, but not treatment with the proteasome inhibitor MG132, reduced BST-2 downregulation by wild-type Vpu, thereby suggesting that the presence of Vpu leads to the degradation of BST-2 via an endosome-lysosome degradation pathway. The importance of βTrCP in this process was confirmed by demonstrating that in the absence of βTrCP, BST-2 levels were restored despite the presence of Vpu. Taken together, these data support the hypothesis that, in similarity to its role in CD4 degradation, Vpu acts as an adapter molecule linking BST-2 to the cellular ubiquitination machinery via βTrCP. However, in contrast to the proteasome-dependent degradation of CD4, which occurs in the endoplasmic reticulum, Vpu appears to interact with BST-2 in the trans-Golgi network or in early endosomes, leading to lysosomal degradation of BST-2. Via this action, Vpu could counter the tethering function of BST-2, resulting in enhanced HIV-1 virion release. Interestingly, although HIV-2 does not express Vpu, an isolate known to exhibit enhanced viral egress can downregulate surface BST-2 by an as-yet-unknown mechanism that does not appear to involve degradation. Understanding the molecular mechanisms of both Vpu-dependent and -independent mediated antagonism of BST-2 will be critical for therapeutic strategies that exploit this novel viral function.

Kaposi's sarcoma (KS) herpesvirus (KSHV) is the etiological agent of several immunodeficiency-linked cancers, including KS. Our previous work showed that the proto-oncogene c-kit is upregulated in KSHV-infected endothelial cells (ECs), as well as in KS lesions. We show here that KSHV-dependent induction of both c-kit mRNA and protein requires the establishment of a latent infection and that this upregulation occurs in primary DMVECs as well as in immortalized DMVECs (eDMVECs). Interestingly, we find that while the lymphatic EC (LEC) subpopulation exhibits KSHV-induced c-Kit upregulation, the blood EC (BEC) subpopulation does not. Despite this upregulation of c-Kit, receptor activation and phosphorylation of downstream effectors such as MAP Kinase Erk 1/2 and GSK-3 still requires the addition of exogenous c-Kit ligand, stem cell factor (SCF). These data indicate that KSHV does not induce constitutive c-Kit signaling, but instead upregulates c-Kit receptor levels, thus allowing infected ECs to respond to endogenous and exogenous SCF. Nonetheless, inhibition of either c-Kit activation or its downstream effectors reverses the characteristic spindle phenotype of infected eDMVECs. Together, these results contribute to our overall understanding of the role that the c-kit proto-oncogene plays in KS pathogenesis.

Background Kaposi sarcoma (KS) flare may occur following therapy with corticosteroids, as part of the immune reconstitution inflammatory syndrome seen with highly active antiretroviral therapy (HAART), and after rituximab therapy. The exact mechanism responsible for iatrogenic KS flare is unclear. Methods A case of AIDS-associated cutaneous KS flare following rituximab therapy was compared to similar controls by means of immunohistochemistry using vascular makers (CD34, CD31), monoclonal antibodies to Human Herpesvirus 8 (HHV8) gene products (LNA-1, K5), as well as B-lymphocyte (CD20) and T-lymphocyte (CD3, CD4, CD8) markers. Results CD20+ B-cell depletion with rituximab in KS flare occurred concomitantly with activation of the HHV8 immediate early gene protein K5. KS flare in this patient was successfully treated with liposomal doxorubicin and valganciclovir. Conclusion Rituximab-induced KS flare appears to be related to HHV8 activation. Effective management of iatrogenic KS flare therefore depends upon the control of HHV8 viremia in conjunction with specific chemotherapy for KS.

