Search

The generation of peptidomimetic substructures for medicinal chemistry purposes requires effective and divergent synthetic methods. We present in this work an efficient flow process that allows quick modulation of reagents for Joullié-Ugi multicomponent reaction, using spiroindolenines as core motifs. This sterically hindered imine equivalent could successfully be diversified using various isocyanides and amino acids in generally good space-time yields. A telescoped flow process combining interrupted Fischer reaction for spiroindolenine synthesis and subsequent Joullié-Ugi-type modification resulted in product formation in very good overall yield in less than 2 hours compared to 48 hours required in batch mode. The developed protocol can be seen as a general tool for rapid and facile generation of peptidomimetic compounds. We also showcase preliminary biological assessments for the prepared compounds.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or β-L-2′-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Farnesoid-x-receptor (FXR) agonists, currently trialed in patients with non-alcoholic steatosis (NAFLD), worsen the pro-atherogenic lipid profile and might require a comedication with statin. Here we report that mice feed a high fat/high cholesterol diet (HFD) are protected from developing a pro-atherogenic lipid profile because their ability to dispose cholesterol through bile acids. This protective mechanism is mediated by suppression of FXR signaling in the liver by muricholic acids (MCAs) generated in mice from chenodeoxycholic acid (CDCA). In contrast to CDCA, MCAs are FXR antagonists and promote a CYP7A1-dependent increase of bile acids synthesis. In mice feed a HFD, the treatment with obeticholic acid, a clinical stage FXR agonist, failed to improve the liver histopathology while reduced Cyp7a1 and Cyp8b1 genes expression and bile acids synthesis and excretion. In contrast, treating mice with atorvastatin mitigated liver and vascular injury caused by the HFD while increased the bile acids synthesis and excretion. Atorvastatin increased the percentage of 7α-dehydroxylase expressing bacteria in the intestine promoting the formation of deoxycholic acid and litocholic acid, two GPBAR1 agonists, along with the expression of GPBAR1-regulated genes in the white adipose tissue and colon. In conclusion, present results highlight the central role of bile acids in regulating lipid and cholesterol metabolism in response to atorvastatin and provide explanations for limited efficacy of FXR agonists in the treatment of NAFLD.

The severe acute respiratory syndrome (SARS)-CoV-2, a newly emerged coronavirus first identified in 2019, is the pathogenetic agent od Corona Virus Induced Disease (COVID)19. The virus enters the human cells after binding to the angiotensin converting enzyme (ACE) 2 receptor in target tissues. ACE2 expression is induced in response to inflammation. The colon expression of ACE2 is upregulated in patients with inflammatory bowel disease (IBD), highlighting a potential risk of intestinal inflammation in promoting viral entry in the human body. Because mechanisms that regulate ACE2 expression in the intestine are poorly understood and there is a need of anti-SARS-CoV2 therapies, we have settled to investigate whether natural flavonoids might regulate the expression of ACE2 in intestinal models of inflammation. The results of these studies demonstrated that pelargonidin, a natural flavonoid bind and activates the Aryl hydrocarbon Receptor (AhR) in vitro and reverses intestinal inflammation caused by chronic exposure to high fat diet or to the intestinal braking-barrier agent DSS in a AhR-dependent manner. In these two models, development of colon inflammation associated with upregulation of ACE2 mRNA expression. Colon levels of ACE2 mRNA were directly correlated with TNFα mRNA levels. In contrast to ACE2 the angiotensin 1-7 receptor MAS was downregulated in the inflamed tissues. Molecular docking studies suggested that pelargonidin binds a fatty acid binding pocket on the receptor binding domain of SARS-CoV2 Spike protein. In vitro studies demonstrated that pelargonidin significantly reduces the binding of SARS-CoV2 Spike protein to ACE2 and reduces the SARS-CoV2 replication in a concentration-dependent manner. In summary, we have provided evidence that a natural flavonoid might hold potential in reducing intestinal inflammation and ACE2 induction in the inflamed colon in a AhR-dependent manner.

G-protein-coupled receptors (GPCRs) are the molecular target of 40% of marketed drugs and the most investigated structures to develop novel therapeutics. Different members of the GPCRs superfamily can modulate the same cellular process acting on diverse pathways, thus representing an attractive opportunity to achieve multitarget drugs with synergic pharmacological effects. Here, we present a series of compounds with dual activity toward cysteinyl leukotriene receptor 1 (CysLT1R) and G-protein-coupled bile acid receptor 1 (GPBAR1). They are derivatives of REV5901─the first reported dual compound─with therapeutic potential in the treatment of colitis and other inflammatory processes. We report the binding mode of the most active compounds in the two GPCRs, revealing unprecedented structural basis for future drug design studies, including the presence of a polar group opportunely spaced from an aromatic ring in the ligand to interact with Arg792.60 of CysLT1R and achieve dual activity.

Autophagy is a highly conserved catabolic process activated by fasting and caloric restriction. FXR, a receptor for primary bile acids, reverses the activity of cAMP-response element binding protein (CREB) on autophagy-related genes (Atg)s and terminates autophagy in the fed state. GPBAR1, a receptor for secondary bile acids, exerts its genomic effects via cAMP-CREB pathway. By genetic and pharmacological approaches, we have obtained evidence that GPBAR1 functions as a positive modulator of autophagy in liver and white adipose tissue (WAT) in fasting. Mechanistically, we found that Gpbar1−/− mice lack the expression of Cyp2c70 a gene essential for generation of muricholic acids which are FXR antagonists, and have an FXR-biased bile acid pool. Because FXR represses autophagy, Gpbar1−/− mice show a defective regulation of autophagy in fasting. BAR501, a selective GPBAR1 agonist, induces autophagy in fed mice. Defective regulation of autophagy in Gpbar1−/− could be reversed by FXR antagonism, while repression of autophagy by feeding was partially abrogated by FXR gene ablation, and FXR activation repressed Atgs in the fast state. BAR501 reversed the negative regulatory effects of feeding and FXR agonism on autophagy and promoted the recruitment of CREB to a CRE on the LC3 promoter. In mice exposed to chronic high caloric intake, GPBAR1 agonism ameliorated insulin sensitivity and induced Atgs expression in the liver and WAT. In summary, GPBAR1 is required for positive regulation of autophagy in fasting and its ligands reverse the repressive effects exerted on liver and WAT autophagy flow by FXR in fed. © 2020 Federation of American Societies for Experimental Biology

