Search

Background: The existence of age-associated alterations in immune functions and neuropeptides capable of modulating these functions prompted us to advance the hypothesis that the degradation of plasma neuropeptides, specifically opioid peptides, may be altered by aging. Objective: To verify the possible existence of age-induced variations in neuropeptide hydrolysis in human plasma, using leucine enkephalin as the model substrate. Methods: The hydrolysis of leucine enkephalin and the formation of its hydrolysis byproducts in the presence of plasma enzymes were studied by kinetic and chromatographic techniques in a group of elderly individuals and a control group. Results: The results obtained indicate that in elderly individuals the activity of enkephalin-degrading plasma enzymes is greater than in controls. ANOVA analysis of these data indicates that the dependency of the variation of hydrolysis upon the 2 age groups is statistically significant. Increased substrate hydrolysis, and a modified hydrolysis pattern, appear to be associated with increased activity of the enzymes involved, and with different distribution of the individual enzymes within each class, as well as with severely reduced activity of the low molecular weight plasma inhibitors. Conclusion: The combination of the above-mentioned factors appears to define a characteristic hydrolysis pattern for elderly individuals which is different from that found in controls.

Cystic Fibrosis (CF) is characterized by an airway obstruction caused by a thick mucus due to a malfunctioning Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. The sticky mucus restricts drugs in reaching target cells limiting the efficiency of treatments. The development of new approaches to enhance drug delivery to the lungs represents CF treatment's main challenge. In this work, we report the synthesis and characterization of hybrid core-shell nanoparticles (hNPs) comprising a PLGA core and a dipalmitoylphosphatidylcholine (DPPC) shell engineered for inhalation. We loaded hNPs with a 7-mer peptide nucleic acid (PNA) previously considered for its ability to modulate the post-transcriptional regulation of the CFTR gene. We also investigated the in vitro release kinetics of hNPs and their efficacy in PNA delivery across the human epithelial airway barrier using an ex vivo model based on human primary nasal epithelial cells (HNEC) from CF patients. Confocal analyses and hNPs transport assay demonstrated the ability of hNPs to overcome the mucus barrier and release their PNA cargo within the cytoplasm, where it can perform its biological function.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus. In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.

By combining the ability of short G-rich oligodeoxyribonucleotides (ODNs) containing the sequence 5’CGGA3’ to form higher order G-quadruplex (G4) complexes with the tetra-end-linked (TEL) concept to produce aptamers targeting the HIV envelope glycoprotein 120 (gp120), three new TEL-ODNs (1–3) having the sequence 5’CGGAGG3’ were synthesized with the aim of studying the effect of G4 dimerization on their anti-HIV activity. Furthermore, in order to investigate the effect of the groups at the 5’ position, the 5’ ends of 1–3 were left uncapped (1) or capped with either the lipophilic dimethoxytrityl (DMT) (2) or the hydrophilic glucosyl-4-phosphate (3) moieties. The here reported results demonstrate that only the DMT-substituted TEL-ODN 2 is effective in protecting human MT-4 cell cultures from HIV infection (76% max protection), notwithstanding all the three new aptamers proved to be capable of forming stable higher order dimeric G4s when annealed in K+-containing buffer, thus suggesting that the recognition of a hydrophobic pocket on the target glycoprotein by the aptamers represents a main structural feature for triggering their anti-HIV activity.

&epsilon, poly-l-Lysine (&epsilon, PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. &epsilon, PLL and its synthetic analogue &alpha, poly-l-lysine (&alpha, PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of &alpha, PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with &alpha, PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that &alpha, PLL is capable of binding with &micro, M affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting &alpha, PLL/G4 complexes which support the use of &alpha, PLL as a G4 ligand capable of discriminating among different G4 topologies.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the &ldquo, northern&rdquo, ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5&prime, sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.

In this paper, we report on the synthesis and spectroscopic characterization of the novel nucleoside 5′-chloro-5′-deoxy-2′,3′-O-isopropylidene-6-fluoro nebularine, obtained as a side product during the second step of the synthesis of 5′-fluoro-5′-deoxy-5-aminoimidazole-4-carboxamide-β-d-riboside (5′-F-AICAR), a non-phosphorylable analogue of 5-aminoimidazole-4-carboxamide-β-d-riboside (AICAR).

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC&ndash, size-exclusion chromatography (HPLC&ndash, SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG4T)4. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.

In the search for potential nucleoside/non-nucleoside mixed type inhibitors of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase, we synthesized a new set of rifamycin S derivatives, containing AZT connected via its hydroxyl at 5′ C, through a spacer, to the third C of rifamycin S. The length of the spacer was eight, nine or 14 atoms. Rifamycin S was also used in its 21, 23-O, O-isopropylidene derivative form, and in one case thymidine replaced AZT. These nucleosidyl rifamycins were weak inhibitors of isolated HIV-1 reverse transcriptase. The inhibitory power was weak most probably because their large molecular volume hindered the inhibition process. With the exception of the thymidine derivative, the AZT derivatives, at concentrations in the range 0.04–0.07 μM, proved non-toxic and inhibited the replication of HIV-1 in C8166 T lymphocytes. This activity appears to be owing to AZT released by the derivatives upon hydrolysis in solution. The present compounds require further development as mixed type reverse transcriptase inhibitors and can be considered non-toxic lipophilic prodrugs of AZT.