Search

Chemical proteomics relies primarily on click-chemistry-based protein labeling and biotin-streptavidin enrichment, but these techniques have inherent limitations. Enrichment of intracellular proteins using a totally synthetic host-guest complex is described, overcoming the problem associated with the classical approach. We achieve this by affinity-based protein labeling with a target-specific probe molecule conjugated to a high-affinity guest (suberanilohydroxamic acid-ammonium-adamantane; SAHA-Ad) and then enriching the labeled species using a cucurbit[7]uril bead. This method shows high specificity for labeled molecules in a MDA-MB-231 breast cancer cell lysate. Moreover, this method shows promise for labeling proteins in live cells.

Conventional immunoassays rely on antibodies that provide high affinity, specificity, and selectivity against a target analyte. However, the use of antibodies for the detection of small-sized, nonimmunogenic targets, such as pharmaceuticals and environmental contaminants, presents a number of challenges. Recent advances in protein engineering have led to the emergence of antibody mimetics that offer the high affinity and specificity associated with antibodies, but with reduced batch-to-batch variability, high stability, and in vitro selection to ensure rapid discovery of binders against a wide range of targets. In this work we explore the potential of Affimers, a recent example of antibody mimetics, as suitable bioreceptors for the detection of small organic target compounds, here methylene blue. Target immobilization for Affimer characterization was achieved using long-chained alkanethiol linkers coupled with oligoethylene glycol (LCAT–OEG). Using quartz crystal microbalance with dissipation monitoring (QCM-D), we determine the affinity constant, KD, of the methylene blue Affimer to be comparable to that of antibodies. Further, we demonstrate the high selectivity of Affimers for its target in complex matrixes, here a limnetic sample. Finally, we demonstrate an Affimer-based competition assay, illustrating the potential of Affimers as bioreceptors in immunoassays for the detection of small-sized, nonimmunogenic compounds.

Virtual screening against a pCDK2/cyclin A crystal structure led to the identification of a potent and novel CDK2 inhibitor, which exhibited an unusual mode of interaction with the kinase binding motif. With the aid of X-ray crystallography and modelling, a medicinal chemistry strategy was implemented to probe the interactions seen in the crystal structure and to establish SAR. A fragment-based approach was also considered but a different, more conventional, binding mode was observed. Compound selectivity against GSK-3beta was improved using a rational design strategy, with crystallographic verification of the CDK2 binding mode.

The fluorescent nucleoside 2-pyrimidinone-1-β-d-riboside (4HC) has been incorporated into oligoribonucleotides using standard cyanoethyl phosphoramidite methods. This base provides a useful probe for the exocyclic amino function in cytidine. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUGUCUCGAGC as the substrate and GGCUCGA[4HC]UGAUGAGGCGC as a modified ribozyme resulted in a cleavage rate 17.5-fold slower than the unmodified analogue. The strand GGCUCGACUGA[4HC]GAGGCGC represents an oligoribonucleotide in which a fluorescent base is introduced into a site non-essential for ribozyme function but is centrally located in the ribozyme's core of conserved nucleotides, thus providing a possible physical probe for ribozyme cleavage.

A reliable preparation of S 4 -cyanoethyl-4-thiouridine and its incorporation into oligoribonucleotides is reported. Deprotection of oligoribonucleotides with DBU in acetonitrile followed by methanolic ammonia allows the use of standard N-benzoyl and N-isobutyryl protected phosphoramidites. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUG[ 4S U]CUCGAGC as the modified substrate and GGCUCGACUGAUGAGGCGC as the ribozyme resulted in a halving of the cleavage rate when compared to the unmodified substrate, which is consistent with the proposal that the A 9 -U 17 base pair plays a key role in the active structure.

78 kDa glucose-regulated protein (Grp78) is a heat shock protein (HSP) involved in protein folding that plays a role in cancer cell proliferation. Binding of adenosine-derived inhibitors to Grp78 was characterized by surface plasmon resonance and isothermal titration calorimetry. The most potent compounds were 13 (VER-155008) with K(D) = 80 nM and 14 with K(D) = 60 nM. X-ray crystal structures of Grp78 bound to ATP, ADPnP, and adenosine derivative 10 revealed differences in the binding site between Grp78 and homologous proteins.

A reliable preparation of S 4 -cyanoethyl-4-thiouridine and its incorporation into oligoribonucleotides is reported. Deprotection of oligoribonucleotides with DBU in acetonitrile followed by methanolic ammonia allows the use of standard N-benzoyl and N-isobutyryl protected phosphoramidites. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUG[ 4S U]CUCGAGC as the modified substrate and GGCUCGACUGAUGAGGCGC as the ribozyme resulted in a halving of the cleavage rate when compared to the unmodified substrate, which is consistent with the proposal that the A 9 -U 17 base pair plays a key role in the active structure.

