Search

In 2012, dormant canes of a proprietary wine grape (Vitis vinifera L.) accession were included in the collection of the University of California–Davis Foundation Plant Services. No virus-like symptoms were elicited when bud chips from propagated own-rooted canes of the accession were graft-inoculated onto a panel of biological indicators. However, chlorotic ringspot symptoms were observed on sap-inoculated Chenopodium amaranticolor Coste & A. Rein and C. quinoa Willd. plants, indicating the presence of a mechanically transmissible virus. Transmission electron microscopy of virus preparations from symptomatic C. quinoa revealed spherical, nonenveloped virions about 27 nm in diameter. Nepovirus-like haplotypes of sequence contigs were detected in both the source grape accession and symptomatic C. quinoa plants via high-throughput sequencing. A novel bipartite nepovirus-like genome was assembled from these contigs, and the termini of each RNA segment were verified by rapid amplification of complementary DNA ends assays. The RNA1 (7,186-nt) of the virus encodes a large polyprotein 1 of 231.1 kDa, and the RNA2 (4,460-nt) encodes a large polyprotein 2 of 148.9 kDa. Each of the polyadenylated RNA segments is flanked by 5′- (RNA1 = 156-nt; RNA2 = 170-nt) and 3′- (RNA1 = 834-nt; RNA2 = 261-nt) untranslated region sequences with >90% identities. Maximum likelihood phylogenetic analyses of the conserved Pro-Pol amino acid sequences revealed the clustering of the new virus within the genus Nepovirus of the family Secoviridae. Considering its biological and molecular characteristics, and based on current taxonomic criteria, we propose that the novel virus, named grapevine nepovirus A, be assigned to the genus Nepovirus.

It is known that tomato is one of the most susceptible vegetable crops affected by viral pathogens. Recently, Pepino mosaic virus, is widespread in greenhouse plantations in Europe the harmfulness of which leads to yield and marketability of products decrease. The analysis of tomato hybrids grown in greenhouses of the republic has shown that in different years of research, Pepino mosaic virus has been present both in mono infection and in combination with the other viruses from the genus Cucumovirus, Tobamovirus, Nepovirus and Tobravirus. Laboratory data indicate the susceptibility and ability to high accumulation of viral particles when test plants Datura stramonium L. and Nicotiana rustica L. have been infected with the pepino mosaic virus. It is determined that Aphis gossypii Glov., Frankliniella occidentalis Perg. and Trialeurodes vaporariorum Wetw. can participate in the vector transmission of the pathogen between host plants.

Tobacco ringspot virus (TRSV) is an important plant pathogen that causes severe diseases in tobacco plants. In recent years, this virus has been reported in a number of ornamental plants. However, it has never been reported from Japanese iris, a famous traditional ornamental plant distributed in Asian countries. In this study, the near-complete bipartite genome of a nepovirus (TRSV-Iris) infecting Japanese iris from Taiwan of China was determined. The RNA1 and RNA2 are 7512 and 3899 nucleotides in length, and encodes a polyprotein of 2303 and 1078 amino acids, respectively. Sequence analysis indicates that TRSV-Iris shares more than 80% amino acid sequence identity, the threshold values of the species demarcation for the genus Nepovirus, with known TRSV isolates either in the conserved Pro-Pol or CP regions, respectively. Phylogenetic analysis indicates that TRSV-Iris is a TRSV isolate.

The virome of babaco (Vasconcellea x heilbornii) —a non-traditional fruit crop native to Ecuador— was investigated by high-throughput sequencing (HTS) on plants obtained from a commercial nursery. Six virus-like sequences were detected, including the full length of papaya ringspot virus (PRSV) and an RNA-dependent-RNA-polymerase (RdRp) sequence with homology to papaya virus Q. Three RNA sequences were found with homology, respectively, to apple latent spherical virus (genus Cheravirus, 71% nt identity), cherry leaf roll virus (genus Nepovirus, 54% nt identity) and Citrullus lanatus cryptic virus (genus Deltapartitivirus, 66% nt identity); whereas a DNA pararetrovirus-like sequence with homology to citrus endogenous pararetrovirus (58% nt identity) was also detected. RT-PCR-based virus surveys on a total of 284 samples collected from three provinces revealed that the partitivirus- and pararetrovirus-like sequences were present in 100% of tested plants; whereas the other virus sequences were detected in up to 68% of plants and were associated with different symptoms. This work provides information on the occurrence and prevalence of PRSV and five additional virus-like sequences in babaco, a vegetatively propagated crop, supporting the need for a virus-free certification program.

Background Muscadine (Muscadinia rotundifolia) is known as a resistance source to many pests and diseases in grapevine. The genetics of its resistance to two major grapevine pests, the phylloxera D. vitifoliae and the dagger nematode X. index, vector of the Grapevine fanleaf virus (GFLV), was investigated in a backcross progeny between the F1 resistant hybrid material VRH8771 (Vitis-Muscadinia) derived from the muscadine R source ‘NC184–4’ and V. vinifera cv. ‘Cabernet-Sauvignon’ (CS). Results In this pseudo-testcross, parental maps were constructed using simple-sequence repeats markers and single nucleotide polymorphism markers from a GBS approach. For the VRH8771 map, 2271 SNP and 135 SSR markers were assembled, resulting in 19 linkage groups (LG) and an average distance between markers of 0.98 cM. Phylloxera resistance was assessed by monitoring root nodosity number in an in planta experiment and larval development in a root in vitro assay. Nematode resistance was studied using 10–12 month long tests for the selection of durable resistance and rating criteria based on nematode reproduction factor and gall index. A major QTL for phylloxera larval development, explaining more than 70% of the total variance and co-localizing with a QTL for nodosity number, was identified on LG 7 and designated RDV6. Additional QTLs were detected on LG 3 (RDV7) and LG 10 (RDV8), depending on the in planta or in vitro experiments, suggesting that various loci may influence or modulate nodosity formation and larval development. Using a Bulked Segregant Analysis approach and a proportion test, markers clustered in three regions on LG 9, LG 10 and LG 18 were shown to be associated to the nematode resistant phenotype. QTL analysis confirmed the results and QTLs were thus designated respectively XiR2, XiR3 and XiR4, although a LOD-score below the significant threshold value was obtained for the QTL on LG 18. Conclusions Based on a high-resolution linkage map and a segregating grapevine backcross progeny, the first QTLs for resistance to D. vitifoliae and to X. index were identified from a muscadine source. All together these results open the way to the development of marker-assisted selection in grapevine rootstock breeding programs based on muscadine derived resistance to phylloxera and to X. index in order to delay GFLV transmission.

