Search

Neurodevelopmental diseases are increasingly recognized to be caused by "de novo" variants with the expanding use of next-generation sequencing. The apparent de novo variants may actually be low-level hereditary parental mosaic variants, which could increase the recurrence risk of disease by >50% and is thought to be an underappreciated cause of neurodevelopmental diseases. Our study aimed to investigate the frequency of parental mosaicism in "de novo" neurodevelopmental diseases. A total of 237 patients (and parents) with neurodevelopmental diseases carrying apparent de novo pathogenic or likely pathogenic variants were recruited consecutively. Deep next-generation sequencing was performed on parental samples to identify parental mosaicism. Fourteen parental disease-causing mosaicism variants (3.0%) in 11 genes were detected with alternate allele frequency (AAF) 0.22%-34%. Three parents showed milder clinical phenotypes than their offspring with relatively high AAF (23.33%, 25%, 34% separately). One recurrent variant was identified prenatally. A review of cohort study on parental mosaicism in neurodevelopmental diseases was performed. Our study highlights that identifying the parental mosaic disease-causing variants especially the low-level mosaicism will contribute to improving the accuracy of genetic counseling and prenatal diagnosis for reproductive risks.

The temperature-induced response of long-span steel bridges can be more significant than the structural responses associated with operational loads or structural damage. These responses depend on the spatio-temporal temperature variation in bridge members, including the effective temperature and temperature difference within members. Bridges are designed to withstand the extreme temperature variations predicted for a given site. Hence, numerous studies have employed statistical analysis techniques to provide critical information for the design and maintenance of bridges during life cycles. However, the correlation between the effective temperature and temperature difference is usually ignored, which can result in inaccurate assessment of the extreme temperatures in members. In this work, the joint probability distribution for the temperature variation in a long-span steel truss arch bridge is investigated based on field monitoring data. The extreme temperature variations are mapped on contours with relevant return periods; the results show that the probability distribution of the effective temperature can be described using the normal distribution; the weighted sum of two lognormal distributions can describe the distribution of temperature difference. Moreover, extreme values of the effective temperature and temperature difference do not occur concurrently. The effective temperature and temperature difference in the structural member directly exposed to solar radiation vary significantly, while the temperature of the shaded member can be assumed uniform, which is mainly affected by air temperature. The study leads to more accurate estimation of the temperature extremes in long-span steel truss arch bridges, which is of great importance for proper design and maintenance of bridges.

To determine the effects of Chinese medicine (CM) involving triple rehabilitation therapy (中医三联康复疗法) on the progression of knee osteoarthritis (KOA). A total of 722 patients recruited from 38 community health service centers located in China from March 2013 to March 2017 were randomly divided into treatment and control groups equally, using a cluster randomization design. Health education combined with CM involving triple rehabilitation therapy for KOA (electro-acupuncture, Chinese medicinal herb fumigating-washing, and traditional exercises) was administered in the treatment group while conventional rehabilitation therapy (physical factor therapy, joint movement training, and muscle strength training) was administered in the control group. Patients with a visual analog scale (VAS) scores ≽4 were treated with dispersible meloxicam tablets (7.5 mg, once daily). The Lequesne index scores, VAS scores, range of motion (ROM), lower limb muscle strength, knee joint circumference, quantitative scores of KOA symptoms, and the short-form 36 item health survey questionnaire (SF-36) scores were measured for each patient at 5 checkpoints (before treatment, at the 2nd week and the 4th week during the 4-week treatment period, at 1 month and 3 months after end of treatment), and adverse reactions were observed also. A total of 696 patients completed the entire process, with 351 in the treatment group and 345 in the control group. At all treatment checkpoints, the treatment group demonstrated better outcomes than the control group with regard to the total Lequesne index scores, effective rate and improvement rate of the total Lequesne index scores, VAS scores, lower limb muscle strength, knee circumference, quantitative scores of KOA symptoms, and SF-36 scores as well (P

The multi-tower suspension bridge (MTSB), which is a considerable choice for the cross-river and even cross-sea bridges, has attracted intensive attentions by researchers in recent years. However, the static and dynamic performance of the MTSB becomes more complicated due to its super long spans and the multiple middle towers. The wind-induced vibration becomes the critical issue when constructs the MTSBs due to their low rigidity. In this work, a finite element model (FEM) of a MTSB with four towers and three spans is presented. Several major parameters such as the stiffness of the main girder and the middle towers, the sag-to-span ratios, the self-excited forces, and the spectral model of turbulence are selected to investigate their effects on buffeting performance of the MTSB. Results show that the rigid main girder can decrease the buffeting displacements in lateral and torsional directions, while the vertical buffeting displacement significantly decreases with the increasing stiffness of middle towers. In addition, the buffeting displacements of the main girder increase with the decreasing sag-to-span ratio. Besides, it can be concluded that the self-excited forces should be considered and the turbulent power spectrum should be carefully chosen in analyzing buffeting responses of the MTSB.

There is increasing awareness that oxidative stress may be implicated in the pathophysiology of autism spectrum disorder (ASD). Here we aimed to investigate blood oxidative stress marker profile in ASD children by a meta-analysis. Two independent investigators systematically searched Web of Science, PubMed, and Cochrane Library and extracted data from 87 studies with 4928 ASD children and 4181 healthy control (HC) children. The meta-analysis showed that blood concentrations of oxidative glutathione (GSSG), malondialdehyde, homocysteine, S-adenosylhomocysteine, nitric oxide, and copper were higher in children with ASD than that of HC children. In contrast, blood reduced glutathione (GSH), total glutathione (tGSH), GSH/GSSG, tGSH/GSSG, methionine, cysteine, vitamin B9, vitamin D, vitamin B12, vitamin E, S-adenosylmethionine/S-adenosylhomocysteine, and calcium concentrations were significantly reduced in children with ASD relative to HC children. However, there were no significance differences between ASD children and HC children for the other 17 potential markers. Heterogeneities among studies were found for most markers, and meta-regressions indicated that age and publication year may influence the meta-analysis results. These results therefore clarified blood oxidative stress profile in children with ASD, strengthening clinical evidence of increased oxidative stress implicating in pathogenesis of ASD. Additionally, given the consistent and large effective size, glutathione metabolism biomarkers have the potential to inform early diagnosis of ASD.