The fluorescent nucleoside 2-pyrimidinone-1-β-d-riboside (4HC) has been incorporated into oligoribonucleotides using standard cyanoethyl phosphoramidite methods. This base provides a useful probe for the exocyclic amino function in cytidine. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUGUCUCGAGC as the substrate and GGCUCGA[4HC]UGAUGAGGCGC as a modified ribozyme resulted in a cleavage rate 17.5-fold slower than the unmodified analogue. The strand GGCUCGACUGA[4HC]GAGGCGC represents an oligoribonucleotide in which a fluorescent base is introduced into a site non-essential for ribozyme function but is centrally located in the ribozyme's core of conserved nucleotides, thus providing a possible physical probe for ribozyme cleavage.

The design and synthesis of novel adenosine-derived inhibitors of HSP70, guided by modeling and X-ray crystallographic structures of these compounds in complex with HSC70/BAG-1, is described. Examples exhibited submicromolar affinity for HSP70, were highly selective over HSP90, and some displayed potency against HCT116 cells. Exposure of compound 12 to HCT116 cells caused significant reduction in cellular levels of Raf-1 and Her2 at concentrations similar to that which caused cell growth arrest.

Publisher Summary This chapter discusses the methods used for conventional and time-resolved crystallographic analyses of the hammerhead ribozyme. In the case of the hammerhead ribozyme sequence, the catalytic turnover rate in the crystal is approximately 0.4 molecule/minute when crystals grown at pH 5–6 are activated with the addition of a mother liquor solution buffered at pH 8.5 and containing 50–100 mM divalent metal ion. The time it takes for a fairly complex substrate to diffuse into a crystal of isocitrate dehydrogenase measuring 0.5 mm in each dimension and to saturate the enzyme's active sites is approximately 10 seconds when measured directly by video absorbance spectroscopy. A hammerhead ribozyme cleavage reaction in the crystal can be initiated by removing a crystal from the drop in which it has grown, using a small rayon loop mounted on a wire. The crystal is then immediately immersed into an artificial mother liquor solution containing divalent metal ions at a higher pH. The relatively slow reaction rate of the hammerhead ribozyme allows to use this very simple method of freeze trapping. Depending on the turnover rate of other ribozymes whose reactions might be examined in the crystal, it may be necessary to employ a flow cell to deliver a carefully timed pulse of substrate or divalent metal ion cofactor or even to use a photochemically activatable “caged” substrate precursor to initiate the reaction rapidly throughout the crystal lattice.

The crystal structure of an unmodified hammerhead RNA in the absence of divalent metal ions has been solved, and it was shown that this ribozyme can cleave itself in the crystal when divalent metal ions are added. This biologically active RNA fold is the same as that found previously for two modified hammerhead ribozymes. Addition of divalent cations at low pH makes it possible to capture the uncleaved RNA in metal-bound form. A conformational intermediate, having an additional Mg(II) bound to the cleavage-site phosphate, was captured by freeze-trapping the RNA at an active pH prior to cleavage. The most significant conformational changes were limited to the active site of the ribozyme, and the changed conformation requires only small additional movements to reach a proposed transition-state.

A screening of a range of common laboratory antibiotics for inhibition of the hammerhead ribozyme has shown that in addition to certain aminoglycosides (most notably neomycin B) the tetracyclines are also effective inhibitors, with chlorotetracycline being more effective than tetracycline. Inhibition by chlorotetracycline is not as strong as that by neomycin B but is more complicated, with at least two binding sites apparent. As with hammerhead inhibition by neomycin B, chlorotetracycline inhibition can be overcome by raising the concentration of the Mg2+ ion cofactor. We find that around six Mg2+ ions will displace neomycin B, compared with twelve for chlorotetracycline. Inhibition observed in the presence of mixtures of neomycin B and chlorotetracycline is consistent with separate binding sites on the hammerhead for these two classses of antibiotic. Under certain conditions of the mixing order and low concentration of chlorotetracycline, enhancement of single-turnover hammerhead cleavage by up to 20% is observed, with higher concentrations of antibiotic being inhibitory. We have also found that the presence of 2.5% (v/v) DMSO causes a 30% enhancement of the single-turnover cleavage. These results thus extend the range of known inhibitors of hammerhead cleavage, and also demonstrate how the cleavage can be accelerated.