Data mining and metagenomic analysis of 277 open reading frame sequences of bipartite RNA viruses of the genus Nepovirus, family Secoviridae, were performed, documenting how challenging it can be to unequivocally assign a virus to a particular species, especially those in subgroups A and C, based on some of the currently adopted taxonomic demarcation criteria. This work suggests a possible need for their amendment to accommodate pangenome information. In addition, we revealed a host-dependent structure of arabis mosaic virus (ArMV) populations at a cladistic level and confirmed a phylogeographic structure of grapevine fanleaf virus (GFLV) populations. We also identified new putative recombination events in members of subgroups A, B and C. The evolutionary specificity of some capsid regions of ArMV and GFLV that were described previously and biologically validated as determinants of nematode transmission was circumscribed in silico. Furthermore, a C-terminal segment of the RNA-dependent RNA polymerase of members of subgroup A was predicted to be a putative host range determinant based on statistically supported higher π (substitutions per site) values for GFLV and ArMV isolates infecting Vitis spp. compared with non-Vitis-infecting ArMV isolates. This study illustrates how sequence information obtained via high-throughput sequencing can increase our understanding of mechanisms that modulate virus diversity and evolution and create new opportunities for advancing studies on the biology of economically important plant viruses.

Virus infection of plants can result in various degrees of detrimental impacts and disparate symptom types and severities. Although great strides have been made in our understanding of the virus–host interactions in herbaceous model plants, the mechanisms underlying symptom development are poorly understood in perennial fruit crops. Grapevine fanleaf virus (GFLV) causes variable symptoms in most vineyards worldwide. To better understand GFLV-grapevine interactions in relation to symptom development, field and greenhouse trials were conducted with a grapevine genotype that exhibits distinct symptoms in response to a severe and a mild strain of GFLV. After validation of the infection status of the experimental vines by high-throughput sequencing, the transcriptomic and metabolomic profiles in plants infected with the two viral strains were tested and compared by RNA-Seq and LC-MS, respectively, in the differentiating grapevine genotype. In vines infected with the severe GFLV strain, 1023 genes, among which some are implicated in the regulation of the hypersensitive-type response, were specifically deregulated, and a higher accumulation of resveratrol and phytohormones was observed. Interestingly, some experimental vines restricted the virus to the rootstock and remained symptomless. Our results suggest that GFLV induces a strain- and cultivar-specific defense reaction similar to a hypersensitive reaction. This type of defense leads to a severe stunting phenotype in some grapevines, whereas others are resistant. This work is the first evidence of a hypersensitive-like reaction in grapevine during virus infection.

The first search for viruses in berries (blackberry, raspberry and blueberry) was conducted in Mexico. In September 2017, 24 berry plants displaying virus-like symptoms were sampled in the main berry-producing areas of Mexico and later analyzed for the presence of 29 different viruses via enzyme linked immunosorbent assay (ELISA) and reverse transcription PCR (RT-PCR). Additionally, virus screening was verified using high throughput sequencing (HTS). As a result of this study, two blackberry plants collected in Los Reyes de Salgado, Michoacan were determined positive for tobacco ringspot virus (TRSV; genus Nepovirus), such plants exhibited yellowing and ringspot on leaves. In contrast, the rest of berry samples tested negative for any other virus. This is the first detection of TRSV or any other virus infecting blackberries in Mexico. Lastly, the sequence diversity of characterized TRSV isolates was investigated using an identity matrix and phylogenetics.

Complete genome sequences of two cycas necrotic stunt virus (CNSV) isolates from Paeonia suffruticosa and Daphne odora were determined. Phylogenetic trees and pairwise comparisons using complete RNA1- and RNA2-encoded polyproteins showed that the two CNSV isolates are divergent (83.19%-89.42% in polyprotein 1 and 73.61%-85.78% in polyprotein 2). A comparative analysis based on taxonomic criteria for the species demarcation of nepoviruses confirmed that they are not new species but distinct variants. This is the first report of the complete genome sequences of CNSV detected in P. suffruticosa and D. odora, and the first report of CNSV infecting P. suffruticosa.

The purpose. To select pure clones of female plants and to clarify spread in domestic plantings of cherry, mazzard cherry and their stocks of virus pathogens which were not widely study. Methods. Visual diagnostic study of plantings, immunoenzymatic analysis, statistical methods for data processing. Results. During visual diagnostic study of plantings of asymptomatic plants they selected 90 samples of mazzard cherry, 63 samples of cherry and 33 — of clonal stocks. Their inspection on presence of 11 viruses proved that the level contamination of mazzard cherry (16,7%) was considerably above, than that of cherry (9,5%). In the probed samples of varieties presence of viruses only from two taxonomic groups (of stems Ilarvirus and Nepovirus), namely VKS (8,7%), VNKP (11,8), VMR (6,7), VLKPS (6,7), VKPM (1,1%), and also their complex infection contaminations was revealed. In stocks VSL-2, Kolt and Studenykivska viruses were not revealed. It is determined that the most spread pathogen in plantings of both crops was VNKP (11,8%). It goes into all the identified complexes from 2 and more viruses. Among 11 tested varieties of mazzard cherry the most infected were Valerii Chkalov and Kazka (50%). Free from viruses were samples of varieties Donetskii ugoliok, Donetskaya krasavitsa, Nizhnist, Melitopolska chorna, and Udivitelnaya. At the same time samples of 3 varieties of cherry — Vidrodzhennia and Solidarnist (33%), Ksenia (12%) — were infected. Conclusions. Spread of virus pathogens to plantings of cherry and mazzard cherry in 6 regions of Ukraine is fixed. Pure plants of all tested varieties are selected for the further inspection on presence of virus pathogens by OT-PCR method with the purpose to takeoff plants in initial clones which can be used for reproduction according to standard schemes of certification of these crops. The state of execution of technology requirements on saving virus-free status of parent plantings in equipments of different patterns of ownership is analyzed and measures on prevention of spread of viruses in parent and industrial plantings are offered.

A novel nepovirus was identified and characterised from caraway, and tentatively named caraway yellows virus (CawYV). Tubular structures with isomeric virus particles typical for nepoviruses were observed in infected tissues by electron microscopy. The whole genome of CawYV was identified by high throughput sequencing (HTS). It consists of two segments with 8026 nt for RNA1 and 6405 nt for RNA2, excluding the poly(A) tails. CawYV-RNA1 shared closest nt identity to peach rosette mosaic virus (PRMV) with 63%, while RNA2 shared 41.5% with blueberry latent spherical virus (BLSV). The amino acid sequences of the CawYV protease-polymerase (Pro-Pol) and capsid protein (CP) regions share the highest identities with those of the subgroup C nepoviruses. The Pro-Pol region shared highest aa identity with PRMV (80.1%), while the CP region shared 39.6% to soybean latent spherical virus. Phylogenetic analysis of the CawYV-Pro-Pol and -CP aa sequences provided additional evidence of their association with nepoviruses subgroup C. Based on particle morphology, genomic organization and phylogenetic analyses, we propose CawYV as a novel species within the genus Nepovirus subgroup C. Electronic supplementary material The online version of this article (10.1186/s12985-019-1181-1) contains supplementary material, which is available to authorized users.