To evaluate the prediction performance of deep convolutional neural network (DCNN) based on ultrasound (US) images for the assessment of breast cancer molecular subtypes. A dataset of 4828 US images from 1275 patients with primary breast cancer were used as the training samples. DCNN models were constructed primarily to predict the four St. Gallen molecular subtypes and secondarily to identify luminal disease from non-luminal disease based on the ground truth from immunohistochemical of whole tumor surgical specimen. US images from two other institutions were retained as independent test sets to validate the system. The models’ performance was analyzed using per-class accuracy, positive predictive value (PPV), and Matthews correlation coefficient (MCC). The model achieved good performance in identifying the four breast cancer molecular subtypes in the two test sets, with accuracy ranging from 80.07% (95% CI, 76.49–83.23%) to 97.02% (95% CI, 95.22–98.16%) and 87.94% (95% CI, 85.08–90.31%) to 98.83% (95% CI, 97.60–99.43) for the two test cohorts for each sub-category, respectively. In terms of 4-class weighted average MCC, the model achieved 0.59 for test cohort A and 0.79 for test cohort B. Specifically, the DCNN also yielded good diagnostic performance in discriminating luminal disease from non-luminal disease, with a PPV of 93.29% (95% CI, 90.63–95.23%) and 88.21% (95% CI, 85.12–90.73%) for the two test cohorts, respectively. Using pretreatment US images of the breast cancer, deep learning model enables the assessment of molecular subtypes with high diagnostic accuracy. Clinical trial number: ChiCTR1900027676 • Deep convolutional neural network (DCNN) helps clinicians assess tumor features with accuracy. • Multicenter retrospective study shows that DCNN derived from pretreatment ultrasound imagine improves the prediction of breast cancer molecular subtypes. • Management of patients becomes more precise based on the DCNN model.

Damage detection is one of the most important tasks for structural health monitoring of civil infrastructure. Before a damage detection algorithm can be applied, the integrity of the data must be ensured; otherwise results may be misleading or incorrect. Indeed, sensor system malfunction, which results in anomalous data (often called faulty data), is a serious problem, as the sensors usually must operate in extremely harsh environments. Identifying and eliminating anomalies in the data is crucial to ensuring that reliable monitoring results can be achieved. Because of the vast amounts of data typically collected by a structural health monitoring system, manual removal of the anomalous data is prohibitive. Machine learning methods have the potential to automate the process of data anomaly detection. Although supervised methods have been proven to be effective for detecting data anomalies, two unresolved challenges reduce the accuracy of anomaly detection: (1) the class imbalance and (2) incompleteness of anomalous patterns of training dataset. Unsupervised methods have the potential to address these challenges, but improvements are required to deal with vast amounts of monitoring data. In this article, the generative adversarial networks are combined with a widely applied unsupervised method, that is, autoencoders, to improve the performance of existing unsupervised learning methods. In addition, the time-series data are transformed to Gramian Angular Field images so that advanced computer vision methods can be included in the network. Two structural health monitoring datasets from a full-scale bridge, including examples of anomalous data caused by sensor system malfunctions, are utilized to validate the proposed methodology. Results show that the proposed methodology can successfully identify data anomalies with good accuracy and robustness, hence can overcome one of the key difficulties in achieving automated structural health monitoring.

Review question / Objective: At present, many clinical studies have been reported on the treatment of KOA by injecting sinomenine hydrochloride into the knee cavity. However, no systematic evaluation has been published on this issue, and it is not clear whether sinomenine hydrochloride injection is effective and safe in the treatment of KOA.Therefore, it is important to conduct systematic evaluation to obtain relatively convincing conclusions as to whether sinomenine hydrochloride injection can be a good choice as a complementary and alternative drug (CAM) for KOA. Condition being studied: The RCTs are eligible, whether or not the blind method is specifically described. There are no restrictions on languages. Moreover, systemic evaluation, review literature and the full article cannot be obtained will be excluded.

Purpose: The purpose of this study was to prospectively analyze the safety and feasibility of spot scanning carbon ion radiotherapy (CIRT) for patients with localized prostate cancer.Methods: 118 localized prostate cancer patients treated with spot scanning CIRT at Shanghai Proton and Heavy Ion Center (SPHIC) were enrolled in this dose escalated study. The dose was gradually increased from 59.2GyE to 65.6GyE in 16 fractions. The primary endpoint was the acute and late toxicities. Secondary endpoints were biochemical relapse free survival (bRFS), distant metastasis free survival (DMFS), prostate cancer-specific survival (PCSS), and overall survival (OS).Results: The median follow-up time was 30.2 months (4.8-62.7 months). Acute grade 1 and 2 genitourinary (GU) toxicities were 15.3% and 18.6%, while acute grade 1 and 2 gastrointestinal (GI) toxicities were 2.5% and 0%, respectively. Late grade 1 and 2 GU toxicities were 4.2% and 1.7%, respectively. No late GI toxicity were observed. There were no cases of severe acute or late toxicity (≥grade 3). The significant association was not found between the factors and the acute GU toxicities except for CTV volume (p=0.031) on multivariate analysis. The 2-year bRFS, DMFS, PCSS, OS were 100%, 100%, 100% and 98.8%, respectively.Conclusion: The 2 years’ outcomes are encouraging, providing additional and useful information on the feasibility and safety of spot scanning CIRT for prostate cancer. Long term follow-up and prospective multi-institutional data are warranted to reinforce the role of CIRT in the management of localized prostate cancer.Trial registration: Clinicaltrial, NCT02739659. Registered 15 April 2016

Microtubule dynamics is crucial for neuronal function and survival. The disrupted function of microtubule dynamics would lead to neurodegenerative and neurodevelopmental disorders. Tubulin-specific chaperone D (TBCD) is one of five tubulin co-chaperones acted in assembly and disassembly dynamics of microtubule. The biallelic pathogenic variants of TBCD gene were reported to be associated with severe degenerative encephalopathy accompanied with seizures previously. Compound heterozygous variants were identified in three patients from three families. The in silico prediction software and ACMG standards and guidelines proved the pathogenicity of the TBCD pathogenic variants. The clinical features of the three patients presented with mild neurodevelopmental manifestations including autism spectrum disorder (ASD) and occasional generalized tonic-clonic seizures (GTCSs) responding well to antiepileptic drugs. Our research expanded the clinical spectrum of TBCD-related neurodevelopmental disease which contributed to understanding the genotype-phenotype correlations of the disease.

