Search

Retroviral transformation has been associated with pro-proliferative oncogenic signaling in human cells. The current study demonstrates that transduction of human breast carcinoma cells (MDA-MB231) with LXSN and QCXIP retroviral vectors causes significant increases in growth rate, clonogenic fraction, and aldehyde dehydrogenase-1 positive cells (ALDH1+), which is associated with increased steady-state levels of cancer stem cell populations. Furthermore, this retroviral-induced enhancement of cancer cell growth in vitro was also accompanied by a significant increase in xenograft tumor growth rate in vivo. The retroviral induced increases in cancer cell growth rate were partially inhibited by treatment with 100 U/ml polyethylene glycol-conjugated-(PEG)-superoxide dismutase and/or PEG-catalase. These results show that retroviral infection of MDA-MB231 human breast cancer cells is capable of enhancing cell proliferation and cancer stem cell populations as well as suggesting that modulation of reactive oxygen species-induced pro-survival signaling pathways may be involved in these effects.

Unlabelled: Significant evidence implicates α3β1 integrin in promoting breast cancer tumorigenesis and metastasis-associated cell behaviors in vitro and in vivo. However, the extent to which α3β1 is actually required for breast cancer metastasis remains to be determined. We used RNA interference to silence α3 integrin expression by approximately 70% in 4T1 murine mammary carcinoma cells, a model of aggressive, metastatic breast cancer. Loss of α3 integrin reduced adhesion, spreading, and proliferation on laminin isoforms, and modestly reduced the growth of orthotopically implanted cells. However, spontaneous metastasis to lung was strikingly curtailed. Experimental lung colonization after tail vein injection revealed a similar loss of metastatic capacity for the α3-silenced (α3si) cells, suggesting that critical, α3-dependent events at the metastatic site could account for much of α3β1's contribution to metastasis in this model. Reexpressing α3 in the α3si cells reversed the loss of metastatic capacity, and silencing another target, the small GTPase RhoC, had no effect, supporting the specificity of the effect of silencing α3. Parental, α3si, and α3-rescued cells, all secreted abundant laminin α5 (LAMA5), an α3β1 integrin ligand, suggesting that loss of α3 integrin might disrupt an autocrine loop that could function to sustain metastatic growth. Analysis of human breast cancer cases revealed reduced survival in cases where α3 integrin and LAMA5 are both overexpressed., Implications: α3 integrin or downstream effectors may be potential therapeutic targets in disseminated breast cancers, especially when laminin α5 or other α3 integrin ligands are also over-expressed., (©2013 AACR.)

Background: Cucurbitacin B, an oxygenated tetracyclic triterpenoid compound extracted from the Thai medicinal plant Trichosanthes cucumerina L., has been reported to have several biological activities including anti-inflammatory, antimicrobial and anticancer. Cucurbitacin B is great of interest because of its biological activity. This agent inhibits growth of various types of human cancer cells lines., Methods: In this study, we explored the novel molecular response of cucurbitacin B in human breast cancer cells, MCF-7 and MDA-MB-231. The growth inhibitory effect of cucurbitacin B on breast cancer cells was assessed by MTT assay. The effects of cucurbitacin B on microtubules morphological structure and tubulin polymerization were analyzed using immunofluorescence technique and tubulin polymerization assay kit, respectively. Proteomic analysis was used to identify the target-specific proteins that involved in cucurbitacin B treatment. Some of the differentially expressed genes and protein products were validated by real-time RT-PCR and western blot analysis. Cell cycle distributions and apoptosis were investigated using flow cytometry., Results: Cucurbitacin B exhibited strong antiproliferative effects against breast cancer cells in a dose-dependent manner. We show that cucurbitacin B prominently alters the cytoskeletal network of breast cancer cells, inducing rapid morphologic changes and improper polymerization of the microtubule network. Moreover, the results of 2D-PAGE, real-time RT-PCR, and western blot analysis revealed that the expression of nucleophosmin/B23 and c-Myc decreased markedly after cucurbitacin B treatment. Immunofluorescence microscopy showed that cucurbitacin B induced translocation of nucleophosmin/B23 from the nucleolus to nucleoplasm. Treatment with cucurbitacin B resulted in cell cycle arrest at G2/M phase and the enhancement of apoptosis., Conclusions: Our findings suggest that cucurbitacin B may inhibit the proliferation of human breast cancer cells through disruption of the microtubule network and down-regulation of c-Myc and nucleophosmin/B23 as well as the perturbation in nucleophosmin/B23 trafficking from the nucleolus to nucleoplasm, resulting in G2/M arrest.