Viral diseases in viticulture lead to annual losses in the quantity and quality of grape production. Since no direct control measures are available in practice, preventive measures are taken to keep the vines healthy. These include, for example, the testing of propagation material for viruses such as Arabis mosaic virus (ArMV), Grapevine fanleaf virus (GFLV) or Grapevine leafroll-associated virus 1 (GLRaV-1) and 3 (GLRaV-3). As long-term investigations have shown, GLRaV-1 (2.1%) occurs most frequently in southwestern German wine-growing regions, whereas GLRaV-3 (&lt, 0.1%) is almost never found. However, tests conducted over 12 years indicate that there is no general decline in virus-infected planting material. Thus, it can be assumed that a spread of the viruses via corresponding vectors still takes place unhindered. Beyond the examinations regulated within the German Wine Growing Ordinance, one-time tests were carried out on Grapevine Pinot gris virus (GPGV). This analysis showed that GPGV was found in 17.2% of the samples.

Tomato ringspot virus (ToRSV, genus Nepovirus, family Secoviridae, order Picornavirales) is a bipartite positive-strand RNA virus, with each RNA encoding one large polyprotein. ToRSV RNAs are linked to a 5’-viral genome-linked protein (VPg) and have a 3’ polyA tail, suggesting a non-canonical cap-independent translation initiation mechanism. The 3’ untranslated regions (UTRs) of RNA1 and RNA2 are unusually long (~1.5 kb) and share several large stretches of sequence identities. Several putative in-frame start codons are present in the 5’ regions of the viral RNAs, which are also highly conserved between the two RNAs. Using reporter transcripts containing the 5’ region and 3’ UTR of the RNA2 of ToRSV Rasp1 isolate (ToRSV-Rasp1) and in vitro wheat germ extract translation assays, we provide evidence that translation initiates exclusively at the first AUG, in spite of a poor codon context. We also show that both the 5’ region and 3’ UTR of RNA2 are required for efficient cap-independent translation of these transcripts. We identify translation-enhancing elements in the 5’ proximal coding region of the RNA2 polyprotein and in the RNA2 3’ UTR. Cap-dependent translation of control reporter transcripts was inhibited when RNAs consisting of the RNA2 3’ UTR were supplied in trans. Taken together, our results suggest the presence of a CITE in the ToRSV-Rasp1 RNA2 3’ UTR that recruits one or several translation factors and facilitates efficient cap-independent translation together with the 5’ region of the RNA. Non-overlapping deletion mutagenesis delineated the putative CITE to a 200 nts segment (nts 773–972) of the 1547 nt long 3’ UTR. We conclude that the general mechanism of ToRSV RNA2 translation initiation is similar to that previously reported for the RNAs of blackcurrant reversion virus, another nepovirus. However, the position, sequence and predicted structures of the translation-enhancing elements differed between the two viruses.

International audience; High throughput sequencing was performed on virion-associated nucleic acids (VANA) from a pool of fifty asymptomatic rough bluegrasses (Poa trivialis L.) collected in a Belgian grazed pasture. Bioinformatics analyses produced some contigs presenting similarities with secovirid genomes, in particular nepoviruses and waikaviruses. Three distinct positive-sense single-stranded RNAs including 5? and 3? UTR were reconstructed and they represented two novel viruses infecting rough bluegrass, for which the provisional names poaceae Liege nepovirus A (PoLNVA, 7298 nt for RNA1 and 4263 nt for RNA2) and poaceae Liege virus 1 (PoLV1, 11,623 nt) were proposed. Compared to other Secoviridae members, the highest amino acid identity reached 90.7 % and 66.7 % between PoLNVA and nepoviruses for the Pro-Pol and CP regions respectively, while PoLV1 presented the highest amino acid identity with waikaviruses but with lower identities, i.e. 41.2 % for Pro-Pol and 25.8 % for CP regions, far below the ICTV demarcation criteria for novel secovirid. Based on sequence identity and phylogenetic analyses, PoLNVA was proposed to belong to the genus Nepovirus and PoLV1 as an unclassified secovirids. Detection of the two novel viruses was confirmed in high prevalence in rough bluegrass and ten other wild Poaceae species (Agropyron repens, Agrostis capillaris, Apera spica-venti, Anthoxanthum odoratum, Cynosorus cristatus, Festuca rubra, Holcus lanatus, Lolium perenne, Phleum bertolini and Phleum pratense) by RT-PCR and Sanger sequencing, revealing a diverse host range within Poaceae for these novel secovirids. Seed transmission was evaluated and confirmed for PoLNVA.

Melon is one of the most popular fruits worldwide and has been bred into various cultivars. RNA-sequencing using healthy melon fruit was performed to determine differences in gene expression among cultivars. Unexpected RNA-seq results revealed that viruses asymptomatically infected fruits at a high frequency (16 of 21 fruits examined were infected) and that viral transcripts highly accumulated in comparison with host transcripts (15 %–75 % of total reads). Their nucleotide sequences and phylogenetic analyses indicated that more than 10 novel isolates of tobacco ringspot virus (TRSV) were found in melon fruits. Asymptomatic infection with TRSV on melon fruits was confirmed by both immunoblot and RT-PCR analyses. Numerous isolates of TRSV generated and maintained in melon fields, and this is likely due to their asymptomatic infections. This TRSV melon isolate infected Nicotiana benthamiana plants with stunting and yellowing symptoms. This is the first report of frequent and asymptomatic infection of TRSV in consumable melon fruits.

Grapevine fanleaf disease, caused by grapevine fanleaf virus (GFLV), transmitted by the soil-borne nematode Xiphinema index, provokes severe symptoms and economic losses, threatening vineyards worldwide. As no effective solution exists so far to control grapevine fanleaf disease in an environmentally friendly way, we investigated the presence of resistance to GFLV in grapevine genetic resources. We discovered that the Riesling variety displays resistance to GFLV, although it is susceptible to X. index. This resistance is determined by a single recessive factor located on grapevine chromosome 1, which we have named rgflv1. The discovery of rgflv1 paves the way for the first effective and environmentally friendly solution to control grapevine fanleaf disease through the development of new GFLV-resistant grapevine rootstocks, which was hitherto an unthinkable prospect. Moreover, rgflv1 is putatively distinct from the virus susceptibility factors already described in plants., Djennane, Merdinoglu and colleagues identify a single genetic factor, rgflv1, in Riesling grapes that confers a resistance to grapevine fanleaf virus. This resistance factor may inform genetic solutions for control of this virus in many grape varieties.

International audience; Grapevine fanleaf virus (GFLV) is a picorna-like plant virus transmitted by nematodes that affects vineyards worldwide. Nanobody (Nb)-mediated resistance against GFLV has been created recently, and shown to be highly effective in plants, including grapevine, but the underlying mechanism is unknown. Here we present the high-resolution cryo electron microscopy structure of the GFLV-Nb23 complex, which provides the basis for molecular recognition by the Nb. The structure reveals a composite binding site bridging over three domains of one capsid protein (CP) monomer. The structure provides a precise mapping of the Nb23 epitope on the GFLV capsid in which the antigen loop is accommodated through an induced-fit mechanism. Moreover, we uncover and characterize several resistance-breaking GFLV isolates with amino acids mapping within this epitope, including C-terminal extensions of the CP, which would sterically interfere with Nb binding. Escape variants with such extended CP fail to be transmitted by nematodes linking Nb-mediated resistance to vector transmission. Together, these data provide insights into the molecular mechanism of Nb23-mediated recognition of GFLV and of virus resistance loss.