Serviceability performances of the long span bridge during strong winds, including the safety and comfort condition of driving road vehicle on the bridge, have attracted more and more attention in recent years. The dynamic behavior of the riding vehicle is essential for serviceability performance assessment. The vehicle-bridge coupling (VBC) simulation, featured as time-consuming, is traditionally applied, however, cannot meet the requirement for timely decision. Therefore, a monitoring-based approach, with the hybrid combination of in-situ structural health monitoring (SHM) data and dynamic simulation of single vehicle model, is presented in this paper to estimate the vehicle dynamic responses in a more efficient way. A numerical case study of a quarter vehicle model riding on a simply supported beam bridge is presented to validate the proposed approach. The first step is to investigate the feasibility of reproducing structural responses with the data from limited sensors using interpolation methods. Subsequently, dynamic responses of the riding vehicle are estimated using the monitoring-based approach. The influences of random traffic and wind loads are also considered. The estimated vehicle responses generally match VBC-based results, which proves reliability of the monitoring-based approach. Furthermore, the SHM data of a long-span bridge are utilized to investigate the potential usage of the proposed method. In particular, the dynamic responses of a popular light truck on the bridge and rigid road are respectively estimated and compared with each other. Results show that, among all the factors, i.e., bridge vibration, wind loads, and road roughness, the bridge vibration contributes the majority to the vertical vibration of the vehicle. For the lateral and torsional vibration of the vehicle, wind forces and bridge vibration are dominant factors. To summarize, the monitoring-based approach could help to estimate the dynamic responses of the riding vehicle on the bridge with a good reliability, regardless of the operation condition of the bridge, and provide timely and reliable information for serviceability and safety assessment.

To develop and validate an ultrasound elastography radiomics nomogram for preoperative evaluation of the axillary lymph node (ALN) burden in early-stage breast cancer. Data of 303 patients from hospital #1 (training cohort) and 130 cases from hospital #2 (external validation cohort) between Jun 2016 and May 2019 were enrolled. Radiomics features were extracted from shear-wave elastography (SWE) and corresponding B-mode ultrasound (BMUS) images. The minimum redundancy maximum relevance and least absolute shrinkage and selection operator algorithms were used to select ALN status–related features. Proportional odds ordinal logistic regression was performed using the radiomics signature together with clinical data, and an ordinal nomogram was subsequently developed. We evaluated its performance using C-index and calibration. SWE signature, US-reported LN status, and molecular subtype were independent risk factors associated with ALN status. The nomogram based on these variables showed good discrimination in the training (overall C-index: 0.842; 95%CI, 0.773–0.879) and the validation set (overall C-index: 0.822; 95%CI, 0.765–0.838). For discriminating between disease-free axilla (N0) and any axillary metastasis (N + (≥ 1)), it achieved a C-index of 0.845 (95%CI, 0.777–0.914) for the training cohort and 0.817 (95%CI, 0.769–0.865) for the validation cohort. The tool could also discriminate between low (N + (1–2)) and heavy metastatic ALN burden (N + (≥ 3)), with a C-index of 0.827 (95%CI, 0.742–0.913) in the training cohort and 0.810 (95%CI, 0.755–0.864) in the validation cohort. The radiomics model shows favourable predictive ability for ALN staging in patients with early-stage breast cancer, which could provide incremental information for decision-making. • Radiomics analysis helps radiologists to evaluate the axillary lymph node status of breast cancer with accuracy. • This multicentre retrospective study showed that radiomics nomogram based on shear-wave elastography provides incremental information for risk stratification. • Treatment can be given with more precision based on the model.

Congenital disorders of glycosylation (CDGs) are inherited metabolic diseases affecting protein and lipid glycosylation. DDOST-CDG is a rare, newly identified type of CDGs, with only one case reported so far. In this study, we report a Chinese patient with a homozygous pathogenic variant in DDOST (c.1187G>A) and who presented with feeding difficulty, lactose intolerance, facial dysmorphism, failure to thrive, strabismus, high myopia, astigmatism, hypotonia, developmental delay and situs inversus totalis. Serum transferrin isoelectrofocusing demonstrated defective glycosylation in our patient. This finding further identifies DDOST as a genetic cause of CDGs and expands the clinical phenotype of DDOST-CDG.

The long-span bridge, characterized by slenderness and flexibility, is particularly sensitive to wind action. Extreme wind events, including typhoons and hurricanes, will threaten the safet...

The aim of the study was to develop and validate a deep learning radiomic nomogram (DLRN) for preoperatively assessing breast cancer pathological complete response (pCR) after neoadjuvant chemotherapy (NAC) based on the pre- and post-treatment ultrasound.Patients with locally advanced breast cancer (LABC) proved by biopsy who proceeded to undergo preoperative NAC were enrolled from hospital #1 (training cohort, 356 cases) and hospital #2 (independent external validation cohort, 236 cases). Deep learning and handcrafted radiomic features reflecting the phenotypes of the pre-treatment (radiomic signature [RS] 1) and post-treatment tumour (RS2) were extracted. The minimum redundancy maximum relevance algorithm and the least absolute shrinkage and selection operator regression were used for feature selection and RS construction. A DLRN was then developed based on the RSs and independent clinicopathological risk factors. The performance of the model was assessed with regard to calibration, discrimination and clinical usefulness.The DLRN predicted the pCR status with accuracy, yielded an area under the receiver operator characteristic curve of 0.94 (95% confidence interval, 0.91-0.97) in the validation cohort, with good calibration. The DLRN outperformed the clinical model and single RS within both cohorts (P 0.05, as per the DeLong test) and performed better than two experts' prediction of pCR (both P 0.01 for comparison of total accuracy). Besides, prediction within the hormone receptor-positive/human epidermal growth factor receptor 2 (HER2)-negative, HER2+ and triple-negative subgroups also achieved good discrimination performance, with an AUC of 0.90, 0.95 and 0.93, respectively, in the external validation cohort. Decision curve analysis confirmed that the model was clinically useful.A deep learning-based radiomic nomogram had good predictive value for pCR in LABC, which could provide valuable information for individual treatment.

Objective: To analyze the risk factors for testicular atrophy (TA) in children with testicular torsion (TT) following emergent orchiopexy.Methods: Clinical data of patients with TT undergoing orchiopexy were retrospectively reviewed, including age at surgery, affected side, delayed surgery (12–24 h and more than 24 h), echogenicity of testicular parenchyma on ultrasonography (ETPU), testicular blood flow on Color Doppler ultrasonography (CDUS), surgical findings (intraoperative blood supply, the degree of torsion, and surgical approaches), and follow-up. The primary outcome was the rate of TA after orchiopexy. The secondary outcome was the testicular volume loss (TVL) between the affected testis and the contralateral.Results: A total of 113 patients were enrolled in this study with a median age of 11 years. The median follow-up was 21 months. Patients had a median TVL of 51.02% and 44 (38.94%) of them developed severe TA during follow-up. TA was significantly associated with age at surgery (P < 0.0001), delayed surgery (P = 0.0003), ETPU (P = 0.0001), and intraoperative blood supply (P = 0.0005). Multivariate logistic regression analysis showed that school-age children (OR = 0.069, P < 0.001) and puberty (OR = 0.177, P = 0.007) had a decreased risk of TA compared with preschool children, and that heterogeneous ETPU (OR = 14.489, P = 0.0279) and delayed surgery >24 h (OR = 3.921, P = 0.040) increased the risk of TA. Multivariate analysis demonstrated that ETPU (F = 16.349, P < 0.001) and delayed surgery (F = 6.016, P = 0.003) were independent risk factors for TVL.Conclusions: Age at surgery, delayed surgery, and ETPU may play a crucial role in predicting the TA in children with TT following emergent orchiopexy. Moreover, blood flow measured by CDUS could not predict the outcome properly.