A growing body of evidence indicates that G protein-coupled receptors (GPCRs) are involved in breast tumor progression and that targeting GPCRs may be a novel adjuvant strategy in cancer treatment. However, due to the redundant role of multiple GPCRs in tumor development, it may be necessary to target a common signaling component downstream of these receptors to achieve maximum efficacy. GPCRs transmit signals through heterotrimeric G proteins composed of Gα and Gβγ subunits. Here we evaluated the role of Gβγ in breast tumor growth and metastasis both in vitro and in vivo. Our data show that blocking Gβγ signaling with Gα(t) or small molecule inhibitors blocked serum-induced breast tumor cell proliferation as well as tumor cell migration induced by various GPCRs in vitro. Moreover, induced expression of Gα(t) in MDA-MB-231 cells inhibited primary tumor formation and retarded growth of existing breast tumors in nude mice. Blocking Gβγ signaling also dramatically reduced the incidence of spontaneous lung metastasis from primary tumors and decreased tumor formation in the experimental lung metastasis model. Additional studies indicate that Gβγ signaling may also play a role in the generation of a tumor microenvironment permissive for tumor progression, because the inhibition of Gβγ signaling attenuated leukocyte infiltration and angiogenesis in primary breast tumors. Taken together, our data demonstrate a critical role of Gβγ signaling in promoting breast tumor growth and metastasis and suggest that targeting Gβγ may represent a novel therapeutic approach for breast cancer.

The TFAP2C transcription factor is involved in mammary development, differentiation, and oncogenesis. Previous studies established a role for TFAP2C in the regulation of ESR1 (ERalpha) and ERBB2 (Her2) in breast carcinomas. However, the role of TFAP2C in different breast cancer phenotypes has not been examined in detail. To develop a more complete characterization of TFAP2C target genes, ChIP-seq with anti-TFAP2C antibody and expression arrays with TFAP2C knock down were analyzed in MCF-7 breast carcinoma cells. Genomic sequences common to the ChIP-seq data set defined the consensus sequence for TFAP2C chromatin binding as the nine base sequence SCCTSRGGS (S = G/C, r = A/G), which closely matches the previously defined optimal in vitro binding site. Comparing expression arrays before and after knock down of TFAP2C with ChIP-seq data demonstrated a conservative estimate that 8% of genes altered by TFAP2C expression are primary target genes and includes genes that are both induced and repressed by TFAP2C. A set of 447 primary target genes of TFAP2C was identified, which included ESR1 (ERalpha), FREM2, RET, FOXA1, WWOX, GREB1, MYC, and members of the retinoic acid response pathway. The identification of ESR1, WWOX, GREB1, and FOXA1 as primary targets confirmed the role of TFAP2C in hormone response. TFAP2C plays a critical role in gene regulation in hormone responsive breast cancer and its target genes are different than for the Her2 breast cancer phenotype.

Increased expression of heparanase stimulates the progression of various human cancers, including breast cancer. Therefore, a deeper understanding of the mechanisms involved in regulating heparanase is critical in developing effective treatments for heparanase-overexpressing cancers. In this study, we investigated the potential use of extracellular superoxide dismutase (EcSOD) to enhance the inhibitory effects of heparin/low molecular weight heparin (LMWH) in breast cancer cells. EcSOD binds to cell surfaces and the extracellular matrix through heparin-binding domain (HBD). Deleting this HBD rendered the protein a more potent inhibitor of breast cancer growth, survival, and invasion. Among the treatment combinations examined, EcSODDeltaHBD plus LMWH provided the best tumor suppressive effects in inhibiting breast cancer growth and invasion in vitro. We have further shown that overexpression of EcSOD decreased accumulation of vascular endothelial growth factor in the culture medium and increased the level of intact cell surface-associated heparan sulfate, thus implicating inhibition of heparanase expression as a potential mechanism. Overexpression of EcSOD inhibited steady-state heparanase mRNA levels by >50% as determined by quantitative reverse transcription-PCR. Moreover, heparanase promoter activation was suppressed by EcSOD as indicated by a luciferase reporter assay. These findings reveal a previously unrecognized molecular pathway showing that regulation of heparanase transcription can be mediated by oxidative stress. Our study implies that overexpression of EcSOD is a promising strategy to enhance the efficacy of heparin/LMWH by inhibiting heparanase as a novel treatment for breast cancer.