Peach rosette mosaic disease was first described in the 1940s affecting peach and plum. It was later determined that peach rosette mosaic virus (PRMV) is the causal agent of the disease. PRMV, a member of the genus Nepovirus, infects several perennial crops including stone fruit, grape and blueberry as well as several weed species found in orchards around the world. The molecular characterization of the virus is limited to partial genome sequences making it difficult to develop reliable and sensitive molecular detection tests; the reason that detection is routinely performed using ELISA with antibodies risen against a single virus isolate. Given the potential economic impact of the virus and the modes of transmission which, in addition to nematodes, include seed we studied PRMV in more depth using a modified dsRNA extraction protocol to obtain the virus genome. We determined the full nucleotide sequence and developed a protocol that detects conserved regions present in RNA 1 and RNA 2, making it an excellent alternative to the detection protocols used today.

Colombia is the largest worldwide producer of Cape gooseberry (Physalis peruviana L.), which is an exotic tropical fruit with increasing high demand in international markets. Unfortunately, the rapid expansion of this crop has occurred without implementing adequate surveillance measures that enforce the use of healthy planting material for the establishment of new crops. This study investigated the prevalence of viruses in P. peruviana using seeds, plantlets, and adult plants with or without symptoms typical of viral infection in the province of Antioquia. Detection of viruses by RT-qPCR revealed widespread infection with potato virus Y (PVY), potato virus X (PVX), potato virus S (PVS), Cape gooseberry ilarvirus 1 (CGIV-1), and Physalis vein necrosis virus (PhyVNV), a proposed new nepovirus species. Co-infections were also common in all samples tested. Further high-throughput sequencing analysis confirmed the presence of most of these viruses and revealed the presence of a new torradovirus (Physalis torrado virus, PhyTV), a new potexvirus (Physalis virus X, PhyVX), and a divergent tobacco mosaic virus isolate. These results reveal that the P. peruviana virome is largely unexplored, and urgent measures should be implemented to certify the health status of planting material, and crops.

The genome sequence of a new subgroup C nepovirus from Stenotaphrum secundatum in Australia is described. This virus, tentatively named Stenotaphrum nepovirus (SteNV), was present in separate plants as a mixed infection with either sugarcane mosaic virus or Panicum mosaic virus. The virus genome was divided between two RNA segments, 7,824 and 7,104 nucleotides (nt) in length, which each encode a single long polyprotein with putative 3C-like cysteine protease sites of the type H/G, H/S or L/S. The 3' untranslated region of RNA2, at 2,155 nt, is the longest observed for any subgroup C nepovirus. Phylogenetic analyses using protease-polymerase and coat protein amino acid alignments suggest that SteNV is most closely related to cherry leaf roll virus. Using a newly developed RT-PCR assay, this virus was detected at multiple localities in New South Wales, Queensland and Western Australia, and in a second host species, Digitaria didactyla. No consistent association between virus infection and symptoms could be established. The economic importance, pathogenicity and transmission of this novel virus species warrant further investigation.

Raspberry (Rubus idaeus L.) and blackberry (Rubus fruticosus L.) are infected by at least 29 viruses, including the Tomato black ring virus (TBRV) (Martin et al. 2013). TBRV belongs to the genus Nepovirus (subgroup B) of the family Secoviridae and is listed as a plant pathogen in over 40 countries. TBRV infects a wide range of herbaceous and woody plants. In Poland, TBRV has been described on the plants of the following species: Tagetes patula, T. erecta, Cucumis sativus, Cucurbita pepo, Lactuca sativa, Solanum tuberosum, S. lycopersicum, Sambucus nigra, and Robinia pseudoacacia (Jonczyk et al. 2004, Hasiow-Jaroszewska et al. 2015). To this date, there is no information on the incidence of TBRV in raspberry and blackberry in Poland. In the spring of 2019, 52 blackberry leaf samples and 408 raspberry leaf samples were collected from 4 plantations located in central Poland. None of the raspberry plants (cvs. Glen Ample, Polka, Sokolica), nor the blackberry plants (cvs. Thornfree, Polar, Gaj, Kotata) exhibited viral symptoms. Enzyme-linked immunosorbent assay (ELISA) was carried out for extracts from the 460 collected leaf samples to detect TBRV using commercial antisera (Loewe Biochemica GmbH, Germany). The results indicated that 9 samples (4 blackberry, 5 raspberry) were infected with TBRV. The isolates of the virus were transferred by sap inoculation and maintained in Nicotiana tabacum cv. Xanthi. Systemic ringspot, necrosis and patterned lines were observed on tobacco leaves. The presence of the virus in tobacco leaf samples was confirmed by reverse transcription PCR (RT-PCR). Total RNA was extracted from all 9 samples using the silica capture (SC) method described originally by Boom et al. (1990) and adapted to the detection of plant viruses by Malinowski (1997). Part of the CP gene was amplified with the CPF (5'-GCCTGTCTCTCTCGCAATG-3') and CPR (5'-AAGGAGCCAAACTGAAATGT-3') primer pair (Hasiow-Jaroszewska et al. 2015). Amplicons of the expected size (763 bp) were obtained for each sample. The amplified products were purified, sequenced in both directions, deposited in GenBank and assigned accession numbers: MT507387 to MT507390 and MT507394 for the isolates from Rubus idaeus and MT507391 to MT507393 and MN954654 for the isolates from Rubus fruticosus, respectively. The 9 newly obtained TBRV CP gene sequences, together with the 25 isolates deposited in GenBank, were aligned by ClustalW. The isolates obtained in this study showed a 99.0-100% nucleotides (nt) and a 98.7-100% amino acids (aa) identity in the part of the CP, respectively. Comparison of the part of the CP of the 4 blackberry and the 5 raspberry TBRV isolates with 25 TBRV isolates available in GenBank showed a 80.6-97.8% nt and a 87.9-99.5% aa identity, respectively. The results of the phylogenetic analysis have revealed that the TBRV isolates obtained in this study are closely related to 3 Polish isolates (AY157994, KR139941, KR139951) and 1 Bioreba ctrl Switzerland isolate (KT923164). These findings are of epidemiological significance due to the fact that TBRV was detected on symptomless Rubus plants, which therefore represent a reservoir of the virus and a threat in case of a symptomatic infection of sensitive cultivars. Accordingly, the results will assist in using appropriate strategies for reducing TBRV incidence in Rubus-growing areas. Moreover, this is, to the best of our knowledge, the first report of TBRV in raspberry and blackberry in Poland.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

The aim of the presented work consists in the analysis of results of long-term monitoring of the members of one of the most important and interesting phytovirus taxons – genus Nepovirus (Picornavirales, Secoviridae, Comovirinae) – which is carried out since 1962 on the planned basis in the south of the Far East (Primorsky krai, Khabarovsk krai, the Sakhalin region) by the Laboratory of Virology of Federal Scientific Center of the East Asia terrestrial biodiversity of Far Eastern Branch of Russian Academy of Sciences (Vladivostok, Russia). Discussion. Many (it is possible – all) nepoviruses are capable to cause epiphytoties with significant economic damage for world economy. In the current article the organization of nepovirus genome, the principles of their division into three genetic groups (A, B, and C), virion morphology, the principles of division into three beyond density fractions (T, M, and B), the characteristics of phytopathology connected with nepoviruses, their ecology in the south of the Far East (including sources of isolation and vectors) are discussed as well as physical-chemical properties of some the most interesting strains from this region which apparently could represent new species of Nepovirus genus: Phryma asiatica mosaic virus (PhAMV); dayflower mosaic virus (DFMV); foenugreek necrotic spot virus (FoNSV); Capsicum annuum necrotic spot virus (CaNSV). Conclusion. Nepovirus genus is one of the most adapted for circulation in the phytocenoses of midlatitudes having natural reservoir among wild plants and pose serious threat for crops. On the basis of ecological features of nepoviruses the scientifically based list of preventive and protective actions against epiphytoties with nepovirus nature is provided. One of the most important elements of such actions is their planned monitoring at the regional level with obligatory comparison of the received results to universal data.