Background: Accurate prediction of axillary lymph node (ALN) involvement in early-stage breast cancer is important for determining appropriate axillary treatment and therefore avoiding unnecessary axillary surgery and complications. This study aimed to develop and validate an ultrasound radiomics nomogram for preoperative evaluation of the ALN burden. Methods: Data of 303 patients from Wuhan Tongji Hospital (training cohort) and 130 cases from Hunan Provincial Tumour Hospital (external validation cohort) between Jun 2016 and May 2019 were enrolled. Radiomic features were extracted from shear-wave elastography (SWE) and corresponding B-mode ultrasound (BMUS) images. Then, the minimum redundancy maximum relevance (MRMR) and least absolute shrinkage and selection operator (LASSO) algorithm were used to select ALN status-related features and construct the SWE and BMUS radiomic signatures. Proportional odds ordinal logistic regression was performed using the radiomic signature together with clinical data, and an ordinal nomogram was subsequently developed. We evaluated the performance of the nomogram using C-index, calibration, and compared it with clinical model.Results: Multivariate analysis indicated that SWE signature, US-reported LN status and molecular subtype were independent risk factors associated with ALN status. The radiomics nomogram based on these variables showed good calibration and discrimination in the training set (overall C-index: 0.842; 95%CI, 0.773–0.879) and the validation set (overall C-index: 0.822; 95%CI, 0.765–0.838). For discriminating between disease-free axilla (N0) and any axillary metastasis (N + (≥1)), it achieved C-index of 0.845 (95%CI, 0.777–0.914) for the training cohort and 0.817 (95%CI, 0.769–0.865) for the validation cohort. The tool could also discriminate between low (N + (1–2)) and heavy metastatic burden of ALN (N + (≥3)), with C-index of 0.827 (95%CI, 0.742–0.913) for the training cohort and 0.810 (95%CI, 0.755–0.864) for the validation cohort. Conclusions: The presented radiomics nomogram shows favourable predictive ability for ALN staging in patients with early-stage breast cancer, which could provide incremental information for preoperative decision-making.

Deformation monitoring of the girders and towers during strong winds or typhoons is vitally important for serviceability and safety assessment of in-service long-span bridges. Although some field measurements were carried out, our understanding on the features of the bridge deformation during high-speed winds is still limited; therefore, more monitoring-based studies are still required. In this study, the displacements of a long-span cable-stayed bridge during three typhoons are recorded by the Global Positioning System (GPS) in its Structural Health Monitoring (SHM) system. The monitored displacements are decomposed into static and dynamic components using the autoregressive moving average model. The outliers and the low-frequency colored noise in the dynamic components are then analyzed and eliminated. On that basis, the relationship between the static displacements and environmental factors, in terms of wind and temperature, is investigated. Afterwards, the variation of dynamic displacements of the bridge is analyzed with respect to the surrounding environments. Results show that the structural temperature is the major reason that changes the static deformation of the bridge. The dynamic deformation of the girder is mainly controlled by the in-situ wind speed. Nevertheless, the influence of structural temperature on dynamic deformation is mildly. Conclusions are aimed to provide a reference for wind resistant design and assessment of similar long-span bridges.

Background. Culture is still the gold standard for the detection of genital mycoplasma which could cause urogenital infections in humans. Mycoplasma IST2 is a commercial kit widely used for the detection of M. hominis and Ureaplasma species. Its accuracy was partially impaired because clinical specimens are usually mixed with purulent or transparent mucus. We aimed to solve this problem through sample homogenization by N-acetylcysteine (NAC) treatment. Methods. Twenty-two endocervical swab samples were collected from 22 female patients with suspected mycoplasma infection, while 11 of these specimens were with purulent or transparent mucus. Mycoplasma IST2 testing kit was used for mycoplasma culture and AST for the control group and NAC-treated group. Results. Genital mycoplasma was detected in 15 of 22 samples for both groups. The colony number in 6 out of 11 purulent specimens (54.5%) was more than 104 CFU/ml of genital mycoplasma for the NAC-treated group, while only one of 11 (9.1%) for the control group. For the nonpurulent specimens, no significant difference had been found in colony counting of genital mycoplasma between the control group and NAC-treated group (P>0.05). The results of antimicrobial susceptibility testing for the NAC-treated group were highly similar to those for the control group. Conclusions. Our results demonstrate that NAC is helpful in sample homogenization and NAC treatment can improve the detection efficiency of mycoplasma with Mycoplasma IST2 testing.

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

Background The purpose of this study was to assess the potential of 99mTc-labeled PSMA-SPECT/CT and Diffusion-Weighted Image (DWI) for predicting treatment response after carbon ion radiotherapy (CIRT) in prostate cancer. Methods We prospectively registered 26 patients with localized prostate cancer treated with CIRT. All patients underwent 99m Tc-labeled PSMA-SPECT/CT and multiparametric MRI before and after CIRT. The tumor/background ratio (TBR) and mean apparent diffusion coefficient (ADC mean ) were measured on the tumor and the percentage changes between 2 time points (ΔTBR and ΔADC mean ) were calculated. Patients were divided into two groups: good response and poor response according to clinical follow-up. Results The median follow up time was 38.3months. The TBR was significantly decreased ( p =0.001), while the ADC mean was significantly increased compared with the pretreatment value ( p

Load is one of the main causes of structural failure, and the correlation among loads would affect the evaluation results of structural performance. The purpose of this paper is to analyze the influence of the correlation among multiple loads on the structural reliability. In this paper, the nonparametric kernel density estimation (NKDE) method is used to estimate the probability density function (PDF) of related loads. In addition, the mixed copula (M-Copula) model is proposed, which combines Gumbel copula, Frank copula, Clayton copula, and weight coefficient, and the model parameters are fitted by MATLAB software to get the correlation of related loads. The reliability based on the related load combination is calculated according to the constructed model. After analyzing three numerical cases, the results show that the probability characteristics of NKDE estimation are very close to the actual conditions, and the reliability calculated by the M-Copula model is larger than those calculated by JCSS, Turkstra, and Gong methods. Using the M-Copula model for load correlation would avoid underestimating the reliability of the structure, which is conducive to structural economic development.

