Search

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods . Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion . The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion . A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

Recent years a worldwide interest in the use of alternative sources of protein, in particular, protein from insects, has increased. Edible insects for thousands of years have been a part of the human diet in Asian-Pacific region and South America, while in the European Union, the USA and Canada the use of insects for food purposes is a modern trend that is determined by the care of the environment, global warming combating, etc. Thus, the legal rules governing the food use of insects have significant differences among countries. In the Eurasian Economic Union requirements to food are regulated by the Customs Union Technical Regulations. Since none of the Technical Regulations contains the name of such food as "products obtained with the use of insects", these products may be classified as "food products of novel type" which are subjected to state registration. Fundamental and applied research should be conducted as a part of this novel food safety assessment system, that include the determination of nutritional and biological value of food raw materials derived from insects, and toxicological, reprotoxicological, allergological experiments in vivo on several generations of laboratory animals. The aim of the research was studying and comparing the nutritional and biological values of Hermetia illucens larvae dry biomass and basic foodstuffs of animal and plant origin. Material and methods . Nutritional and biological value analysis of H. illucens minced dry larvae biomass, dried at 110-120 °C, was carried out on 83 indicators, which included determination of protein content and amino acid composition, determination of fat level and fatty acid composition, determination of the content of carbohydrates, vitamins, minerals and trace elements, ash and moisture. Results . A study of the nutritional value of dry larvae biomass showed high levels of protein and fat (39 and 38%, respectively), while ash, dietary fiber and carbohydrate accounted for less than 20%. The amino acid profile had a balanced content of essential amino acids and was comparable to the protein of a hen's egg, as well as other animal products. The fatty acid composition of the biomass was characterized by a relatively high content of lauric acid (39.9% of the total fatty acid content), also found in some fruits and seeds of tropical plants; the ratio of other acids was more consistent with the fatty acid profile of fish oil. The dry larvae biomass contained carotenoids (0.23 mg/100 g), tocopherol (3.1 mg/100 g) and thiamine (53 μg/100 g) in amounts significantly lower to those of foods, which traditionally are sources of these vitamins. Based on the analysis of the mineral composition, the H. illucens biomass can be attributed to the sources of calcium, iron, copper and chromium. In terms of the content of the above elements, as well as magnesium and zinc, dry biomass significantly exceed the main food products of animal origin (beef, eggs, fish and seafood), and in terms of the content of potassium and phosphorus, it was comparable to them. Conclusion . The results of dry larvae biomass comparative evaluation with the basic foodstuffs of animal and plant origin evidence to its high nutritional and biological value, allowing to consider H. illucens as a promising source of complete protein, lauric acid, minerals and trace elements., Competing Interests: The authors declare no overt and potential conflict of interest related to the publication of this article., (Copyright© GEOTAR-Media Publishing Group.)

A high protein content in the insect biomass allows to classify this product as a very promising source of protein, comparable in nutritional and biological value with proteins of animal origin. Despite a long history of safe use, in some countries insects are considered a new type of food which safety must be proven before entering the food market. The long-term Russian experience in novel food's research allows to identify the crucial stages, among which, along with toxicological and allergological tests, the protein's biological value determination takes an important place. The conclusion about the biological value of protein is formed on the basis of integrated use of chemical and biological methods, which gist comes down to the study of the nitrogen balance in the growing organism (biological method) and the calculation of the amino acid score (chemical method). The aim of the research was the comprehensive assessment of Black soldier fly (Hermetia illucens) larvae protein's biological value using chemical and biological methods. Material and methods . Biological studies based on measuring of net protein ratio/net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats, with an initial body weight of ~65.5±1.2 g. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of H. illucens protein. The diet's ingredients were replaced with the consideration of the proteins, fats, and carbohydrates content in the included product following the principle of isocaloricity and isonitrogenicity (by mass fraction of total nitrogen). H. illucens biomass and casein in the test and control groups, respectively, were the main significant sources of nitrogen in the diet. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Chemical studies included studies of the amino acid composition of H. illucens biomass protein and calculation of the digestible indispensable amino acid score (DIAAS). Results . The general condition of animals of the both groups during the whole experiment was satisfactory, the weekly body weight increase corresponded to the level of growth typical for Wistar rats, intergroup differences were not detected. Despite the fact that in a number of indicators the test group animals differed from the control [there were noted a decrease of the net protein ratio (by 5%, p>0.05), true protein digestibility (by 11%, p<0.05), net protein utilization (by 13%, p<0.05), caused by increased excretion of nitrogen with urine (by 8%, p>0.05) and feces (by 186%, p<0.05), with the same amount of nitrogen intake], the test rats' growth rate and the nitrogen's retention degree indicate a relatively high biological value of insect protein. According to the DIAAS, H. illucens protein is characterized by high content of histidine, threonine, valine, isoleucine and leucine (DIAAS=100 and more), and is also a source of sulfur-containing amino acids - methionine and cysteine (DIAAS=86) and lysine (DIAAS=97). Conclusion . The comprehensive studies of Hermetia illucens larvae protein's biological value demonstrated a high protein content, its balanced amino acid composition and high biological value, which allows to consider Hermetia illucens as a potential source of complete dietary protein., Competing Interests: The authors declare no overt and potential conflict of interest related to the publication of this article., (Copyright© GEOTAR-Media Publishing Group.)