International audience; Since their discovery, single-domain antigen-binding fragments of camelid-derived heavy-chainonly antibodies, also known as nanobodies (Nbs), have proven to be of outstanding interest as therapeutics against human diseases and pathogens including viruses, but their use against phytopathogens remains limited. Many plant viruses including Grapevine fanleaf virus (GFLV), a nematode-transmitted icosahedral virus and causal agent of fanleaf degenerative disease, have worldwide distribution and huge burden on crop yields representing billions of US dollars of losses annually, yet solutions to combat these viruses are often limited or inefficient. Here, we identified a Nb specific to GFLV that confers strong resistance to GFLV upon stable expression in the model plant Nicotiana benthamiana and also in grapevine rootstock, the natural host of the virus. We showed that resistance was effective against a broad range of GFLV isolates independently of the inoculation method including upon nematode transmission but not againstits close relative, Arabis mosaic virus. We also demonstrated that virus neutralization occurs at an early step of the virus life cycle, prior to cell-to-cell movement. Our findings will not only be instrumental to confer resistance to GFLV in grapevine, but more generally they pave the way for the generation of novel antiviral strategies in plants based on Nbs

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (

A nepovirus was isolated from Begonia ricinifolia showing chlorotic ringspot and line pattern symptoms. The purified virus had spherical particles of ca. 30 nm and contained a single coat protein subunit of ca. 56 kDa. The complete nucleotide sequence of the bipartite viral genome was determined. RNA 1 is 7394 nucleotides long, flanked by 5' and 3' untranslated regions (UTR), and followed by a 3' poly-A tail. It contains a single 6810 nt long open reading frame (ORF), which is translated into a 255 kDa polyprotein composed of 2269 amino acids. The 4684 nt long RNA 2 has a 4053 nt long ORF which encodes a single polyprotein of 1350 amino acids with a molecular weight of 149 kDa. Sequence comparisons revealed that the virus isolated from B. ricinifolia has the highest sequence similarity to beet ringspot virus and should be considered as a strain of BRSV. This is the first report on the occurrence of BRSV in B. ricinifolia and the presence of this virus outside Scotland.

Sunflower is one of the leading edible oilseed crops of the world and is an important oil-producing crop of India. The sunflower necrosis disease caused by sunflower necrosis virus (SNV) has become a major hurdle for cultivation of sunflower in India. However, there is lack of genetic information and standard methods for detection and identification of the SNV. To address this issue, we have developed an application using coat protein (CP) to perform molecular profiling of SNV strains. The nucleic acid and amino acid sequence analysis of CP of SNV strains collected from different regions of Maharashtra and Karnataka showed high percent homology (96.89–98.87%). However, 3D structural analysis generated eleven distinct groups of SNV strains. Comparative bioinformatic analyses of nucleic acid and amino acid sequences with different genera of positive stranded (+) ssRNA viruses established their phylogentic relationship with ~25 (+) ssRNA viruses viz., Ilarvirus, Bromovirus, Cucumovirus, Alfamovirus, Comovirus, Nepovirus, Sequivirus, Potyvirus and Closterovirus. Additionally, the phylogenetic analysis revealed three distinct clusters, wherein major cluster I comprised SNV strains and Tobacco streak virus together showing 99% sequence homology and established closer phylogenetic relationship among all member viruses.

Avirulence factors are critical for the arm's race between a virus and its host in determining incompatible reactions. The response of plants to viruses from the genus Nepovirus in the family Secoviridae, including Grapevine fanleaf virus (GFLV), is well characterized, although the nature and characteristics of the viral avirulence factor remain elusive. By using infectious clones of GFLV strains F13 and GHu in a reverse genetics approach with wild-type, assortant and chimeric viruses, the determinant of necrotic lesions caused by GFLV-F13 on inoculated leaves of Nicotiana occidentalis was mapped to the RNA2-encoded protein 2AHP , particularly to its 50 C-terminal amino acids. The necrotic response showed hallmark characteristics of a genuine hypersensitive reaction, such as the accumulation of phytoalexins, reactive oxygen species, pathogenesis-related protein 1c and hypersensitivity-related (hsr) 203J transcripts. Transient expression of the GFLV-F13 protein 2AHP fused to an enhanced green fluorescent protein (EGFP) tag in N. occidentalis by agroinfiltration was sufficient to elicit a hypersensitive reaction. In addition, the GFLV-F13 avirulence factor, when introduced in GFLV-GHu, which causes a compatible reaction on N. occidentalis, elicited necrosis and partially restricted the virus. This is the first identification of a nepovirus avirulence factor that is responsible for a hypersensitive reaction in both the context of virus infection and transient expression.

Next-generation sequencing (NGS) allowed the assembly of the complete RNA-1 and RNA-2 sequences of a grapevine isolate of artichoke Italian latent virus (AILV). RNA-1 and RNA-2 are 7,338 and 4,630 nucleotides in length excluding the 3' terminal poly(A) tail, and encode two putative polyproteins of 255.8 kDa (p1) and 149.6 kDa (p2), respectively. All conserved motifs and predicted cleavage sites, typical for nepovirus polyproteins, were found in p1 and p2. AILV p1 and p2 share high amino acid identity with their homologues in beet ringspot virus (p1, 81% and p2, 71%), tomato black ring virus (p1, 79% and p2, 63%), grapevine Anatolian ringspot virus (p1, 65% and p2, 63%), and grapevine chrome mosaic virus (p1, 60% and p2, 54%), and to a lesser extent with other grapevine nepoviruses of subgroup A and C. Phylogenetic and sequence analyses, all confirmed the strict relationship of AILV with members classified in subgroup B of genus Nepovirus.

Tomato black ring virus (TBRV, genus Nepovirus) infects a wide range of economically important plants such as tomato, potato, tobacco and cucumber. Here, a successful construction of infectious full-length cDNA clones of the TBRV genomic RNAs (RNA1 and RNA2) is reported for the first time. The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS). The symptoms induced on plants agroinoculated with both constructs were indistinguishable from those caused by the wild-type virus. The infectivity of obtained clones was verified by reinoculation to Nicotiana tabacum cv. Xanthi, Chenopodium quinoa and Cucumis sativus. The presence of viral particles and RNA was confirmed by electron microscopy and reverse transcription polymerase chain reaction, respectively. Constructed full-length infectious cDNA clones will serve as an excellent tool to study virus-host-vector interactions.