Mitochondrial aminoacyl-tRNA synthetases (mt-aaRSs) are a family of enzymes that play critical roles in protein biosynthesis. Mutations in mt-aaRSs are associated with various diseases. As a member of the mt-aaRS family, PARS2 encoding prolyl-tRNA synthetase 2 was recently shown to be associated with Alpers syndrome and certain infantile-onset neurodegenerative disorders in four patients. Here, we present two patients in a pedigree with early developmental delay, epileptic spasms, delayed myelination combined with cerebellar white matter abnormalities, and progressive cortical atrophy. Whole-exome sequencing revealed pathogenic compound heterozygous variants [c.283 G > A (p.95 V > I)] and [c.604 G > C (p.202 R > G)] in PARS2. Nearly all patients had epileptic spasms with early response to treatment, early developmental delay and/or regression followed by generalized hypotonia, postnatal microcephaly, elevated lactate levels, and progressive cerebral atrophy. Our study provides further evidence for validating the role of PARS2 in the pathology of related infantile-onset encephalopathy, contributing to the phenotypic features of this condition, and providing clinical and molecular insight for the diagnosis of this disease entity.

The aim of this study was to explore the independent prognostic factors related to postoperative recurrence‐free survival (RFS) in patients with breast phyllodes tumors (PTBs). A retrospective analysis was conducted in Fudan University Shanghai Cancer Center. According to histological type, patients with benign PTBs were classified as a low‐risk group, while borderline and malignant PTBs were classified as a high‐risk group. The Cox regression model was adopted to identify factors affecting postoperative RFS in the two groups, and a nomogram was generated to predict recurrence‐free survival at 1, 3, and 5 years. Among the 404 patients, 168 (41.6%) patients had benign PTB, 184 (45.5%) had borderline PTB, and 52 (12.9%) had malignant PTB. Fifty‐five patients experienced postoperative local recurrence, including six benign cases, 26 borderline cases, and 22 malignant cases; the three histological types of PTB had local recurrence rates of 3.6%, 14.1%, and 42.3%, respectively. Stromal cell atypia was an independent prognostic factor for RFS in the low‐risk group, while the surgical approach and tumor border were independent prognostic factors for RFS in the high‐risk group, and patients receiving simple excision with an infiltrative tumor border had a higher recurrence rate. A nomogram developed based on clinicopathologic features and surgical approaches could predict recurrence‐free survival at 1, 3, and 5 years. For high‐risk patients, this predictive nomogram based on tumor border, tumor residue, mitotic activity, degree of stromal cell hyperplasia, and atypia can be applied for patient counseling and clinical management. The efficacy of adjuvant radiotherapy remains uncertain.

Background Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal dyskinesia. Approximately half of the cases of paroxysmal kinesigenic dyskinesia worldwide are attributable to proline-rich transmembrane protein 2 mutations. Objective The objective of this study was to investigate potential causative genes and clinical characteristics in proline-rich transmembrane protein 2-negative patients with paroxysmal kinesigenic dyskinesia. Methods We analyzed clinical manifestations and performed exome sequencing in a cohort of 163 proline-rich transmembrane protein 2-negative probands, followed by filtering data with a paroxysmal movement disorders gene panel. Sanger sequencing, segregation analysis, and phenotypic reevaluation were used to substantiate the findings. Results The clinical characteristics of the enrolled 163 probands were summarized. A total of 39 heterozygous variants were identified, of which 33 were classified as benign, likely benign, and uncertain significance. The remaining 6 variants (3 novel, 3 documented) were pathogenic and likely pathogenic. Of these, 3 were de novo (potassium calcium-activated channel subfamily M alpha 1, c.1534A>G; solute carrier family 2 member 1, c.418G>A; sodium voltage-gated channel alpha subunit 8, c.3640G>A) in 3 sporadic individuals, respectively. The other 3 (paroxysmal nonkinesiogenic dyskinesia protein, c.956dupA; potassium voltage-gated channel subfamily A member 1, c.765C>A; Dishevelled, Egl-10, and Pleckstrin domain containing 5, c.3311C>T) cosegregated in 3 families. All 6 cases presented with typical paroxysmal kinesigenic dyskinesia characteristics, except for the Dishevelled, Egl-10, and Pleckstrin domain containing 5 family, where the proband's mother had abnormal discharges in her temporal lobes in addition to paroxysmal kinesigenic dyskinesia episodes. Conclusions Our findings extend the genotypic spectrum of paroxysmal kinesigenic dyskinesia and establish the associations between paroxysmal kinesigenic dyskinesia and genes classically related to other paroxysmal movement disorders. De novo variants might be a cause of sporadic paroxysmal kinesigenic dyskinesia. © 2018 International Parkinson and Movement Disorder Society.

Purpose To develop a nomogram incorporating B-mode ultrasound (BMUS) and shear-wave elastography (SWE) radiomics to predict malignant status of breast lesions seen on US non-invasively. Methods Data on 278 consecutive patients from Hospital #1 (training cohort) and 123 cases from Hospital #2 (external validation cohort) referred for breast US with subsequent histopathologic analysis between May 2017 and October 2019 were retrospectively collected. Using their BMUS and SWE images, we built a radiomics nomogram to improve radiology workflow for management of breast lesions. The performance of the algorithm was compared with a consensus of three ACR BI-RADS committee experts and four individual radiologists, all of whom interpreted breast US images in clinical practice. Results Twelve features from BMUS and three from SWE were selected finally to construct the respective radiomic signature. The nomogram based on the dual-modal US radiomics achieved good diagnostic performance in the training (AUC 0.96; 95% confidence intervals [CI], 0.94–0.98) and the validation set (AUC 0.92; 95% CI, 0.87–0.97). For the 123 test lesions, the algorithm achieved 105 of 123 (85%) accuracy, comparable to the expert consensus (104 of 123 [85%], P = 0.86) and four individual radiologists (93, 99, 95 and 97 of 123, with P value of 0.05, 0.31, 0.10 and 0.18 respectively). Furthermore, the model also performed well in the BI-RADS 4 and 5 categories. Conclusions Performance of a dual-model US radiomics nomogram based on SWE for breast lesion classification may comparable to that of expert radiologists who used ACR BI-RADS guideline.

Exosomal microRNAs (miRNAs) have been suggested to participate in the pathogenesis of neuropsychiatric diseases, but their role in major depressive disorder (MDD) is unknown. We performed a genome-wide miRNA expression profiling of blood-derived exosomes from MDD patients and control subjects and revealed the top differentially expressed exosomal miRNA, i.e. hsa-miR-139-5p (upregulation), had good performance to differentiate between MDD patients and controls. Tail vein injection of blood exosomes isolated from MDD patients into normal mice caused their depressive-like behaviors as determined by the forced swimming, tail suspension, and novelty suppressed feeding tests, and injection of blood exosomes isolated from healthy volunteers into unpredictable mild stress (CUMS)-treated mice alleviated their depressive-like behaviors. CUMS mice also showed significantly increased blood and brain levels of exosomal miR-139-5p. Furthermore, the depressive-like behaviors in CUMS-treated mice were rescued by intranasal injection of miR-139-5p antagomir, suggesting that increased exosomal miR-139-5p levels may mediate stress-induced depression-like behavior in mice. Both exosome treatment and miR-139-5p antagomir treatment increased hippocampal neurogenesis in the CUMS-treated mice, and treatment of exosome from MDD patients decreased hippocampal neurogenesis in the normal mice. The role of miR-139-5p in neurogenesis was validated by in vitro experiments, demonstrating that miR-139-5p is a negative regulator for neural stem cell proliferation and neuronal differentiation. Our findings together suggest that exosomes from patients with major depression caused depressive-like behaviors in mice with involvement of miR-139-5p-regulated neurogenesis. Therefore, exosomal miRNAs are promising targets for the diagnosis and treatment of MDD.