Bile acids are a large family of atypical steroids which exert their functions by binding to a family of ubiquitous cell membrane and nuclear receptors. There are two main bile acid activated receptors, FXR and GPBAR1, that are exclusively activated by bile acids, while other receptors CAR, LXRs, PXR, RORγT, S1PR2and VDR are activated by bile acids in addition to other more selective endogenous ligands. In the intestine, activation of FXR and GPBAR1 promotes the release of FGF15/19 and GLP1 which integrate their signaling with direct effects exerted by theother receptors in target tissues. This network is tuned in a time ordered manner by circadian rhythm and is critical for the regulation of metabolic process including autophagy, fast-to-feed transition, lipid and glucose metabolism, energy balance and immune responses. In the last decade FXR ligands have entered clinical trials but development of systemic FXR agonists has been proven challenging because their side effects including increased levels of cholesterol and Low Density Lipoproteins cholesterol (LDL-c) and reduced High-Density Lipoprotein cholesterol (HDL-c). In addition, pruritus has emerged as a common, dose related, side effect of FXR ligands. Intestinal-restricted FXR and GPBAR1 agonists and dual FXR/GPBAR1 agonists have been developed. Here we review the last decade in bile acids physiology and pharmacology.

Introduction: Nonalcoholic steatohepatitis (NASH) is a progressive form of nonalcoholic fatty liver disease (NAFLD) for which therapy is suboptimal. The farnesoid-X-receptor (FXR) and the G protein bile acid receptor (GPBAR)1 are two bile acid-activated receptors that exert regulatory effects on lipid, glucose, energy, and immune homeostasis. GPBAR1 and FXR ligands have shown efficacy in reversing steatohepatitis and fibrosis in preclinical models of NASH. Area covered: This article evaluates the efficacy and pitfalls of GPBAR1 and FXR-based therapies in the treatment of NASH. While there are no GPBAR1 agonist in clinical development, several FXR ligands have completed phase 2 and phase 3 trials in NASH. EDP305, tropifexor, cilofexor, nidufexor, TERN.101, Px-104, EYP001, MET409. Individual FXR agonists have shown variable efficacy in reversing liver steatohepatitis and fibrosis. Class-related, dose-dependent side effects: pruritus, increased plasma levels of cholesterol and LDLc, and reduction of HDL have been reported. Expert opinion: Efficacy of FXR agonists as stand-alone therapy is limited by dose-related side effects. Efficacy of combining an FXR agonist with statins, CCR2, and ACC inhibitors is currently investigated. Identification of patient subsets would allow development of patients tailored therapy using a combination of drugs acting on different molecular mechanisms.

The coronavirus disease 2019 (COVID-19) is a respiratory tract infection caused by the severe acute respiratory syndrome coronavirus (SARS)-CoV-2. In the light of the urgent need to identify novel approaches to be used in the emergency phase, a largely explored strategy has been the repurpose of clinically available drugs as new antivirals, by targeting different viral proteins. In this paper, we describe a drug repurposing strategy based on a virtual screening of druggable pockets located in the central β-sheet core of the SARS-CoV-2 Spike protein RBD supported by in vitro tests identifying several steroidal derivatives as SARS-CoV-2 entry inhibitors. Our results demonstrate that several potential binding sites exist in the SARS CoV-2 S protein, and that the occupancy of these pockets reduces the ability of the S protein RBD to bind to the ACE2 consensus in vitro. In particular, natural occurring and clinically available steroids as glycyrrhetinic and oleanolic acids, as well as the bile acids derivatives glyco-UDCA and obeticholic acid have been shown to be effective in preventing virus entry in the case of low viral load. All together, these results might help to define novel approaches to reduce the viral load by using SARS-CoV-2 entry inhibitors.

The farnesoid-X-receptor (FXR) is validated target in the cholestatic disorders treatment. Obeticholic acid (OCA), the first in class of FXR agonist approved for clinical use, causes side effects including acute liver decompensation when administered to cirrhotic patients with primary biliary cholangitis at higher than recommended doses. The V-Maf avian-musculoaponeurotic-fibrosarcoma-oncogene-homolog-G (Mafg) and nuclear factor-erythroid-2-related-factor-2 (Nrf2) mediates some of the downstream effects of FXR. In the present study we have investigated the role of FXR/MafG/NRF2 pathway in the development of liver toxicity caused by OCA in rodent models of cholestasis. Cholestasis was induced by bile duct ligation (BDL) or administration of α-naphtyl-isothiocyanate (ANIT) to male Wistar rats and FXR−/− and FXR+/+ mice. Treating BDL and ANIT rats with OCA exacerbated the severity of cholestasis, hepatocytes injury and severely downregulated the expression of basolateral transporters. In mice, genetic ablation FXR or its pharmacological inhibition by 3-(naphthalen-2-yl)-5-(piperidin-4-yl)-1,2,4-oxadiazole rescued from negative regulation of MRP4 and protected against liver injury caused by ANIT. By RNAseq analysis we found that FXR antagonism effectively reversed the transcription of over 2100 genes modulated by OCA/ANIT treatment, including Mafg and Nrf2 and their target genes Cyp7a1, Cyp8b1, Mat1a, Mat2a, Gss. Genetic and pharmacological Mafg inhibition by liver delivery of siRNA antisense or S-adenosylmethionine effectively rescued from damage caused by ANIT/OCA. In contrast, Nrf2 induction by sulforaphane was protective. Conclusions: Liver injury caused by FXR agonism in cholestasis is FXR-dependent and is reversed by FXR and Mafg antagonism or Nrf2 induction. © 2020 Elsevier B.V.