Two groups of economically important plant viruses, nepoviruses and tobraviruses, are transmitted through the longidorids, Trichodorus and Paratrichodorus. Nepoviruses and tobraviruses are taxonomically different from each other, but both have RNA genetic material and contain two different types of genomic RNAs. Nepovirus particles are spherical in shape, while tobraviruses are rod-shaped. Nepovirus species have a single coat protein (CP), which is assembled in multiple copies to form the virus particles. Longidorids have been reported as vectors of nepoviruses, while trichodorids serve as vectors of tobraviruses. Of the 41 species of nepoviruses, 13 are transmitted by 11 species of Xiphinema and 10 are transmitted by 11 species of Longidorus in different crops. Different species of Trichodorus and Paratrichodorus have been reported to transmit pepper ringspot virus, tobacco rattle virus, and pea early-browning virus in different countries. Plant-parasitic nematodes acquire virus particles during feeding by sucking cell sap with a stylet. Most of the plant-parasitic nematodes transmit plant viruses by feeding ectoparasitically near the root tip on the outside of the root surface. Among them, some nematodes induce galls at the infection site of root surface after completion of the feeding process. The transmission process of the plant viruses by nematodes are completed by different phases, such as ingestion, acquisition, adsorption, retention, release, transfer, and establishment. Efficient transmission from infected host plants to healthy host plants by nematode vectors is an important biological feature for the development of epidemics of plant diseases incited by viruses. Both the adult and juvenile stages of the nematode vectors are capable of transmitting the associated plant viruses. Virus transmission by a vector is often characterized by some degree of specificity. Specific relationships exist between the serologically distinct viruses and their vector nematode species. Specificity is largely determined by the virus CP and by an inherited ability of the nematode to retain virus particles at specific sites within its esophagus. Numerous studies suggest the involvement of a virus–ligand interaction in transmission specificity. The CP and its derivatives readthrough CP and minor CP and nonstructural proteins, such as a helper component or a transmission factor, are major viral determinants of transmission specificity. A number of virion-binding vector proteins have been identified as potential receptors.

During high throughput sequencing (HTS) of leaves from a symptomatic red clover plant, a new RNA virus, tentatively named red clover nepovirus A (RCNVA), was discovered. The complete genomic sequence was determined and characterized. Particularly noteworthy was that RCNVA shares high sequence identities in RNA1 with a group of phylogenetically related nepoviruses while homologies in the RNA2 segments are markedly lower. Based on the genomic organization and phylogenetic attributes, RCNVA should be classified as a novel virus of the genus Nepovirus (subfamily Comovirinae, family Secoviridae, order Picornavirales).

Grapevine fanleaf virus (GFLV) and arabis mosaic virus (ArMV) are nepoviruses responsible for grapevine degeneration. They are specifically transmitted from grapevine to grapevine by two distinct ectoparasitic dagger nematodes of the genus Xiphinema. GFLV and ArMV move from cell to cell as virions through tubules formed into plasmodesmata by the self-assembly of the viral movement protein. Five surface-exposed regions in the coat protein called R1 to R5, which differ between the two viruses, were previously defined and exchanged to test their involvement in virus transmission, leading to the identification of region R2 as a transmission determinant. Region R4 (amino acids 258 to 264) could not be tested in transmission due to its requirement for plant systemic infection. Here, we present a fine-tuning mutagenesis of the GFLV coat protein in and around region R4 that restored the virus movement and allowed its evaluation in transmission. We show that residues T258, M260, D261, and R301 play a crucial role in virus transmission, thus representing a new viral determinant of nematode transmission.

Raspberry ringspot virus (RpRSV) is an important virus that infects horticultural crops including grapevine, cherry, berry fruit and rose. The genome sequences of RpRSV are highly diverse between isolates and this makes the design of a PCR-based detection method difficult. In this study, a TaqMan real-time RT-PCR assay was developed for the rapid and sensitive detection of RpRSV. Primers and probes targeting the most conserved region of the movement protein gene were designed to amplify a 229 bp fragment of RpRSV RNA-2. The assay was able to amplify all RpRSV isolates tested. The detection limit of the RpRSV target region was estimated to be 61–98 copies, depending on the RpRSV strain. The sensitivity was about 100 times greater than the conventional RT-PCR assay using the same primers as the real-time RT-PCR assay. A comparison with published conventional RT-PCR assays indicated that both published assays lacked reliability and sensitivity, as neither were able to amplify all RpRSV isolates tested, and both were at least 1000 times less sensitive than the novel TaqMan real-time RT-PCR assay. The assay can also be run as a duplex reaction with the nad5 plant internal control primers and probe to simultaneously verify the PCR competency of the samples. The amplicon obtained with the real-time RT-PCR assay is suitable for direct sequencing if it is necessary to further confirm the RpRSV identity or determine the RpRSV strain.

The mechanisms underlying host plant symptom development upon infection by viruses of the genus Nepovirus in the family Secoviridae, including grapevine fanleaf virus (GFLV), are poorly understood. In the systemic host Nicotiana benthamiana, GFLV strain GHu produces characteristic symptoms of vein clearing in apical leaves, unlike other GFLV strains such as F13, which cause an asymptomatic infection. In this study, we expanded on earlier findings and used reverse genetics to identify residue 802 (lysine, K) of the GFLV-GHu RNA1-encoded RNA-dependent RNA polymerase (1EPol) as a modulator of vein-clearing symptom development in N. benthamiana. Mutations to this site abolished (K to G, A, or Q) or attenuated (K to N or P) symptom expression. Noteworthy, residue 802 is necessary but not sufficient for vein clearing, as GFLV-F13 RNA1 carrying K802 remained asymptomatic in N. benthamiana. No correlation was found between symptom expression and RNA1 accumulation, as shown by reverse transcription-quantitative polymerase chain reaction. Additionally, the involvement of RNA silencing of vein clearing was ruled out by virus-induced gene silencing experiments and structure predictions for protein 1EPol suggested that residue 802 is flanked by strongly predicted stable secondary structures, including a conserved motif of unknown function (805LLKT/AHLK/RT/ALR814). Together, these results reveal the protein nature of the GFLV-GHu symptom determinant in N. benthamiana and provide a solid basis for probing and determining the virus-host proteome network for symptoms of vein clearing.