With the rapid expansion of the high-speed railway (HSR) network in China, some new lines must be constructed near or across existing HSRs, which will likely have an effect on the operation...

Clonorchiasis is an important food-borne parasitic disease in China because of the popularity in ingesting raw freshwater fish. To explore the epidemiology and determinants of clonorchiasis in children, a cross-sectional survey was implemented in two middle schools in Qiyang county, Hunan province, in southeastern China. Questionnaire survey and fecal examination were implemented. Questionnaires were fed back by 627 students, while stool samples were collected from 557 students, out of which 545 ones also provided questionnaire information. The percentage of students ingesting raw freshwater fish was 40.5% (254/627), while the prevalence with Clonorchis sinensis infection was 18.9% (105/557). Such factors contributed significantly to the students' practice in eating raw freshwater fish including boys, fathers' eating raw freshwater fish, mothers' eating raw freshwater fish, and preparation of raw freshwater fish at home, with an adjusted odds ratio of 1.9 (95% confidence intervals (95% CI): 1.3-2.8), 3.9 (95% CI: 2.3-6.5), 3.0 (95% CI: 1.8-4.8) and 2.8 (95% CI: 1.8-4.5), correspondingly. Ingestion of raw freshwater fish, fathers' eating raw freshwater fish and preparation of raw freshwater fish at home were risk factors of C. sinensis infection in students, and the adjusted odds ratio was 3.2 (95% CI: 1.9-5.5), 2.1 (95% CI: 1.1-3.9) and 1.8 (95% CI: 1.0-3.2), respectively. Thus, clonorchiasis was endemic in the surveyed schools due to the ingestion of raw freshwater fish, which is influenced by family environment. Education should be implemented in schools to promote behavioral change of eating raw freshwater fish.

We preliminarily evaluated the clinical feasibility and efficacy of intraoperative radiotherapy in patients with thyroid carcinoma. Nine thyroid cancer patients received intraoperative radiotherapy using an Intrabeam system. The dose was 3-4 Gy and the irradiation time ranged from 1 min 32 s to 7 min 33s. One case was a primary thyroid carcinoma, while the other cases were recurrent disease. Adverse effects, recurrence and survival were analyzed. In one patient, poorly differentiated thyroid carcinoma recurred 5 months after treatment, one patient developed a postoperative tracheal skin fistula, and one patient developed a wound infection. Because the affected areas were treated with both surgical resection and then radiotherapy, it is difficult to know which of those led to the adverse effects. Nonetheless, our results indicate that intraoperative radiotherapy can relieve the symptoms associated with thyroid cancer and improve the quality of life for these patients. It thus appears feasible to treat thyroid cancer patients with intraoperative radiotherapy.

Three typhoons approached the southeast coast of China during August 2012. The structural health monitoring (SHM) system recorded in-situ environmental factors (including wind speed and temperature) and structural responses (including displacements and acceleration) during the whole period. Based on the recorded SHM data, the variation features of the environmental factors and structural responses are investigated respectively. Furthermore, modal parameters including natural frequencies and damping ratios of SCB are identified and tracked during this period; such that, the relationship between modal parameters and environmental factors is studied. Results show that the variation of acceleration amplitude of the deck is mainly caused by the high-frequency excitations between 1.0 and 7.0 ​Hz which may correspond to the traffic and high-frequency wind loads. The low-frequency wind load, smaller than 1.0 ​Hz, is the major factor that controls the variation of dynamic displacements of the deck. In addition, a clear relationship between damping ratios and wind speed can be observed for the first three vertical modes, based on which, the aerodynamic damping can be subtracted. Conclusions can provide references for serviceability and safety assessment of similar long-span bridges.

Background Thyroid cancer (TC) is one of the most commonly seen secondary malignancy in breast cancer (BC) survivors. Materials and methods A retrospective study was conducted in BC patients in our center from 1999 to 2013. Patients were divided into BC‐TC group and BC‐alone group. Results In total, 13 978 BC patients were identified, among whom 247 (1.8%) had TC. The standardized incidence ratio (SIR) of TC was 4.48 compared with Chinese females, and up to 98.0% of cases were thyroid papillary carcinomas. A family history of malignancy was the only independent risk factor (odds ratio = 1.457, P = 0.025) for development of TC in patients with BC. We also identified inferior survival in patients with synchronous versus metachronous BC‐TC (P = 0.016). Synchronous BC‐TC (risk ratio = 5.597, P = 0.018) was an independent prognostic factor for inferior RFS. Conclusions We observed high co‐occurrence of TC in patients with BC. There might be different mechanisms behind synchronous and metachronous BC‐TC.

Video surveillance has become an important tool in various fields of social security, including criminal investigation, remote defense, information verification, etc. Non-universal video format also brings great challenges to data recovery. We explore a typical method that contains 4 steps for time code retrieval in practical case examination. These 4 steps are A) obtain existing video files, B) analyze the structure of existing video files and find the time field location, C) ascertain the time code location and change pattern and D) export and browse. Confirmed via comparison with 2 sets of questioned special format surveillance video files, this method has proved to be effective.

Hemophagocytic lymphohistiocytosis (HLH) is an immune-mediated syndrome resulting in cytokine storm. The uncontrolled cytokine storm leads to significant tissue damage and potentially life-threatening multiorgan failure. Conventional first-line treatment for HLH included HLH-94 protocol or HLH-2004 protocol. However, up to 30% of patients do not respond to first-line therapy. We reported 3 cases of secondary HLH/macrophage activation syndrome which were caused by lymphoma (2 cases) and adult-onset still's disease. They received low dose ruxolitinib plus HLH-94 protocol, and had rapid response to treatment without obvious adverse effects. Following the treatment, there was improvement seen in several disease markers, including fever, fibrinogen, serum ferritin, and liver function tests. Our report indicated that treatment with low dose ruxolitinib plus HLH-94 protocol might be a potential choice for secondary HLH, and clinical trials warrants to be further investigated in this treatment regimen.