Human cytomegalovirus (HCMV) is associated with the acceleration of a number of vascular diseases such as atherosclerosis, restenosis, and transplant vascular sclerosis (TVS). All of these diseases are the result of either mechanical or immune-mediated injury followed by inflammation and subsequent smooth muscle cell (SMC) migration from the vessel media to the intima and proliferation that culminates in vessel narrowing. A number of epidemiological and animal studies have demonstrated that CMV significantly accelerates TVS and chronic rejection (CR) in solid organ allografts. In addition, treatment of human recipients and animals alike with the antiviral drug ganciclovir results in prolonged survival of the allograft indicating that CMV replication is a requirement for acceleration of disease. However, although virus persists in the allograft throughout the course of disease, the number of directly infected cells does not account for the global effects that the virus has on the acceleration of TVS and CR. Recent investigations of up- and down-regulated cellular genes in infected allografts in comparison to native heart has demonstrated that Rat-CMV (RCMV) up-regulates genes involved in wound healing (WH) and angiogenesis (AG). Consistent with this result, we have found that supernatants from HCMV infected cells (HCMV secretome) induce WH and AG using in vitro models. Taken together these findings suggest that one mechanism for HCMV acceleration of TVS is mediated through induction of secreted cytokines and growth factors from virus-infected cells that promote WH and AG in the allograft, resulting in the acceleration of TVS. We review here the ability of CMV infection to alter the local environment by producing cellular factors that act in a paracrine fashion to enhance WH and AG processes associated with the development of vascular disease, which accelerates chronic allograft rejection.

The effect of mycoplasma-free human cytomegalovirus (HCMV) on the production and biologic activity of interleukin-1 (IL-1) from peripheral blood monocytes was examined. The use of biologic thymocyte assays revealed a time-dependent decrease in the IL-1 activity of both HCMV-challenged and control monocytes after initiation of culture. A decrease in the amount of IL-1 beta secreted as measured by ELISA was also detected. The amount of IL-1 beta secreted by HCMV-challenged cells was always greater than that produced by control cultures at similar times. Despite containing higher levels of IL-1 beta, supernatants from challenged cells were markedly less effective in supporting thymocyte proliferation. It is proposed that this is due to the concomitant production of an inhibitor of IL-1 activity from HCMV-challenged monocyte cultures.

Kaposi's sarcoma-associated herpesvirus (KSHV) is the pathological agent of Kaposi's sarcoma (KS), a tumor characterized by aberrant proliferation of endothelial-cell-derived spindle cells. Since in many cancers tumorigenesis is associated with an increase in the activity of the cathepsin family, we studied the role of cathepsins in KS using an in vitro model of KSHV-mediated endothelial cell transformation. Small-molecule inhibitors and small interfering RNA (siRNA) targeting CTSB, but not other cathepsins, inhibited KSHV-induced postconfluent proliferation and the formation of spindle cells and foci of dermal microvascular endothelial cells. Interestingly, neither CTSB mRNA nor CTSB protein levels were induced in endothelial cells latently infected with KSHV. Secretion of CTSB was strongly diminished upon KSHV infection. Increased targeting of CTSB to endosomes was caused by the induction by KSHV of the expression of insulin-like growth factor-II receptor (IGF-IIR), a mannose-6-phosphate receptor (M6PR) that binds to cathepsins. Inhibition of IGF-IIR/M6PR expression by siRNA released CTSB for secretion. In contrast to the increased cathepsin secretion observed in most other tumors, viral inhibition of CTSB secretion via induction of an M6PR is crucial for the transformation of endothelial cells.

Kaposi sarcoma (KS), the most common AIDS-associated malignancy, is amultifocal tumor characterized by deregulated angiogenesis, proliferation of spindle cells, and extravasation of inflammatory cells and erythrocytes. Kaposi sarcoma-associated herpesvirus (KSHV; also human herpesvirus-8) is implicated in all clinical forms of KS. Endothelial cells (EC) harbor the KSHV genome in vivo, are permissive for virus infection in vitro, and are thought to be the precursors of KS spindle cells. Spindle cells are rare in early patch-stage KS lesions but become the predominant cell type in later plaque- and nodular-stage lesions. Alterations in endothelial/spindle cell physiology that promote proliferation and survival are thus thought to be important in disease progression and may represent potential therapeutic targets. KSHV encodes genes that stimulate cellular proliferation and migration, prevent apoptosis, and counter the host immune response. The combined effect of these genes is thought to drive the proliferation and survival of infected spindle cells and influence the lesional microenvironment. Large-scale gene expression analyses have revealed that KSHV infection also induces dramatic reprogramming of the EC transcriptome. These changes in cellular gene expression likely contribute to the development of the KS lesion. In addition to KS, KSHV is also present in B cell neoplasias including primary effusion lymphoma and multicentric Castleman disease. A combination of virus and virus-induced host factors are similarly thought to contribute to establishment and progression of these malignancies. A number of lymphocyte- and EC-based systems have been developed that afford some insight into the means by which KSHV contributes to malignant transformation of host cells. Whereas KSHV is well maintained in PEL cells cultured in vitro, explanted spindle cells rapidly lose the viral episome. Thus, endothelial cell-based systems for studying KSHV gene expression and function, as well as the effect of infection on host cell physiology, have required in vitro infection of primary or life-extended EC. This chapter includes a review of these in vitro cell culture systems, acknowledging their strengths and weaknesses and putting into perspective how each has contributed to our understanding of the complex KS lesional environment. In addition, we present a model of KS lesion progression based on findings culled from these models as well as recent clinical advances in KS chemotherapy. Thus this unifying model describes our current understanding of KS pathogenesis by drawing together multiple theories of KS progression that by themselves cannot account for the complexities of tumor development.