Many breast cancer cells typically exhibit lower expression of manganese superoxide dismutase (MnSOD) compared to the normal cells from which they arise. This decrease can often be attributed to a defect in the transcription of SOD2, the gene encoding MnSOD; however, the mechanism responsible for this change remains unclear. Here, we describe how altered histone modifications and a repressive chromatin structure constitute an epigenetic process to down regulate SOD2 in human breast carcinoma cell lines. Utilizing chromatin immunoprecipitation (ChIP) we observed decreased levels of dimethyl H3K4 and acetylated H3K9 at key regulatory elements of the SOD2 gene. Consistent with these results, we show that loss of these histone modifications creates a repressive chromatin structure at SOD2. Transcription factor ChIP experiments revealed that this repressive chromatin structure influences the binding of SP-1, AP-1, and NFkappaB to SOD2 regulatory cis-elements in vivo. Lastly, we show that treatment with the histone deacetylase inhibitors trichostatin A and sodium butyrate can reactivate SOD2 expression in breast cancer cell lines. Taken together, these results indicate that epigenetic silencing of SOD2 could be facilitated by changes in histone modifications and represent one mechanism leading to the altered expression of MnSOD observed in many breast cancers.

Malignant breast cancer cells often exhibit lower expression and activity of manganese superoxide dismutase (MnSOD) than their normal cell counterparts; however, the mechanism(s) responsible for this change remains unclear. We examined whether SOD2, the gene encoding MnSOD, was epigenetically repressed in breast cancer cell lines by DNA methylation and histone acetylation. RT-PCR analysis of SOD2 mRNA showed the nontumorigenic breast epithelial cell line MCF-10A to have two to three fold higher expression levels than either UACC-893 or MDA-MB-435 breast carcinoma cells. Analysis of a region in the SOD2 promoter by sodium bisulfite genomic sequencing demonstrated significantly higher levels of CpG methylation in both human breast carcinoma cell lines assessed than in MCF-10A cells. CREB binding in vitro to a cognate site derived from this region was repressed by DNA methylation, and CREB binding to the 5' regulatory region of the SOD2 gene in vivo as determined by ChIP was significantly lower in breast carcinoma cells than in MCF-10A. Increased cytosine methylation was also accompanied by a significant decrease in the level of acetylated histones in the same region of the SOD2 promoter. Finally, a causal link between cytosine methylation and transcriptional repression was established by increasing MnSOD mRNA, protein and activity in breast carcinoma cells using the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine. These findings indicate that epigenetic silencing of SOD2 constitutes one mechanism leading to the decreased expression of MnSOD observed in many breast cancers.

Introduction: Noninvasive analysis of therapeutic transgene expression is important for the development of clinical translational gene therapy strategies against cancer. To image p53 and MnSOD gene transfer noninvasively, we used radiologically detectable dual-expressing adenoviral vectors with the human sodium iodide symporter (hNIS) as the reporter gene., Methods: Dual-expressing adenoviral vectors were constructed with hNIS cloned into E3 region and therapeutic genes, either MnSOD or p53, recombined into the E1 region. Steady-state mRNA levels of hNIS were evaluated by real-time polymerase chain reaction. hNIS function was determined by iodide uptake assay and MnSOD, and p53 protein levels were assessed by Western blots., Results: 125I- accumulation resulting from hNIS expression in both Ad-p53-hNIS- and Ad-MnSOD-hNIS-infected MDA-MB-435 cells could be visualized clearly on phosphorimaging autoradiograph. Iodide accumulation increased with increasing adenovirus titer, and there was a linear correlation between iodide uptake and dose. p53 and MnSOD protein levels increased as a function of adenovirus titer, and there was a direct positive correlation between p53 and MnSOD expression and hNIS function. P53 and MnSOD overexpression inhibited cell growth in the dual-expressing adenoviral vector-infected cells., Conclusions: Radiological detection of hNIS derived from dual-expressing adenoviral vectors is a highly effective method to monitor therapeutic gene transfer and expression in a noninvasive manner.