Objective: We aimed to investigate the clinical and genetic features of paroxysmal kinesigenic dyskinesia (PKD) in a large population and to analyze the genotype–phenotype correlation of PKD. Methods: We analyzed clinical manifestations and conducted PRRT2 screening in 110 patients with PKD. Clinical data were compared between 91 probands with and without PRRT2 mutations. Results: Among the enrolled participants (45 from 26 families, 65 sporadic cases), 8 PRRT2 mutations were detected in 20 PKD families (76.9%) and 14 sporadic cases (21.5%), accounting for 37.4% (34/91) of the study population. Five mutations (c.649dupC, c.649delC, c.487C>T, c.573dupT, c.796C>T) were already reported, while 3 mutations (c.787C>T, c.797G>A, c.931C>T) were undocumented. A patient harboring a homozygous c.931C>T mutation was shown to have inherited the mutation via uniparental disomy. Compared with non- PRRT2 mutation carriers, the PRRT2 mutation carriers were younger at onset, experienced longer attacks, and tended to present with complicated PKD, combined phenotypes of dystonia and chorea, and a positive family history. A good response was shown in 98.4% of the patients prescribed with carbamazepine. Conclusions: PRRT2 mutations are common in patients with PKD and are significantly associated with an earlier age at onset, longer duration of attacks, a complicated form of PKD, combined phenotypes of dystonia and chorea, and a tendency for a family history of PKD. A patient with uniparental disomy resulting in a homozygous c.931C>T mutation is identified in the present study. Carbamazepine is the first-choice drug for patients with PKD, but an individualized treatment regimen should be developed.

We report a rare case of dextroversion accompanied with atrial septal defect (ASD), persistent left superior vena cava with absent right superior vena cava in a four-year-old male. A polytetrafluoroethylene (PTFE) graft as an extracardiac conduit was used to connect the persistent left superior vena cava (PLSVC) with the right atrial appendage.

The resource allocation problem is investigated for cooperative cognitive radio networks, considering energy efficiency of the primary users (PUs) and spectrum efficiency of the secondary users (SUs). The cooperation framework involves a PU selecting a SU as the relay and allocating the spectrum access intervals for the selected SU as a reward. The above sequential decision procedure is formulated as a Stackelberg game. Based on the knowledge of the effects of PUs decision on the behavior of a SU, the leader (PU) determines a fraction of the time slot duration to be used for the primary. The follower (SU) is allowed to transmit its own data to the corresponding receiver in the remaining duration and determines its optimal transmission power. The outcomes of the proposed cooperative resource allocation scheme, including primary user and secondary user power control, as well as dynamic access spectrum, are analyzed. Numerical results demonstrate that, with the proposed resource allocation scheme, the PU can achieve high energy saving by cooperation with the SU.

Bevacizumab, a recombinant humanized monoclonal antibody that targets the vascular endothelial growth factor, has been approved for use in a variety of malignancies. There have been reports of infections associated with the use of bevacizumab. We performed this meta-analysis to determine the overall incidence and risk of infections associated with bevacizumab in cancer patients.Pubmed and oncology conference proceedings were searched for relevant studies from January 2000 to June 2014. Studies were limited to phase II and phase III randomized controlled trials (RCTs) of bevacizumab in cancer patients with adequate safety profiles. Summary incidences, relative risks (RRs), and 95% confidence intervals (95%CIs) were calculated by using either random effects or fixed effect models according to the heterogeneity of included studies.In total 33,526 patients from 41 RCTs were included. The use of bevacizumab significantly increased the risk of developing all-grade (RR 1.45, 95%CI: 1.27-1.66, p0.001) and high-grade (RR 1.59, 95%CI: 1.42-1.79, p0.001) infections in cancer patients. Sensitivity analysis indicated that the significance estimate of pooled RRs was not significantly influenced by omitting any single study. On subgroup analysis, the risk of developing high-grade infection varied significantly with concomitant drugs (p=0.008). When stratified according to specific infectious events, the use of bevacizumab significantly increased the risk of developing severe febrile neutropenia (RR 1.57, 95%CI: 1.34-1.84; p0.001) and fistulae/abscesses (RR 2.13, 95%CI: 1.06-4.27; p=0.033). No evidence of publication bias was observed.Bevacizumab treatment significantly increases the risk of infectious events developing in cancer patients. The risk may vary with concomitant drugs. Clinicians should be aware of the risks of infections with the administration of this drug in cancer patients.

// Li Zhang 1,* , Zhao-zhi Yang 1,* , Xing-xing Chen 1,* , Jeffrey Tuan 3 , Jin-li Ma 1 , Xin Mei 1 , Xiao-li Yu 1 , Zhi-rui Zhou 1 , Zhi-min Shao 2 , Guang-yu Liu 2 and Xiao-mao Guo 1 1 Department of Radiation Oncology, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, China 2 Department of Breast Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, China 3 Department of Radiation Oncology, National Cancer Centre Singapore, Singapore * These authors have contributed equally to this work Correspondence to: Guang-yu Liu, email: // Xiao-mao Guo, email: // Keywords : breast cancer; positive sentinel lymph nodes, radiotherapy, intensity modulated radiation therapy, axillary level Received : March 27, 2015 Accepted : May 18, 2015 Published : May 27, 2015 Abstract Purpose: This study was designed to evaluate the dose coverage of axillary areas during whole breast irradiation with simplified intensity modulated radiation therapy (s-IMRT) and field-in-field IMRT (for-IMRT) in early stage breast cancer patients. Methods: Sixty-one consecutive patients with breast-conserving surgery and sentinel lymph node biopsy were collected. Two plans were created for each patient: the s-IMRT and for-IMRT plan. Dosimetric parameters of axillary areas were compared. Results: The average of mean doses delivered to the axillary level I areas in s-IMRT and for-IMRT plan were 27.7Gy and 29.1Gy ( p = 0.011), respectively. The average of V47.5Gy, V45Gy and V40Gy (percent volume receiving≥ 47.5Gy, 45Gy and 40Gy) of the axillary level I in s-IMRT plan was significantly lower than that in for-IMRT plan ( p 19.3cm and body width >31.9cm had significantly higher mean dose in axillary level I area ( p = 0.002, 0.007, 0.001, respectively). Conclusion: Compared with for-IMRT plan, the s-IMRT plan delivered lower dose to axillary level I area. For centers using s-IMRT technique, caution should be exercised when selecting to omit axillary lymph node dissection for patients with breast conserving surgery and limited positive SLNs.

In order to train outstanding engineering talents, our school proposed the third batch of "The Plan for Educating and Training Outstanding Engineers (PETOE)" for agricultural mechanization and automation. First, PETOE is tried in a small scale, our school set up small class teaching class and equipped with high-quality teachers. Besides, it was encouraging for teachers to carry out teaching reform and establish the school and enterprise double tutorial system. The use of credit requirements, policy incentives and other ways were applied to strengthen extracurricular practice innovation. After several years of implementation, our school has initially formed outstanding engineers training mode with a self characteristics. The inherent law of personnel training is constantly explored. We summarize the successful experience and lessons from the implementation of the PETOE. Innovating agricultural engineering personnel training mechanism make it play its demonstration effect in a large scale.