Bile acids are produced in the liver by the cholesterol breakdown and further metabolized by the intestinal microbiota to generate a group of chemically heterogeneous steroids that bind and activate a family of cells surface and nuclear receptors, collectively known as the bile acid-activated receptors (BARs). The two best characterized members of this family are the farnesoid-x-receptor (FXR) and G protein Bile Acid Receptor (GPBAR1). Both receptors are expressed by cells of innate immunity including liver-resident and intestinal-resident macrophages and monocytes-derived macrophages. Because FXR and GPBAR1 knockout mice are biased toward a pro-inflammatory phenotype, it appears the both receptors might have a role in the development and maintenance of a tolerogenic phenotype. FXR and GPBAR1 ligands have been proven effective in the treatment in inflammatory and metabolic disorders and ligands for these receptors are currently under development for the treatment of non-alcoholic steato-hepatitis and diabetes. © 2020 Elsevier Ltd

12 p.-6 fig.-1 schem., CD22 (Siglec-2) is a B-cell surface inhibitory protein capable of selectively recognising sialylated glycans, thus dampening autoimmune responses against self-antigens. Here we have characterised the dynamic recognition of complex-type N-glycans by human CD22 by means of orthogonal approaches including NMR spectroscopy, computational methods and biophysical assays. We provide new molecular insights into the binding mode of sialoglycans in complex with h-CD22, highlighting the role of the sialic acid galactose moieties in the recognition process, elucidating the conformational behaviour of complex-type N-glycans bound to Siglec-2 and dissecting the formation of CD22 homo-oligomers on the B-cell surface. Our results could enable the development of additional therapeutics capable of modulating the activity of h-CD22 in autoimmune diseases and malignancies derived from B-cells., H2020 Marie Skłodowska-Curie Actions. Grant Numbers: 642157, 814102 Mizutani Foundation for Glycoscience. Grant Number: 2014-2015

[Image: see text] GPBAR1 agonists have been identified as potential leads for the treatment of diseases related to colon inflammation such as Crohn’s and ulcerative colitis. In this paper, we report the discovery of a small library of hyodeoxycholane analogues, decorated at C-6 with different substituents, as potent and selective GPBAR1 agonists. In vitro pharmacological assays showed that compound 6 selectively activates GPBAR1 (EC(50) = 0.3 μM) and reduces the production of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) in THP1 cells. The binding mode of compound 6 in GPBAR1 was elucidated by docking calculations. Moreover, compound 6 protects against TNBS-induced colitis in Gpbar1(+/+) rodent model, representing an intriguing lead for the treatment of these inflammatory disorders.

A greener and sustainable flow chemistry protocol for the synthesis of 3,3-disubstituted indolenines through interrupted Fischer indolisation reaction is described. First, two model aldehydes were reacted with phenylhydrazine in order to explore the reaction feasibility in a ‘greener’ fashion in batch mode. The best outcomes were then used as the starting point for the implementation of the reaction in continuous flow. A thorough exploration of key parameters allowed the identification of the most efficient reagent mixing mode, and the optimum temperature and residence time. The newly developed method allowed straightforward reaction channelling towards the formation of the indolenines, thus reducing the competitive formation of side products. We further broadened the scope of the conceived methodology by exploring the possibility of a heterogeneous in-line reduction of the indolenines to their indoline counterparts. This rapid approach nicely complements known batch chemistry and could facilitate synthesis and scale up of 3,3-disubstituted indolenines and indolines, offering a coupling point for additional and subsequent flow reactions for multistep syntheses for further derivatization.

The coronavirus disease 2019 (COVID-19) is a respiratory tract infection caused by the severe acute respiratory syndrome coronavirus (SARS)-CoV-2. In light of the urgent need to identify novel approaches to be used in the emergency phase, we have embarked on an exploratory campaign aimed at repurposing natural substances and clinically available drugs as potential anti-SARS-CoV2-2 agents by targeting viral proteins. Here we report on a strategy based on the virtual screening of druggable pockets located in the central β-sheet core of the SARS-CoV-2 Spike's protein receptor binding domain (RBD). By combining an in silico approach and molecular in vitro testing we have been able to identify several triterpenoid/steroidal agents that inhibit interaction of the Spike RBD with the carboxypeptidase domain of the Angiotensin Converting Enzyme (ACE2). In detail, we provide evidence that potential binding sites exist in the RBD of the SARS CoV-2 Spike protein and that occupancy of these pockets reduces the ability of the RBD to bind to the ACE2 consensus in vitro. Naturally occurring and clinically available triterpenoids such as glycyrrhetinic and oleanolic acids, as well as primary and secondary bile acids and their amidated derivatives such as glyco-ursodeoxycholic acid and semi-synthetic derivatives such as obeticholic acid reduces the RBD/ACE2 binding. In aggregate, these results might help to define novel approaches to COVID-19 based on SARS-CoV-2 entry inhibitors.