Kaposi sarcoma (KS) is the most common AIDS-associated malignancy and is characterized by angiogenesis and the presence of spindle cells. Kaposi sarcoma-associated herpesvirus (KSHV) is consistently associated with all clinical forms of KS, and in vitro infection of dermal microvascular endothelial cells (DMVECs) with KSHV recapitulates many of the features of KS, including transformation, spindle cell proliferation, and angiogenesis. To study the molecular mechanisms of KSHV pathogenesis, we compared the protein expression profiles of KSHV-infected and uninfected DMVECs. This comparison revealed that heme oxygenase-1 (HO-1), the inducible enzyme responsible for the rate-limiting step in heme catabolism, was up-regulated in infected endothelial cells. Recent evidence suggests that the products of heme catabolism have important roles in endothelial cell biology, including apoptosis and angiogenesis. Here we show that HO-1 mRNA and protein are up-regulated in KSHV-infected cultures. Comparison of oral and cutaneous AIDS-KS tissues with normal tissues revealed that HO-1 mRNA and protein were also up-regulated in vivo. Increased HO-1 enzymatic activity in vitro enhanced proliferation of KSHV-infected DMVECs in the presence of free heme. Treatment with the HO-1 inhibitor chromium mesoporphyrin IX abolished heme-induced proliferation. These data suggest that HO-1 is a potential therapeutic target for KS that warrants further study. (Blood. 2004;103: 3465-3473)

Kaposi sarcoma–associated herpesvirus (KSHV) is associated with KS, primary effusion lymphoma (PEL), and multicentric Castleman disease. Reactivation of KSHV in latently infected cells and subsequent plasma viremia occur before the development of KS. Intracellular signaling pathways involved in KSHV reactivation were studied. In latently infected PEL cells (BCBL-1), KSHV reactivation in single cells was determined by quantitative flow cytometry. Viral particle production was determined by electron microscope analyses and detection of minor capsid protein in culture supernatants. Agents that mobilized intracellular calcium (ionomycin, thapsigargin) induced expression of KSHV lytic cycle-associated proteins and led to increased virus production. Calcium-mediated virus reactivation was blocked by specific inhibitors of calcineurin-dependent signal transduction (cyclosporine, FK506). Similarly, calcium-mediated virus reactivation in KSHV-infected dermal microvascular endothelial cells was blocked by cyclosporine. Furthermore, retroviral transduction with plasmid DNA encoding VIVIT, a peptide specifically blocking calcineurin-NFAT interactions, inhibited calcium-dependent KSHV reactivation. By contrast, chemical induction of lytic-phase infection by the phorbol ester 12-O-tetradecanoyl-phorbol-13-acetate was blocked by protein kinase C inhibitors, but not by calcineurin inhibitors. In summary, calcineurin-dependent signal transduction, an important signaling cascade in vivo, induces calcium-dependent KSHV replication, providing a possible target for the design of antiherpesvirus strategies in KSHV-infected patients.