Whole-exome sequencing (WES), one of the next-generation sequencing (NGS), has become a powerful tool to identify exonic variants. Investigating causality of the sequence variants in human disease becomes an important part in NGS for the research and clinical applications. Recently, important guidelines on them have been published and will keep on updating. In our study, two Chinese families, with the clinical diagnosis of “Epilepsy”, which presented with seizures, psychomotor retardation, hypotonia and etc. features, were sequenced by Trio-WES (including the proband and the unaffected parents), and a standard interpretation of the identified variants was performed referring to the recently updated guidelines. Finally, we identified three novel mutations (c.71 C > T, p.P24L; c.1387-1389delGAG, p.E463-; c.134 G > A, p.W45*; NM_000026) in ADSL in the two Chinese families, and confirmed them as the causal variants to the disease-Adenylosuccinate Lyase Deficiency. Previous reported specific therapy was also introduced to the patients after our refined molecular diagnosis, however, the effect was very limited success. In summary, our study demonstrated the power and advantages of WES in exploring the etiology of human disease. Using the constantly updated guidelines to conduct the WES study and to interpret the sequence variants are a necessary strategy to make the molecular diagnosis and to guide the individualized treatment of human disease.

For patients with metastatic castration-resistant prostate cancer (CRPC), the efficacy and safety of molecular targeted agents (MTAs) in combination with docetaxel are still unclear. We conducted this meta-analysis to assess the efficacy and toxicity of the addition of MTAs to docetaxel-based chemotherapy for the treatment of metastatic CRPC.Databases from PubMed, Web of Science, and abstracts presented at American Society of Clinical Oncology meeting up to 31 June 2014 were searched to identify relevant studies. Eligible studies included prospective phase III randomized controlled trials (RCTs) evaluating docetaxel with or without MTAs in patients with metastatic CRPC. The primary aim was to assess overall survival (OS). Secondary aims were to assess progression-free survival (PFS); overall response rates (ORRs), and grade 3-5 toxicities. Statistical analyses were conducted by using either random effects or fixed-effect models according to the heterogeneity of included studies.A total of 5886 patients from five phase III RCTs were identified. No statistically significant difference in OS [hazard ratio (HR): 0·98, 95% confidence interval (CI): 0·91-1·04, P = 0·44], ORR [relative risk (RR): 1·32, 95% CI: 0·94-1·84, P = 0·11], and PSA response rate (RR: 1·22, 95% CI: 0·86-1·74, P = 0·27) was found between the two groups. The addition of MTAs to docetaxel significantly improved PFS (HR: 0·92, 95% CI: 0·86-0·98, P = 0·011). However, the benefits in PFS was accompanied by increasing the risk of developing grade 3-4 (RR: 1·19, 95% CI: 0·99-1·42, P = 0·062) and fatal (RR: 1·30, 95% CI: 1·01-1·66, P = 0·039) adverse events.The findings of this study suggest that the palliation of CRPC with MTAs and docetaxel does not provide a significant survival benefit and is associated with increased severe toxicities.

Currently, the anti-epidermal-growth-factor-receptor (EGFR) agents have shown encouraging treatment benefits in patients with various types of solid tumors including non-small-cell lung cancer (NSCLC). Despite these advances, radiological complete response to these therapies is rare. We meta-analyze the incidence of complete response (CR) in advanced NSCLC patients treated with anti-EGFR agents and controls in randomized controlled trials (RCTs).PubMed, Web of Science, Embase and Cochrane library databases were reviewed for phase III RCTs with EGFR-targeted agents vs. non-EGFR-targeted agents in patients with advanced NSCLC. We calculated the odds ratio of CR in patients assigned to anti-EGFR agents compared to controls.A total of 11,568 patients from 17 RCTs were included for analysis. The incidence of CR in patients treated with anti-EGFR agents was 1.1% (95% CI, 0.7-1.7%) compared to 0.6% (95% CI, 0.4-0.9%) in control arms. Comparing the different types of anti-EGFR agents, the incidence of CR was 1.9% for gefitinib (95% CI: 1.4-2.6%), 1.4% for cetuximab (95% CI: 0.8-2.7%) and 0.9% for erlotinib (95% CI: 0.6-1.5%), respectively. The use of anti-EGFR agents significantly increased the odds ratio of obtaining a CR (OR 2.12, 95% CI: 1.28-3.49, p = 0.003) compared to controls. This was found to be higher in treatment arms involving more than 50% of: female patients, patients who had never smoked tobacco, patients of Asian descent or patients with adenocarcinoma or EGFR mutation. No significant differences in ORs were observed in any prespecified sub-groups.Although a CR is rare in advanced NSCLC patients receiving anti-EGFR agents, these drugs significantly increase the OR of a CR compared to controls, especially for patients with EGFR mutations. Further studies are needed to investigate whether the increase of CR with anti-EGFR therapy would be translated into survival benefits.

Background: Blocking angiogenesis by targeting vascular endothelial growth factor (VEGF) signaling pathway to inhibit tumor growth has proven to be successful in treating a variety of different metastatic tumor types, including kidney, colon, ovarian, and lung cancers, but its role in castration-resistant prostate cancer (CRPC) is still unknown. We here aimed to determine the efficacy and toxicities of anti-VEGF agents in patients with CRPC. Materials and Methods: The databases of PubMed, Web of Science and abstracts presented at the American Society of Clinical Oncology up to March 31, 2014 were searched for relevant articles. Pooled estimates of the objective response rate (ORR) and prostate-specific antigen (PSA) response rate (decline ≥50%) were calculated using the Comprehensive Meta-Analysis (version 2.2.064) software. Median weighted progressionfree survival (PFS) and overall survival (OS) time for anti-VEGF monotherapy and anti-VEGF-based doublets were compared by two-sided Student’s t test. Results: A total of 3,841 patients from 19 prospective studies (4 randomized controlled trials and 15 prospective nonrandomized cohort studies) were included for analysis. The pooled ORR was 12.4% with a higher response rate of 26.4% (95%CI, 13.6-44.9%) for anti-VEGF-based combinations vs. 6.7% (95%CI, 3.5-12.7%) for anti-VEGF alone (p=0.004). Similarly, the pooled PSA response rate was 32.4% with a higher PSA response rate of 52.8% (95%CI: 40.2-65.1%) for anti-VEGF-based combinations vs. 7.3% (95%CI, 3.6-14.2%) for anti-VEGF alone (p