Drug-induced liver injury caused by acetaminophen (acetyl-para-aminophenol [APAP]) is the main cause of acute liver failure and liver transplantation in several Western countries. Whereas direct toxicity exerted by APAP metabolites is a key determinant for early hepatocytes injury, the recruitment of cells of innate immunity exerts a mechanistic role in disease progression, determining the clinical outcomes. GPBAR1 is a G protein–coupled receptor for secondary bile acids placed at the interface between liver sinusoidal cells and innate immunity. In this report, using genetic and pharmacological approaches, we demonstrate that whereas Gpbar1 gene deletion worsens the severity of liver injury, its pharmacological activation by 6β-ethyl-3a,7b-dihydroxy-5b-cholan-24-ol rescues mice from liver injury caused by APAP. This protective effect was supported by a robust attenuation of liver recruitment of monocyte-derived macrophages and their repolarization toward an anti-inflammatory phenotype. Macrophage depletion by gadolinium chloride pretreatment abrogated disease development, whereas their reconstitution by spleen-derived macrophage transplantation restored the sensitivity to APAP in a GPBAR1-dependent manner. RNA sequencing analyses demonstrated that GPBAR1 agonism modulated the expression of multiple pathways, including the chemokine CCL2 and its receptor, CCR2. Treating wild-type mice with an anti-CCL2 mAb attenuated the severity of liver injury. We demonstrated that negative regulation of CCL2 production by GPBAR1 agonism was promoter dependent and involved FOXO1. In conclusion, we have shown that GPBAR1 is an upstream modulator of CCL2/CCR2 axis at the sinusoidal cell/macrophage interface, providing a novel target in the treatment of liver damage caused by APAP.

Introduction. The nuclear receptor FXR regulates the expression of genes involved in bile acids, glucose and lipid homeostasis. For its role as guardian of metabolism, FXR has been identified a promising pharmacological target in liver bile acid and lipid accumulation, such as cholestasis and non-alcoholic fatty liver disease (NAFLD). The field of FXR research is extremely competitive with a large number of patents and articles published in the last decades identifying promising hit compounds. Areas covered. The present review summarizes recent patent activity (2014-to date) filing for synthetic and natural FXR ligands, including bile acid derivatives and non-steroidal compounds, alongside their in vitro and in vivo efficacy as well as their therapeutic applications. Expert opinion. While the first FXR agonist, obeticholic acid, has gained approval, significant safety issues have been emerged. Today is unclear whether these safety issues are class related or restricted to the bile acid scaffold of this agent. Despite the significant number of patent applications claiming steroidal and non-steroidal FXR agonists, several questions on their therapeutic potential in cholestasis and NASH remain open leaving a space for the development of novel compounds.

The plant Gymnema sylvestre has been used widely in traditional medicine as a remedy for several diseases, and its leaf extract is known to contain a group of bioactive triterpene saponins belonging to the gymnemic acid class. Gymnemic acid I (1) is one of the main components among this group of secondary metabolites and is endowed with an interesting bioactivity profile. Since there is a lack of information about its specific biological targets, the full interactome of 1 was investigated through a quantitative chemical proteomic approach, based on stable-isotope dimethyl labeling. The ribosome complex was found to be the main partner of compound 1, and a full validation of the proteomics results was achieved by orthogonal approaches. Further biochemical and biological investigations revealed an inhibitory effect of 1 on the ribosome machinery.

The G-protein coupled receptor of bile acids GPBAR1 is a bile acid receptor that plays an important role in regulating innate immunity, glucose homeostasis and energy expenditure representing an interesting target for the treatment of metabolic and degenerative diseases. A selective control of its activity over the other bile acid-activated receptors is desirable to reduce unwanted effects due to activation of multiple downstream signals regulated by diverse receptors. Here, we report the design and the synthesis of a small series of bile acid derivatives with their side chains decorated with an epoxide ring. We demonstrate that all the compounds selectively activate GPBAR1 in cell-based assays and regulate the expression of pro-glucagon, a canonical GPBAR1 targeted gene in an intestinal endocrine cell line, while have no effect on FXR, LXRα and LXRβ. Finally, we elucidate the binding mode of the most potent compound of this family through molecular modeling studies. Our study contributes to increase the arsenal of bile acid derivatives serving as GPBAR1 modulators, widening the chemical space that can be exploited in drug design.

As a cellular bile acid sensor, farnesoid X receptor (FXR) and the membrane G-coupled receptor (GPBAR1) participate in maintaining bile acid, lipid, and glucose homeostasis. To date, several selective and dual agonists have been developed as promising pharmacological approach to metabolic disorders, with most of them possessing an acidic conjugable function that might compromise their pharmacokinetic distribution. Here, guided by docking calculations, nonacidic 6-ethyl cholane derivatives have been prepared. In vitro pharmacological characterization resulted in the identification of bile acid receptor modulators with improved pharmacokinetic properties.

Obeticholic acid (OCA) is a farnesoid-X-receptor (FXR) ligand, shown effective in reducing steatosis and fibrosis in NASH patients. However, OCA causes major side effects including pruritus, while increases the risk for liver decompensation in cirrhotic patients. Ursodeoxycholic acid (UDCA), is a safe and unexpensive bile acid used in the treatment of liver disorders whose mechanism of action is poorly defined. Here we have compared the effects of OCA and UDCA in a mouse model of NASH. In mice exposed to a diet rich in fat/cholesterol and fructose (HFD-F), treatment with OCA or UDCA effectively prevented body weight gain, insulin resistance, as demonstrated by OGTT, and AST plasma levels. After 12 weeks HFD-F mice developed liver microvesicular steatosis, inflammation and mild fibrosis, increased expression of inflammatory (TNFα, IL6, F4/80) and fibrosis (αSma, Col1α1, Tgfβ) markers, reduced liver expression of FXR, dysregulated liver FXR signaling and elevated levels of Tauro-α and β-muricholic acid (T-α and βMCA), two FXR antagonists in mice. Both compounds prevented these changes and improved liver histopathology. OCA reduced primary bile acid synthesis worsening the T-CA/T-βMCA ratio. UDCA effectively transactivated GPBAR1 in vitro. By RNAseq analysis we found that among over 2400 genes modulated by the HFD-F, only 32 and 60 genes were modulated by OCA and UDCA, with only 3 genes (Dbp, Adh7, Osgin1) being modulated by both agents. Both agents partially prevented the intestinal dysbiosis. Conclusions UDCA is a GPBAR1 ligand and exerts beneficial effects in a rodent model of NASH by activating non-overlapping pathway with OCA.