It has been hypothesized that cancer cells increase glucose metabolism to protect against metabolic fluxes of hydroperoxides via glutathione-dependent peroxidases. 2-Deoxy-D-glucose, inhibits glucose metabolism and has been shown to cause cytotoxicity in cancer cells that is partially mediated by disruptions in thiol metabolism. In the current study, human breast cancer cells were continuously treated (24 hours) with 2-deoxy-D-glucose, and total glutathione content as well as the expression of the first enzyme in the glutathione synthetic pathway [glutamate cysteine ligase (GCL)] were found to be induced 2.0-fold. Inhibiting GCL activity during 2-deoxy-D-glucose exposure using l-buthionine-[S,R]-sulfoximine (BSO) significantly enhanced the cytotoxic effects of 2-deoxy-D-glucose and caused increases in endpoints indicative of oxidative stress, including % oxidized glutathione and steady-state levels of pro-oxidants as assayed using an oxidation-sensitive fluorescent probe. These results show that treatment of human breast cancer cells with 2-deoxy-d-glucose causes metabolic oxidative stress that is accompanied by increases in steady-state levels of GCL mRNA, GCL activity, and glutathione content. Furthermore, inhibition of 2-deoxy-D-glucose-mediated induction of GCL activity with BSO increases endpoints indicative of oxidative stress and sensitizes cancer cells to 2-deoxy-D-glucose-induced cytotoxicity. These results support the hypothesis that drug combinations capable of inhibiting both glucose and hydroperoxide metabolism may provide an effective biochemical strategy for sensitizing human cancer cells to metabolic oxidative stress.

Introduction: Desmocollin 3 (DSC3) is a member of the cadherin superfamily of calcium-dependent cell adhesion molecules and a principle component of desmosomes. Desmosomal proteins such as DSC3 are integral to the maintenance of tissue architecture and the loss of these components leads to a lack of adhesion and a gain of cellular mobility. DSC3 expression is down-regulated in breast cancer cell lines and primary breast tumors; however, the loss of DSC3 is not due to gene deletion or gross rearrangement of the gene. In this study, we examined the prevalence of epigenetic silencing of DSC3 gene expression in primary breast tumor specimens., Methods: We used bisulfite genomic sequencing to analyze the methylation state of the DSC3 promoter region from 32 primary breast tumor specimens. We also used a quantitative real-time RT-PCR approach, and analyzed all breast tumor specimens for DSC3 expression. Finally, in addition to bisulfite sequencing and RT-PCR, we used an in vivo nuclease accessibility assay to determine the chromatin architecture of the CpG island region from DSC3-negative breast cancer cells lines., Results: DSC3 expression was downregulated in 23 of 32 (72%) breast cancer specimens comprising: 22 invasive ductal carcinomas, 7 invasive lobular breast carcinomas, 2 invasive ductal carcinomas that metastasized to the lymph node, and a mucoid ductal carcinoma. Of the 23 specimens showing a loss of DSC3 expression, 13 (56%) were associated with cytosine hypermethylation of the promoter region. Furthermore, DSC3 expression is limited to cells of epithelial origin and its expression of mRNA and protein is lost in a high proportion of breast tumor cell lines (79%). Lastly, DNA hypermethylation of the DSC3 promoter is highly correlated with a closed chromatin structure., Conclusion: These results indicate that the loss of DSC3 expression is a common event in primary breast tumor specimens, and that DSC3 gene silencing in breast tumors is frequently linked to aberrant cytosine methylation and concomitant changes in chromatin structure.

The maspin gene functions as a tumor suppressor in human breasts, and its expression is frequently lost during breast cancer progression. In vitro models of human breast cancer indicate that the loss of maspin expression is closely linked to aberrant methylation of the maspin promoter. We conducted a study on 30 archival ductal carcinoma in situ (DCIS) specimens to determine if aberrant methylation of the maspin promoter occurred in vivo, and whether it occurred early in breast cancer evolution. Healthy tissue obtained from reduction mammoplasty was used as normal control. Results from immunohistochemical analysis indicate that maspin expression is lost in a substantial fraction of DCIS specimens (57%). Bisulfite sequencing of DNA isolated from laser capture-microdissected normal and neoplastic ducts showed that loss of maspin expression was often, but not always, linked to aberrant methylation of the maspin promoter, suggesting that other mechanisms, in addition to aberrant methylation, participate and/or cooperate to silence maspin gene expression. Taken together, these results indicate that aberrant methylation of the maspin promoter is an early event in human breast cancer., (Copyright 2004 Neoplasia Press, Inc.)