The blood-brain barrier (BBB) plays a critical role in regulating cell trafficking through the central nervous system (CNS) due to several unique anatomical features, including the presence of interendothelial tight junctions that form impermeable seals between the cells. Previous studies have demonstrated BBB perturbations during human immunodeficiency virus encephalitis (HIVE); however, the basis of these permeability changes and its relationship to infiltration of human immunodeficiency virus type 1 (HIV-1)-infected monocytes, a critical event in the pathogenesis of the disease, remains unclear. In this study, we examined CNS tissue from HIV-1-seronegative patients and HIV-1-infected patients, both with and without encephalitis, for alterations in BBB integrity via immunohistochemical analysis of the tight junction membrane proteins, occludin and zonula occludens-1 (ZO-1). Significant tight junction disruption (P < 0.001), as demonstrated by fragmentation or absence of immunoreactivity for occludin and ZO-1, was observed within vessels from subcortical white matter, basal ganglia, and, to a lesser extent, cortical gray matter in patients who died with HIVE. These alterations were also associated with accumulation of activated, HIV-1-infected brain macrophages, fibrinogen leakage, and marked astrocytosis. In contrast, no significant changes (P > 0.05) were observed in cerebellar tissue from patients with HIVE compared to HIV-seronegative patients or HIV-1-infected patients without encephalitis. Our findings demonstrate that tight junction disruption is a key feature of HIVE that occurs in regions of histopathological alterations in association with perivascular accumulation of activated HIV-1-infected macrophages, serum protein extravasation, and marked astrocytosis. We propose that disruption of this key BBB structure serves as the main route of HIV-1-infected monocyte entry into the CNS.

Human immunodeficiency virus (HIV)-I infection is associated with the development of aggressive extranodal B-cell non-Hodgkin's lymphomas. Using microvascular endothelial cell (MVEC)-enriched bone marrow stromal cultures, HIV infection of stromal MVECs from lymphoma patients induced the outgrowth of malignant B cells. MVECs were the only HIV-infected cells in the stroma, and purified brain MVECs also induced a phenotype supportive of neoplastic B-cell attachment and proliferation. HIV infection of MVECs stimulated surface expression of CD40 and allowed preferential induction of the vascular cell adhesion molecule VCAM-1 after CD40 triggering. B-lymphoma cells expressed the CD40 ligand (CD40L), and blocking of CD40–CD40L interactions between HIV-infected MVECs and B-lymphoma cells inhibited B-cell attachment and proliferation. These observations suggest that HIV promotes B-lymphoma cell growth through facilitating attachment of lymphoma cells to HIV-infected MVECs and represent a novel mechanism through which viruses may induce malignancies.

The cytoadherence of Plasmodium falciparum -infected erythrocytes was studied using immortalized human brain capillary endothelial cells. The immortalized cells, denoted as BB19, derived from the human brain endothelium, were transformed with the E6E7 genes of human papilloma virus and retained their endothelial nature, i.e. tubule formation occurred with Matrigel as a substratum and the cells stained positive for Factor VIII-related antigen, or vonWillebrand's factor. Surface expression of ICAM-1, VCAM, E-selectin, and CD36 was demonstrated by immunofluorescence staining with monoclonal antibodies to these ligands. Exposure to cytokines (TNF, IFNγ, IL-1α, and IL-6) and lipopolysaccharide resulted in an increase in expression of ICAM-1, VCAM, E-selectin, and CD36. The BB19 cells bound P. falciparum -infected red blood cells with both the FCR-3 and the ITO4 strains. Antibodies to CD36 and ICAM-1 partially inhibited the binding of the FCR-3 and the ITO4 lines, respectively. These findings suggest that BB19 cells may be useful in the analysis of receptor-based cytoadherence and sequestration, as well as in the cell biology of microvessel formation.

Mycobacterium fortuitum is a rapidly growing Mycobacterium , which usually colonizes the soil, dust and water. It commonly causes skin and soft tissue infections especially in patients who have preceding trauma. We report a case of perianal fistulae caused by M. fortuitum.

Neuropathologic studies of AIDS patients have shown that brain capillary endothelial cells are a cellular target for human immunodeficiency virus (HIV) in vivo. We have established in vitro cultures of primary human brain capillary endothelial (HBCE) cells. Using this model system, we have shown a significant HIV infection of HBCE cells that is productive yet noncytopathic. The infection is mediated by a cellular interaction with gp120 that does not involve CD4 or galactosylceramide. HIV infection of HBCE cells may contribute to AIDS-associated neuropathology by disturbing the physiology of the endothelium and directly or indirectly facilitating dissemination of virus to the central nervous system.