Non-alcoholic steatohepatitis (NASH) is a progressive, chronic, liver disease whose prevalence is growing worldwide. Despite several agents being under development for treating NASH, there are no drugs currently approved. The Farnesoid-x-receptor (FXR) and the G-protein coupled bile acid receptor 1 (GPBAR1), two bile acid activated receptors, have been investigated for their potential in treating NASH. Here we report that BAR502, a steroidal dual ligand for FXR/GPBAR1, attenuates development of clinical and liver histopathology features of NASH in mice fed a high fat diet (HFD) and fructose (F). By RNAseq analysis of liver transcriptome we found that BAR502 restores FXR signaling in the liver of mice feed HFD&ndash, F, and negatively regulates a cluster of genes including Srebf1 (Srepb1c) and its target genes&mdash, fatty acid synthase (Fasn) and Cell death-inducing DFF45-like effector (CIDE) genes, Cidea and Cidec&mdash, involved in lipid droplets formation and triglycerides storage in hepatocytes. Additionally, BAR502 increased the intestinal expression of Fgf15 and Glp1 and energy expenditure by white adipose tissues. Finally, exposure to BAR502 reshaped the intestinal microbiota by increasing the amount of Bacteroidaceae. In conclusion, we have shown that dual FXR/GPBAR1 agonism might have utility in treatment of NASH.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

[Image: see text] Recent findings have shown that Farnesoid X Receptor (FXR) antagonists might be useful in the treatment of cholestasis and related metabolic disorders. In this paper, we report the discovery of a new chemotype of FXR antagonists featured by a 3,5-disubstituted oxadiazole core. In total, 35 new derivatives were designed and synthesized, and notably, compounds 3f and 13, containing a piperidine ring, displayed the best antagonistic activity against FXR with promising cellular potency (IC(50) = 0.58 ± 0.27 and 0.127 ± 0.02 μM, respectively). The excellent pharmacokinetic properties make compound 3f the most promising lead identified in this study.

[Image: see text] Acetaminophen misuse is a leading cause of acute liver failure and liver transplantation for which therapy is poorly effective. FXR ligands have shown effective in reducing liver injury in several experimental and clinical settings. In this Letter, we have elaborated on the structure of GW4064, the first nonsteroidal agonist for FXR, to identify novel isoxazoles endowed with FXR agonistic activity and improved ADME properties. The pharmacological characterization and molecular docking studies for the structure–activity rationalization allowed the identification of several FXR agonists with nanomolar potency in transactivation and SRC-1 recruitment assays. This characterization resulted in the identification of a potent FXR agonist, compound 20 that was orally active, and rescued mice from acute liver failure caused by acetaminophen overdose in a FXR-dependent manner.

The G-protein bile acid receptor 1 (GPBAR1) has emerged in the last decade as prominent target for the treatment of metabolic and inflammatory diseases including type 2 diabetes, obesity, and non-alcoholic steatohepatitis. To date numerous bile acid derivatives have been identified as GPBAR1 agonists, however their clinical application is hampered by the lack of selectivity toward the other bile acid receptors. Therefore, non-steroidal GPBAR1 ligands able to selectively activate the receptor are urgently needed. With this aim, we here designed, synthesized and biologically evaluated ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl) urea derivatives as novel potent GPBAR1 agonists. Particularly, compounds 9 and 10 induce the mRNA expression of the GPBAR1 target gene pro-glucagon and show high selectivity over the other bile acid receptors FXR, LXRα, LXRβ and PXR, and the related receptors PPARα and PPARγ. Computational studies elucidated the binding mode of 10 to GPBAR1, providing important structural insights for the design of non-steroidal GPBAR1 agonists. The pharmacokinetic properties of 9 and 10 suggest that the ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureydil scaffold might be exploited to achieve effective drug candidates to treat GPBAR1 related disorders.

Graphical abstract Pelargonidin down-regulates Ace2 expression and inhibits binding of the SARS-Cov-2 virus on the host cell ACE2 receptor. Inflammatory stimuli lead to the release of TNF-α which binds to its receptor present on epithelial cells of the colon. The activation of TNF-α receptor induces an activation of NF-kB that migrates to the nucleus where activates the transcription of several genes including Il-6 and Ace2. Pelargonidin exerts a protective effect through AHR which blocks NF-kB translocation into the nucleus (indicated with a red line because this mechanism has not been demonstrated in this study but in previous studies [57,58]) and thereby inhibiting the expression of Ace2. Pelargonidin also directly inhibits the binding of the SARS-Cov-2 virus to the ACE2 receptor., The severe acute respiratory syndrome (SARS)-CoV-2 is the pathogenetic agent of Corona Virus Induced Disease (COVID)19. The virus enters the human cells after binding to the angiotensin converting enzyme (ACE)2 receptor in target tissues. ACE2 expression is induced in response to inflammation. The colon expression of ACE2 is upregulated in patients with inflammatory bowel disease (IBD), highlighting a potential risk of intestinal inflammation in promoting viral entry in the human body. Because mechanisms that regulate ACE2 expression in the intestine are poorly understood and there is a need of anti-SARS-CoV-2 therapies, we have settled to investigate whether natural flavonoids might regulate the expression of Ace2 in intestinal models of inflammation. The results of these studies demonstrated that pelargonidin activates the Aryl hydrocarbon Receptor (AHR) in vitro and reverses intestinal inflammation caused by chronic exposure to high fat diet or to the intestinal braking-barrier agent TNBS in a AhR-dependent manner. In these two models, development of colon inflammation associated with upregulation of Ace2 mRNA expression. Colon levels of Ace2 mRNA were directly correlated with Tnf-α mRNA levels. Molecular docking studies suggested that pelargonidin binds a fatty acid binding pocket on the receptor binding domain of SARS-CoV-2 Spike protein. In vitro studies demonstrated that pelargonidin significantly reduces the binding of SARS-CoV-2 Spike protein to ACE2 and reduces the SARS-CoV-2 replication in a concentration-dependent manner. In summary, we have provided evidence that a natural flavonoid might hold potential in reducing intestinal inflammation and ACE2 induction in the inflamed colon in a AhR-dependent manner.