An emerging virus-like flower yellowing disease (FYD) of green Sichuan pepper (Zanthoxylum armatum v. novemfolius) has been recently reported. Four new RNA viruses were discovered in the FYD-affected plant by the virome analysis using high-throughput sequencing of transcriptome and small RNAs. The complete genomes were determined, and based on the sequence and phylogenetic analysis, they are considered to be new members of the genera Nepovirus (Secoviridae), Idaeovirus (unassigned), Enamovirus (Luteoviridae), and Nucleorhabdovirus (Rhabdoviridae), respectively. Therefore, the tentative names corresponding to these viruses are green Sichuan pepper-nepovirus (GSPNeV), -idaeovirus (GSPIV), -enamovirus (GSPEV), and -nucleorhabdovirus (GSPNuV). The viral population analysis showed that GSPNeV and GSPIV were dominant in the virome. The small RNA profiles of these viruses are in accordance with the typical virus-plant interaction model for Arabidopsis thaliana. Rapid and sensitive RT-PCR assays were developed for viral detection, and used to access the geographical distributions. The results revealed a correlation between GSPNeV and the FYD. The viruses pose potential threats to the normal production of green Sichuan pepper in the affected areas due to their natural transmission and wide spread in fields. Collectively, our results provide useful information regarding taxonomy, transmission and pathogenicity of the viruses as well as management of the FYD.

International audience; Aim: Fifteen nepoviruses are able to induce fanleaf degeneration in grapes, which is the viral disease with the highest economic impact. Grapevine FanLeaf Virus (GFLV) is the main causal agent of this disease worldwide and in Europe, followed by Arabis Mosaic Virus (ArMV). A third nepovirus has been described in France: Tomato Black Ring Virus (TBRV), detected in vines for the first time in France on a multi-varietal plot in 2009. The aim of this work is to evaluate the effect of TBRV on grape yield and berry quality potential in two grapevine varieties. Methods and results: Quantitative and qualitative impact of TBRV was investigated in 2010 and 2011 in the vine plot where the virus was first detected in France. Over 200 vines were analyzed by ELISA tests in order to determine their status regarding viral diseases. Vines were distributed in four groups: TBRV positive versus virus free for Merlot and Cabernet franc respectively. For each vine, the presence of eleven other viruses was investigated. In 2010 and 2011 shoot length was measured. Grape composition was also analyzed to determine technological maturity and phenol content in grapes of each vine in relation to its virus status. Total pruning weight was reduced in TBRV infected vines, while lateral shoot number and length were increased. All yield components were affected by the presence of the virus. Vines positive to TBRV produced less bunches and berries and smaller berries compared to healthy vines. Yield loss was greater on Merlot compared to Cabernet franc. Grape quality parameters seemed to be not negatively affected by the presence of TBRV. Conclusions: The major impact of TBRV was a significant yield decrease. The enhanced development of lateral shoots may be considered as a second negative impact that could increase production cost. Significance and impact of the study: These results provide essential information on the impact of TBRV in vineyards. Consequences for management of the viral disease in the vineyard are discussed.

Pollen transmitted viruses require accurate detection and identification to minimize the risk of spread through the global import and export of pollen. Therefore in this study we developed RT-qPCR assays for the detection of Cherry leaf roll virus (CLRV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), and Cherry virus A (CVA), four viruses that infect pollen of Prunus species. Assays were designed against alignments of extant sequences, optimized, and specificity was tested against known positive, negative, and non-target controls. An examination of assay sensitivity showed that detection of virus at concentrations as low as 101 copies was possible, although 102 copies was more consistent. Furthermore, comparison against extant assays showed that in both pollen and plant samples, the newly developed RT-qPCR assays were more sensitive and could detect a greater range of isolates than extant endpoint RT-PCR and ELISA assays. Use of updated assays will improve biosecurity protocols as well as the study of viruses infecting pollen.

Bark from the graft union of tomato ringspot virus (ToRSV) infected plum, symptomatic for brown line disease, showed anatomical changes characteristic of the wound response process. The wound tissue consisted of necrotic cells demarcated by pinkish purple necrophylactic periderm, whose function is to protect living tissues from detrimental effects associated with necrosing cells. However, formation of gray exophylactic periderm led to the sloughing off of the wound tissue and the necrophylactic periderm, resulting in discontinuity of the exophylactic periderm and secondary virus invasion into the wound site. The changes seen in the bark suggest that the hypersensitive response in plum rootstock bark to ToRSV is slow, allowing a systemic movement of the virus and development of a brown line (BL) along the scion and rootstock union. Necrophylactic periderm was not seen in the bark from the graft union of a healthy plum tree. In the graft union of a plum tree without a BL, but testing ToRSV-positive in the roots, localized areas of wound tissue with pinkish purple necrophylactic periderm developed only in the rootstock portion of the tree. Silver-enhanced protein A-colloidal gold immunolabeling was seen on the cell wall and in the cytoplasm of bark tissue from the BL region of scion and rootstock and leaves from the rootstock suckers.

Hibiscus rosa-sinensis Linn., family Malvaceae, is an attractive horticultural plant originating from China. Five viruses infecting H. rosa-sinensis that have been characterized previously are Hibiscus chlorotic ringspot virus (HCRSV, genus Carmovirus), Hibiscus latent ringspot virus (HLRSV, genus Nepovirus), Hibiscus yellow mosaic virus (genus Tobamovirus), Eggplant mottled dwarf virus (EMDV, genus Nucleorhabdovirus), and Okra mosaic virus (OkMV, genus Tymovirus) (2). Recently, two novel tobamoviruses infecting H. rosa-sinensis were characterized in Singapore and Florida (1). In this study, viral symptoms were observed on H. rosa-sinensis in Nanyang City in Henan Province, China. The systemic symptoms included dark and light green mosaic in young leaves, leaf puckering and malformation on older leaves, and significant stunting. Rod-shaped virus particles were isolated from H. rosa-sinensis expressing systemic symptoms. The virus was transmitted mechanically to 10 species from three families. Symptoms expressed on these plants included systemic leaf chlorosis and distortion on Lycopersicum esculentum, systemic mosaic on Capsicum annuum, Nicotiana tabacum, and Physalis floridana, and systemic chlorosis on Glycine max. N. tabacum-Xanthi nc and Datura stramonium were asymptomatic. The virus also produced chlorotic and necrotic local lesions on Chenopodium quinoa, C. amaranticolor, and C. murale. The virus was propagated in L. esculentum, N. tabacum, and P. floridana. Virions purified from systemically infected N. tabacum contained a single-stranded RNA of approximately 6.4 kb and a coat protein (CP) of approximately 17.6 kDa. The double-stranded RNA profile revealed a single band of approximately 6.4 kb. Sap extracted from virus-infected plants reacted positive with an antiserum prepared against Tobacco mosaic virus (TMV) using an antigen-coated plate enzyme-linked immunosorbent assay. The CP gene was amplified by reverse transcription-polymerase chain reaction with primers specific to Tomato mosaic virus (ToMV) and sequence data obtained from the resulting amplification product. The CP gene consisting of 159 amino acids (GenBank Accession No. AY313136) shared 99.37% identity with the ToMV Queensland isolate (GenBank Accession No. AF332868). On the basis of biology, serology, properties of virions, and the sequence of the CP gene, we conclude that the virus isolated from H. rosa-sinensis in China is Tomato mosaic virus(ToMV). References: (1) S. Adkins et al. Plant Dis. 87:1190, 2003. (2) M. H. V. van Regenmortel et al., eds. Virus Taxonomy. 7th Report of the ICTV, Academic Press, NY, 2000.