p300/CBP-associated factor (PCAF) is a coactivator of the tumor suppressor, p53. PCAF participates in p53's transactivation of target genes through acetylation of both bound p53 and histones within p53 target promoters. Using microarrays, we discovered that PCAF itself is induced by p53 in a panel of breast tumor cell lines. Two p53 mutant breast tumor cell lines, BT-549 and UACC-1179, were chosen for further study of PCAF induction by wild-type p53. PCAF induction following adenoviral transduction of p53 expression was confirmed with real-time polymerase chain reaction in a time course experiment. Chromatin immunoprecipitation experiments then showed that PCAF induction was associated with increased p53 binding to the PCAF promoter, which contains p53 consensus-binding sites. PCAF induction by p53 activity was further demonstrated in wild-type p53 MCF10A cells when PCAF expression was induced following activation of endogenous wild-type p53 with doxorubicin in a dose- and time-dependent manner. Furthermore, the doxorubicin-induced increase in PCAF expression was blocked by pretreatment of the MCF10A cells with siRNA (small interfering RNA) targeted against p53 mRNA. Taken together, the results show that PCAF expression can be induced by wild-type p53.

Unlabelled: In this study we investigated the feasibility of using radionuclide accumulation mediated by the human sodium iodide symporter (hNIS) gene in conjunction with various imaging modalities as a reporter system to noninvasively monitor the expression of transgenes delivered for gene therapy., Methods: NIS-expressing adenovirus (Ad-hNIS) was delivered in vitro to MB-435 breast carcinoma cells. NIS-mediated accumulation of (125)I(-), (99m)TcO(4)(-), and (76)Br(-) by the cells was visualized using autoradiography, gamma-camera scintigraphy, and PET imaging, respectively., Results: For all imaging modalities, signal intensity generated by the cells correlated linearly both with the amount of Ad-hNIS and with the activity of radionuclide added to the cells., Conclusion: hNIS-mediated cellular accumulation of radionuclide was clearly visualized by all 3 imaging modalities tested. This preliminary study demonstrates the feasibility of using hNIS for monitoring the location and magnitude of expression of genes delivered during gene therapy.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

p53 is an important transcriptional regulator that is frequently mutated in cancer. Gene-profiling experiments of breast cancer cells infected with wt p53 revealed both MASPIN and desmocollin 3 (DSC3) to be p53-target genes, even though both genes are silenced in association with aberrant cytosine methylation of their promoters. Despite the transcriptional repression of these genes by aberrant DNA methylation, restoration of p53 resulted in the partial reactivation of both genes. This reactivation is a result of wt p53 binding to its consensus DNA-binding sites within the MASPIN and DSC3 promoters, stimulating histone acetylation, and enhancing chromatin accessibility of their promoters. Interestingly, wt p53 alone did not affect the methylation status of either promoter, suggesting that p53 itself can partially overcome the repressive barrier of DNA methylation. Pharmacologic inhibition of DNA methylation with 5-aza-2'-deoxycytidine in combination with restoration of wt p53 status resulted in a synergistic reactivation of these genes to near-normal levels. These results suggest that cancer treatments that target both genetic and epigenetic facets of gene regulation may be a useful strategy towards the therapeutic transcriptional reprogramming of cancer cells.

ErbB-3 (HER3) is a member of the epidermal growth factor receptor family. Increasing evidence suggests that elevated expression of ErbB-3 is important for malignancy. In this study, we found that elevated levels of ErbB-3 expression did not occur in the absence of AP-2gamma in a panel of human mammary epithelial and fibroblasts cell lines. In contrast, there was no association between the expression of AP-2alpha or AP-2beta and the level of ErbB-3, or between AP-2alpha and AP-2gamma double positivity and ErbB-3 expression. In co-transfection experiments, exogenous expression of AP-2gamma robustly activated ErbB-3 promoter activity. Moreover, expression of a dominant negative AP-2 protein, AP-2delta (deleted residues 31-117), not only repressed the ErbB-3 promoter activity but also suppressed endogenous ErbB-3 transcription in the ErbB-3 overexpressing cell line MRC-5VA. Overexpression of AP-2A resulted in a decreased proliferation rate and inhibitin of colony formation. Taken together, these data strongly support a role for the AP-2 gene family, in particular, AP-2gamma, in the control of ErbB-3 expression. Interference with the function of transcription factor AP-2 might provide a potential strategy for modulation of the malignant phenotype.