Nonnutritive sweeteners (NNSs) are widely employed as dietary substitutes for classical sugars thanks to their safety profile and low toxicity. In this study, a re-evaluation of the biological effects of steviol (1), the main metabolite from Stevia rebaudiana glycosides, was performed using the Inverse Virtual Screening (IVS) target fishing computational approach. Starting from well-known pharmacological properties of Stevia rebaudiana glycosides, this computational tool was employed for predicting the putative interacting targets of 1 and, afterwards, of its five synthetic ester derivatives 2–6, accounting a large panel of proteins involved in cancer and inflammation events. Applying this methodology, the farnesoid X receptor (FXR) was identified as the putative target partner of 1–6. The predicted ligand-protein interactions were corroborated by transactivation assays, specifically disclosing the agonistic activity of 1 and the antagonistic activities of 2–6 on FXR. The reported results highlight the feasibility of IVS as a fast and potent tool for predicting the interacting targets of query compounds, addressing the re-evaluation of their bioactivity. In light of the obtained results, the presumably safe profile of known compounds, such as the case of steviol (1), is critically discussed.

Once known exclusively for their role in nutrients absorption, primary bile acids, chenodeoxycholic and cholic acid, and secondary bile acids, deoxycholic and lithocholic acid, are signaling molecules, generated from cholesterol breakdown by the interaction of the host and intestinal microbiota, acting on several receptors including the G protein-coupled bile acid receptor 1 (GPBAR1 or Takeda G-protein receptor 5) and the Farnesoid-X-Receptor (FXR). Both receptors are placed at the interface of the host immune system with the intestinal microbiota and are highly represented in cells of innate immunity such as intestinal and liver macrophages, dendritic cells and natural killer T cells. Here, we review how GPBAR1 and FXR modulate the intestinal and liver innate immune system and contribute to the maintenance of a tolerogenic phenotype in entero-hepatic tissues, and how regulation of innate immunity might help to explain beneficial effects exerted by GPBAR1 and FXR ligands in immune and metabolic disorders.

Bile acids (BAs) are experiencing a new life. Next to their ancestral roles in lipid digestion and solubilization, BAs are today recognized signaling molecules involved in many physiological functions. These signaling pathways involve the activation of metabolic nuclear receptors, mainly the BA sensor FXR, and the dedicated membrane G protein-coupled receptor, GPBAR1 (TGR5). As a consequence, the discovery of GPBAR1/FXR selective or dual modulators represents an important answer to the urgent demand of new pharmacological opportunity for several human diseases including dyslipidemia, cholestasis, nonalcoholic steatohepatitis, Type 2 diabetes and inflammation. Targeted oriented discovery of natural compounds and medicinal chemistry manipulation have allowed the development of promising drug candidates.

Liver fibrosis, a major health concern worldwide, results from abnormal collagen deposition by activated hepatic stellate cells (HSCs) in an injured liver. The farnesoid-x-receptor (FXR) is a bile acid sensor that counteracts HSCs transdifferentiation. While targeting FXR holds promise, 6-ethyl-CDCA known as obeticholic acid, the first in class of FXR ligands, causes side effects, partially because the lack of selectivity toward GPBAR1, a putative itching receptor. Here, we describe the 3-deoxy-6-ethyl derivative of CDCA, BAR704, as a highly selective steroidal FXR agonist. Methods Liver Fibrosis was induced in mice by carbon tetrachloride (CCl4). Main results In transactivation assay BAR704 activated FXR with and EC50 of 967 nM while exerted no agonistic activity on other receptors including GPBAR1. In naive mice, BAR704 modulated the expression of FXR target genes in the liver of wild type mice but not in FXR−/− mice. In cirrhotic mice, administration of BAR704, 15 mg/kg for 9 weeks, spared the liver biosynthetic activity (bilirubin and albumin plasma levels), reduced liver fibrosis score (Sirius red staining), expression of pro-fibrogenetic (Colα1α, TGFβ and αSMA) and inflammatory genes (IL-1β, TNFα) and portal pressure. From mechanistic stand point, we have found that exposure of LX2 cells, a human HSCs line, to BAR704 increased the transcription of the short heterodimer partner (SHP) and induced the binding of this nuclear receptor to SMAD3, thus abrogating the binding of phosho-SMAD3 to the TGFβ promoter. Conclusions and applications. BAR704 is a selective FXR agonist that reduces liver fibrosis by interfering with the TGFβ-SMAD3 pathway in HSCs. Selective FXR agonists may represent an attractive strategy for the treatment of liver fibrosis.