Grapevines (Vitis spp.) in Washington and Oregon were surveyed for the prevalence of key grapevine viruses. Samples collected from 1,522 vines in Washington were tested for Rupestris stem pitting associated virus (RSPaV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV), and Grapevine leafroll associated virus-3 (GLRaV-3). Tests were also conducted for GLRaV-1 and -2 on 420 samples from Washington. Two hundred forty samples collected from wine grape vineyards in Oregon were tested for GLRaV-1, -2, and -3, and an additional 2,880 samples were collected from 40 vineyards known to have high populations of Xiphinema americanum nematodes. The latter were tested for ArMV, ToRSV, and GFLV. GLRaV-1, -2, and -3 were detected in 2.6, 0.2, and 6.5% of the Washington samples and in 3.0, 0.4, and 4.4% of the Oregon samples. RSPaV was detected in 4.6% of the samples from Washington. No ToRSV, ArMV, or GFLV was detected in any of the samples from Oregon or Washington. Transmission of field isolates of GLRaV-3 from Washington by the grape mealybug also was demonstrated.

Zamia furfuracea (Zamiaceae) is native of coastal Mexico. It is a popular houseplant and easy to grow outdoors in warm climates. In November 2005, a plant of Z. furfuracea, originally from Texas, was received at the Division of Plant Industry in Gainesville, FL. The plant had numerous chlorotic spots on the leaves that eventually became necrotic. Leaves were ground in phosphate buffer (pH 7.2) with Carborundum and used to inoculate a host range that included Chenopodium amaranticolor, C. quinoa, Gomphrena globosa, Datura stramonium, and Nicotiana benthamiana. Systemic symptoms were seen in C. quinoa (necrotic lesions), G. globosa (stunting), D. stramonium (chlorotic ringspots), and N. benthamiana (wavy line patterns) 1 to 2 weeks after inoculation. C. amaranticolor showed only small necrotic local lesions. In further host range studies, systemic infections of Beta vulgaris, D. metaloides, Lactuca sativa, N. clevelandii, Pisum sativus, Petunia hybrida, Zinnia elegans (symptomless), and Cucumis sativa were observed. However, no infection of Zea mays, Verbena hybrida, Glycine max, Phaseolus vulgaris, Catharanthus roseus, Arachis hypogaea, Trifolium spp., Vigna unguiculata, Vicia faba or Digitalis spp. was detected. Inclusions observed in leaf strips of N. benthamiana and D. stramonium indicated a possible infection of this plant with a nepovirus (1). A 337-bp fragment was amplified from total RNA isolated from an inoculated D. stramonium using reverse transcription-PCR with nepovirus group primers provided by Agdia Inc. (Elkhart, IN). Sequence analysis indicated that the nucleotide (nt) and deduced amino acid (aa) sequences of the fragment were 89 to 91% and 91 to 95% identical, respectively, to sequences of the RNA-dependent RNA polymerase gene for Tobacco ringspot virus (TRSV) contained in GenBank (Accession Nos. U50869 and AJ698718). This region was only 50% (nt) and 38% (aa) identical to Cycas necrotic stunt virus (GenBank Accession No. NC_003791), a nepovirus previously reported to infect cycads (2). The original plant, symptomatic inoculated hosts, and the symptomless zinnia tested positive by double-antibody sandwich-ELISA using commercially available antiserum for TRSV (Agdia, Inc.), further confirming the presence of TRSV. Although the virus infecting Z. furfuracea has a more restricted host range than that reported for TRSV, the serology and gene sequence indicates that this virus is a unique isolate of TRSV. References: (1) J. R. Edwardson and R. G. Christie. University of Florida, Institute of Food and Agricultural Sciences, Bull. 894. 1996. (2) S. S. Han et al. Arch. Virol. 147:2207, 2002.

A number of viruses in the genera Ilarvirus and Nepovirus have been shown to be associated with specific diseases in rose, but many graft-transmissible rose diseases still have unknown etiologies. One of these diseases originally was detected by grafting from nonsymptomatic roses to Rosa multiflora indicator plants. Double-stranded RNAs (dsRNAs) were recovered and used as templates for cDNA synthesis and generating a cDNA library. Analysis of deduced amino acid sequences clearly positioned this virus as a member of the family Luteoviridae. The name rose spring dwarf associated virus (RSDaV) is tentatively proposed for the novel virus because the symptoms of this virus on R. multiflora are consistent with previous descriptions of rose spring dwarf disease (RSD). Phylogenetic analysis revealed a close relationship of RSDaV with members of the genus Luteovirus. Aphid transmission studies identified the rose-grass aphid (Metapolophium dirhodum) and yellow rose aphid (Rhodobium porosum) as vectors for this new virus. Host range data showed that RSDaV has a host range including both monocots and dicots. A specific reverse-transcription polymerase chain reaction assay was developed and revealed the presence of the RSDaV in several rose cultivars. RSDaV-inoculated rose plants developed RSD symptoms, confirming its role in the etiology of the disease.

Population dynamics of Xiphinema americanum and transmission of Tomato ringspot virus (ToRSV) were studied in a red raspberry field in Washington State. Population densities of X. americanum were highest in the winter, lowest in the summer, and were correlated with precipitation (R2 = 0.42). All nematode stages were present throughout the year. Gravid females were observed only in the spring, indicating one generation per year. The sequence of the coat protein of the ToRSV from this field was similar to those of other raspberry isolates from the Pacific Northwest. Cucumber seedlings were planted in soil collected monthly from the field and were evaluated for nematode transmission of ToRSV by enzyme-linked immunosorbent assay (ELISA). The proportion of assay plants infected with ToRSV was negatively correlated with nematode densities (R2 = 0.31). In another study, ToRSV was detected by ELISA in fine roots of raspberry plants 5 months after planting in field soil infested with viruliferous nematodes, in all subterranean portions of plants after 12 months, and in all aerial portions the second year. The rate of spread of ToRSV in a raspberry field was 70 cm per year. These results suggest that the rate of ToRSV spread is limited by systemic spread of virus in plants when nematode-infested soil is not transported in the field.

To determine the roles of phytoplasmas and Blackcurrant reversion virus (BRV) in the etiology of full blossom disease (FBD), we conducted graft and dodder transmission experiments. Scions from FBD-affected Ribes rubrum were grafted onto red currants, white currants, and black currants. Red and white cultivars revealed symptoms of FBD, whereas blackcurrant displayed symptoms of BRV. No differences in symptoms were observed between plants infected with BRV only and those infected with BRV and phytoplasma. Aster yellows phytoplasma subgroup 16SrI-C was transferred from FBD-infected red currants to periwinkle, where symptoms of green and yellow petal were observed. Back-transmission of phytoplasma to currant seedlings of red and black currant was not successful. Scions of periwinkle infected with aster yellows phytoplasmas of subgroup 16SrI-C and 16SrI-B, which were bottle-, bark-, and approach-grafted onto seedlings of red and black currant, resulted in positive but symptomless transmission of phytoplasma to red currant. We conclude that FBD symptoms are induced by BRV rather than by phytoplasma, which was originally described as the causal agent of FBD.