We report details of the synthesis and characterization of oligoribonucleotides containing 4-thiouridine or 2-pyrimidinone ribonucleoside (4HC). We have used these probes to examine the roles of the conserved pyrimidines in the central core of the hammerhead ribozyme. The effects on catalysis of singly-substituted hammerhead ribozyme and substrate strands were quantified in multiple-turnover reactions. Various effects were observed on kcat. and Km, with up to a 7-fold decrease and a 3-fold increase respectively. For substitutions with 4HC at positions 3 or 17, catalytic activity in single turnover reactions can be increased up to 8-fold equivalent to 40% of wild-type activity, by increasing the concentration of the Mg2+ cofactor, implying that these substitutions had a deleterious effect on Mg2+ binding. Calculations of the change in the apparent free energy of binding for variants at positions 3, 4 or 17 are each consistent with deletion of a single hydrogen-bond to an uncharged group in the ribozyme. The cytidine 5′ to the scissile phosphate had not previously been thought to play a direct role in catalysis, however, removal of the exocyclic amino group decreased kcat. 4-fold. Recently, the crystal structures of a hammerhead ribozyme bound to either a non-cleavable 2′-deoxy substrate strand or a ribo-substrate strand have been reported. The kinetic properties of the variants described here are consistent with several key interactions seen in the crystals, in particular they provide experimental support for the assignment of the proposed catalytically active magnesium ion-binding site.

THE RNA bacteriophage MS2 is a convenient model system for the study of protein–RNA interactions. The MS2 coat protein achieves control of two distinct processes—sequence-specific RNA encapsidation and repression of replicase translation—by binding to an RNA stem–loop structure of 19 nucleotides containing the initiation codon of the replicase gene. The binding of a coat protein dimer to this hairpin shuts off synthesis of the viral replicase1, switching the viral replication cycle to virion assembly rather than continued replication. The operator fragment alone can trigger self-assembly of the phage capsid at low protein concentrations and a complex of about 90 RNA operator fragments per protein capsid has been described2. We report here the crystal structure at 3.0 A resolution of a complex between recombinant MS2 cap-sids and the 19-nucleotide RNA fragment. It is the first example of a structure at this resolution for a sequence-specific protein-RNA complex apart from the transfer RNA synthetase complexes3–5. The structure shows sequence-specific interactions between conserved residues on the protein and RNA bases essential for binding.

The role of the 70 kDa heat shock protein isoforms (Hsc70 and Hsp70) in cancer development and progression through their ability to inhibit apoptosis and via their role as Hsp90 co-chaperones has been well documented. Dual targeting of Hsc70 and Hsp70 with siRNA has previously been demonstrated to induce proteasome-dependent degradation of Hsp90 client proteins and extensive tumor specific apoptosis as well as the potentiation of tumor cell apoptosis following pharmacological Hsp90 inhibition. The design and synthesis of novel adenosine-derived inhibitors of Hsp70, guided by modelling and X-ray crystallographic structures of these compounds in complex with Hsc70/BAG-1, has been described.1 These were the first inhibitors described to target the ATPase binding domain of this family of chaperones. Many of these compounds exhibited submicromolar affinity for Hsp70, were highly selective over Hsp90, and displayed in vitro activity against a variety of human tumor cell lines. We further describe the in vitro mode of action of one of the most potent analogues, VER-155008 in HCT116, HT29, BT474 and MDA-MB-468 carcinoma cell lines. Cell proliferation, cell cycle, cell apoptosis and caspase 3/7 activity was determined for VER-155008 in the absence or presence of small molecule Hsp90 inhibitors. VER-155008 inhibited the proliferation of human breast and colon cancer cell lines with GI50s in the range 5.3 to 14.4 M, and induced Hsp90 client protein degradation in both HCT116 and BT474 cells. As a single agent, VER-155008 induced caspase-3/7 dependent apoptosis in BT474 cells and non-caspase dependent cell death in HCT116 and HT29 cells. VER-155008 potentiated the apoptotic potential of the small molecule Hsp90 inhibitors VER-821602 and 17-AAG in HCT116 but not HT29 or MDA-MB-468 cells. In vivo, VER-155008 demonstrated rapid metabolism and clearance, along with tumor levels below the predicted pharmacologically active level. These data suggest that as a single agent, small molecule inhibitors of Hsc70/Hsp70 phenotypically mimic the cellular mode of action of a small molecule Hsp90 inhibitor and can potentiate the apoptotic potential of a small molecule Hsp90 inhibitor in certain cell lines. The factors determining whether or not cells apoptose in response to Hsp90 inhibition or the combination of Hsp90 plus Hsc70/Hsp70 inhibition remain to be determined. Citation Information: Mol Cancer Ther 2009;8(12 Suppl):A212.