Bile acids are extensively investigated for their potential in the treatment of human disorders. The liver X receptors (LXRs), activated by oxysterols and by a secondary bile acid named hyodeoxycholic acid (HDCA), have been found essential in the regulation of lipid homeostasis in mammals. Unfortunately, LXRα activates lipogenic enzymes causing accumulation of lipid in the liver. In addition to LXRs, HDCA has been also shown to function as ligand for GPBAR1, a G protein coupled receptor for secondary bile acids whose activation represents a promising approach to liver steatosis. In the present study, we report a library of HDCA derivatives endowed with modulatory activity on the two receptors. The lead optimization of HDCA moiety was rationally driven by the structural information on the binding site of the two targets and results from pharmacological characterization allowed the identification of hyodeoxycholane derivatives with selective agonistic activity toward LXRα and GPBAR1 and notably to the identification of the first example of potent dual LXRα/GPBAR1 agonists. The new chemical entities might hold utility in the treatment of dyslipidemic disorders.

Bile acids are end products of cholesterol metabolism generated in the liver and released in the intestine. Primary and secondary bile acids are the result of the symbiotic relation between the host and intestinal microbiota. In addition to their role in nutrient absorption, bile acids are increasingly recognized as regulatory signals that exert their function beyond the intestine by activating a network of membrane and nuclear receptors. The best characterized of these bile acid-activated receptors, GPBAR1 (also known as TGR5) and the farnesosid-X-receptor (FXR), have also been detected in the vascular system and their activation mediates the vasodilatory effects of bile acids in the systemic and splanchnic circulation. GPBAR1, is a G protein-coupled receptor, that is preferentially activated by lithocholic acid (LCA) a secondary bile acid. GPBAR1 is expressed in endothelial cells and liver sinusoidal cells (LSECs) and responds to LCA by regulating the expression of both endothelial nitric oxide synthase (eNOS) and cystathionine-γ-lyase (CSE), an enzyme involved in generation of hydrogen sulfide (H2S). Activation of CSE by GPBAR1 ligands in LSECs is due to genomic and nongenomic effects, involves protein phosphorylation, and leads to release of H2S. Despite that species-specific effects have been described, vasodilation caused by GPBAR1 ligands in the liver microcirculation and aortic rings is abrogated by inhibition of CSE but not by eNOS inhibitor. Vasodilation caused by GPBAR1 (and FXR) ligands also involves large conductance calcium-activated potassium channels likely acting downstream to H2S. The identification of GPBAR1 as a vasodilatory receptor is of relevance in the treatment of complex disorders including metabolic syndrome-associated diseases, liver steatohepatitis, and portal hypertension.

Bile acids are signaling molecules interacting with the nuclear receptor FXR and the G-protein coupled receptor 1 (GP-BAR1/TGR5). GP-BAR1 is a promising pharmacological target for the treatment of steatohepatitis, type 2 diabetes, and obesity. Endogenous bile acids and currently available semisynthetic bile acids are poorly selective toward GP-BAR1 and FXR. Thus, in the present study we have investigated around the structure of UDCA, a clinically used bile acid devoid of FXR agonist activity, to develop a large family of side chain modified 3α,7β-dihydroxyl cholanoids that selectively activate GP-BAR1. In vivo and in vitro pharmacological evaluation demonstrated that administration of compound 16 selectively increases the expression of pro-glucagon 1, a GP-BAR1 target, in the small intestine, while it had no effect on FXR target genes in the liver. Further, compound 16 results in a significant reshaping of bile acid pool in a rodent model of cholestasis. These data demonstrate that UDCA is a useful scaffold to generate novel and selective steroidal ligands for GP-BAR1.

Chemical analysis of the organic extract of Theonella swinhoei yielded two new tridecadepsipeptides of the theonellapeptolide family, namely sulfinyltheonellapeptolide, characterized by a methylsulfinylacetyl group at the N-terminus, and theonellapeptolide If, the first member of this class of compounds to show four valine residues. The structures of the compounds, isolated along with the known theonellapeptolide Id, were determined by extensive 2D NMR and MS/MS analyses followed by application of Marfey’s method. The isolated peptides exhibited moderate antiproliferative activity against HepG2 cells, a hepatic carcinoma cell line.

Plakortides R–U, four new polyketide endoperoxides, have been isolated from the marine sponge Plakinastrella mamillaris. Their structures were elucidated on the basis of extensive NMR spectroscopic (1H and 13C, COSY, HSQC, HMBC, and ROESY) and MS analyses and by chemical methods. In addition, a new method for the unambiguous stereochemical elucidation of 3,6-disubstituted 1,2-dioxines, frequently isolated from Plakinidae sponges, is reported. Pharmacological analysis demonstrated that plakortide U is endowed with in vitro antiplasmodial activity against a chloroquine-resistant strain.

Using theonellasterol as a novel FXR antagonist hit, we prepared a series of semi-synthetic derivatives in order to gain insight into the structural requirements for exhibiting antagonistic activity. These derivatives are characterized by modification at the exocyclic carbon-carbon double bond at C-4 and at the hydroxyl group at C-3 and were prepared from theonellasterol using simple reactions. Pharmacological investigation showed that the introduction of a hydroxyl group at C-4 as well as the oxidation at C-3 with or without concomitant modification at the exomethylene functionality preserve the ability of theonellasterol to inhibit FXR transactivation caused by CDCA. Docking analysis showed that the placement of these molecules in the FXR-LBD is well stabilized when on ring A functional groups, able to form hydrogen bonds and π interactions, are present.

Diastereomers of 3-amino-2-hydroxy-6-methylheptanoic acid (AHMHA), a new amino acid unit in perthamides C and D, have been synthesized from commercially available 4-methylpentanol in a concise manner and 50% average overall yield. Comparison of the 1H and 13C NMR data, optical rotation data and Marfey’s analysis of the resulting isomers with the natural fragment unambiguously allowed the configurational assignment of the natural residue as (2R,3R). A structural revision of perthamides C and D is also reported.

An efficient and highly stereocontrolled synthesis of (2R,3R,4R,6R)-3-hydroxy-2,4,6-trimethyloctanoic acid, the β-hydroxy acid unit that acylates the N-terminus of homophymine A, has been devised starting from iodoethane and (S,S)-pseudoephedrine propionamide in 9 steps and 36% average overall yield. Comparison of the 1H and 13C NMR and optical rotation data of the resulting β-hydroxy acid with the natural fragment unambiguously verifies the configurational assignment as (2R,3R,4R,6R).

Four new jaspamide derivs. (e.g. I, jaspamide M) with antimicrofilament activity were isolated from the marine sponge Jaspis splendans. Their structures were elucidated by NMR and MS analalysis. A structure-activity relationship analalysis on all natural jaspamides is also reported

Peroxiredoxin-1, a key enzyme in the cellular detoxification pathway, has been identified through a chemoproteomic approach as the main partner of theonellasterone, a marine bioactive metabolite. A combination of chemical and biochemical assays disclosed its mechanism of action at the molecular level.

GPBAR1 is a bile acid-activated receptor (BAR) for secondary bile acids, lithocholic (LCA) and deoxycholic acid (DCA), expressed in the enterohepatic tissues and in the vasculature by endothelial and smooth muscle cells. Despite that bile acids cause vasodilation, it is unclear why these effects involve GPBAR1, and the vascular phenotype of GPBAR1 deficient mice remains poorly defined. Previous studies have suggested a role for nitric oxide (NO) in regulatory activity exerted by GPBAR1 in liver endothelial cells. Hydrogen sulfide (H2S) is a vasodilatory agent generated in endothelial cells by cystathionine-γ-lyase (CSE). Here we demonstrate that GPBAR1 null mice had increased levels of primary and secondary bile acids and impaired vasoconstriction to phenylephrine. In aortic ring preparations, vasodilation caused by chenodeoxycholic acid (CDCA), a weak GPBAR1 ligand and farnesoid-x-receptor agonist (FXR), was iberiotoxin-dependent and GPBAR1-independent. In contrast, vasodilation caused by LCA was GPBAR1 dependent and abrogated by propargyl-glycine, a CSE inhibitor, and by 5β-cholanic acid, a GPBAR1 antagonist, but not by N5-(1-iminoethyl)-l-ornithine (l-NIO), an endothelial NO synthase inhibitor, or iberiotoxin, a large-conductance calcium-activated potassium (BKCa) channels antagonist. In venular and aortic endothelial (HUVEC and HAEC) cells GPBAR1 activation increases CSE expression/activity and H2S production. Two cAMP response element binding protein (CREB) sites (CREs) were identified in the CSE promoter. In addition, TLCA stimulates CSE phosphorylation on serine residues. In conclusion we demonstrate that GPBAR1 mediates the vasodilatory activity of LCA and regulates the expression/activity of CSE. Vasodilation caused by CDCA involves BKCa channels. The GPBAR1/CSE pathway might contribute to endothelial dysfunction and hyperdynamic circulation in liver cirrhosis.

Bile acids can regulate nutrient metabolism through the activation of the cell membrane receptor GPBAR1 and the nuclear receptor FXR. Developing an exogenous control over these receptors represents an attractive strategy for the treatment of enterohepatic and metabolic disorders. A number of dual GPBAR1/FXR agonists are known, however their therapeutic use is limited by multiple unwanted effects due to activation of the diverse downstream signals controlled by the two receptors. On the other hand, designing selective GPBAR1 and FXR agonists is challenging since the two proteins share similar structural requisites for ligand binding. Here, taking advantage of our knowledge of the two targets, we have identified through a rational drug design study a series of amine lithocholic acid derivatives as selective GPBAR1 agonists. The presence of the 3α-NH2 group on the steroidal scaffold is responsible for the selectivity over FXR unveiling unprecedented structural insights into bile acid receptors activity modulation.

An improved synthesis of 1 (R = SiPh2CMe3, R1 = SiMe2CMe3) which contains the C23-C35 moiety of reidispongiolide A, was completed. An intermol. Nozaki-Hiyama-Kishi coupling was employed for the union of C23-C30 and C31-C35 fragments. A discussion on the factors influencing the stereochem. outcome of (E)-crotylboration reactions of alpha-methyl-beta-alkoxy aldehydes was also presented.

Callipeltin A is a cyclic depsidecapeptide isolated from the marine sponges Callipelta sp. and Latrunculia sp. that has been previously shown to increase the force of contraction of guinea-pig atria through the inhibition of Na+/Ca2+ exchanger (NCX). We investigated the effect of callipeltin A on guinea-pig aortic rings contracted by procedures that activate NCX in “calcium entry mode”. Callipeltin A did not inhibit these contractions. Resting aorta responded to callipeltin A with a remarkable contraction that was concentration-dependent (EC50 0.44 μM). This contraction was not inhibited by the calcium channel blocker verapamil and was not mediated by the activation of alpha-adrenergic or endothelin-1 receptors. Pre-incubation of aortic rings with 0.5 mM amiloride, an inhibitor of NCX, completely prevented callipeltin A-induced contraction. Furthermore, callipeltin A (EC50 0.51 μM) increased Na+ efflux of Na-loaded erythrocytes. 1 H and 13 C NMR resonances of callipeltin A revealed small but significant changes in the titration with K+ and Na+ salts. It is suggested that the effect of callipeltin A on cardiac and vascular preparations is linked to a Na-ionophore action.