Search

Guanine quadruplexes (GQs) are four-stranded DNA/RNA structures exhibiting an important polymorphism. During the past two decades, their study by time-resolved spectroscopy, from femtoseconds to milliseconds, associated to computational methods, shed light on the primary processes occurring when they absorb UV radiation. Quite recently, their utilization in label-free and dye-free biosensors was explored by a few groups. In view of such developments, this review discusses the outcomes of the fundamental studies that could contribute to the design of future optoelectronic biosensors using fluorescence or charge carriers stemming directly from GQs, without mediation of other molecules, as it is the currently the case. It explains how the excited state relaxation influences both the fluorescence intensity and the efficiency of low-energy photoionization, occurring via a complex mechanism. The corresponding quantum yields, determined with excitation at 266/267 nm, fall in the range of (3.0-9.5) × 10 -4 and (3.2-9.2) × 10 -3 , respectively. These values, significantly higher than the corresponding values found for duplexes, depend strongly on certain structural factors (molecularity, metal cations, peripheral bases, number of tetrads …) which intervene in the relaxation process. Accordingly, these features can be tuned to optimize the desired signal., (© 2023 The Authors. Photochemistry and Photobiology published by Wiley Periodicals LLC on behalf of American Society for Photobiology.)

The paper deals with the fluorescence of guanine quadruplexes (G4) formed by association of two DNA strands d(GGGGTTTTGGGG) in the presence of K + cations, noted as OXY/K + in reference to the protozoon Oxytricha nova , whose telomere contains TTTTGGGG repeats. They were studied by steady-state and time-resolved techniques, time-correlated single photon counting, and fluorescence upconversion. The maximum of the OXY/K + fluorescence spectrum is located at 334 nm, and the quantum yield is 5.8 × 10 -4 . About 75% of the photons are emitted before 100 ps and stem from ππ* states, possibly with a small contribution of charge transfer. Time-resolved fluorescence anisotropy measurements indicate that ultrafast (<330 fs) excitation transfer, due to internal conversion among exciton states, is more efficient in OXY/K + compared to previously studied G4 structures. This is attributed to the arrangement of the peripheral thymines in two diagonal loops with restricted mobility, facilitating the interaction among them and with guanines. Thymines should also be responsible for a weak intensity excimer/exciplex emission band, peaking at 445 nm. Finally, the longest living fluorescence component (∼2.1 ns) is observed at the blue side of the spectrum. So far, high-energy long-lived emitting states had been reported only for double-stranded structures but not for G4.

The study deals with four-stranded DNA structures (G-Quadruplexes), known to undergo ionization upon direct absorption of low-energy UV photons. Combining quantum chemistry calculations and time-resolved absorption spectroscopy with 266 nm excitation, it focuses on the electron holes generated in tetramolecular systems with adenine groups at the ends. Our computations show that the electron hole is placed in a single guanine site, whose location depends on the position of the adenines at the 3' or 5' ends. This position also affects significantly the electronic absorption spectrum of (G + ) ● radical cations. Their decay is highly anisotropic, composed of a fast process (<2 µs), followed by a slower one occurring in ~20 µs. On the one hand, they undergo deprotonation to (G-H2) ● radicals and, on the other, they give rise to a reaction product absorbing in the 300-500 nm spectral domain.

Guanine quadruplexes are four-stranded DNA/RNA structures composed of a guanine core (vertically stacked guanine tetrads) and peripheral groups (dangling ends and/or loops). Such a dual structural arrangement of the nucleobases favors their photoionization at energies significantly lower than the guanine ionization potential. This effect is important with respect to the oxidative DNA damage and for applications in the field of optoelectronics. Photoionization quantum yields, determined at 266 nm by nanosecond transient absorption spectroscopy, strongly depend on both the type and position of the peripheral nucleobases. The highest value (1.5 × 10 -2 ) is found for the tetramolecular structure (AG 4 A) 4 in which adenines are intermittently stacked on the adjacent guanine tetrads, as determined by nuclear magnetic resonance spectroscopy. Quantum chemistry calculations show that peripheral nucleobases interfere in a key step preceding electron ejection: charge separation, initiated by the population of charge transfer states during the relaxation of electronic excited states.

The study deals with the primary species, ejected electrons, and guanine radicals, leading to oxidative damage, that is generated in four-stranded DNA structures (guanine quadruplexes) following photo-ionization by low-energy UV radiation. Performed by nanosecond transient absorption spectroscopy with 266 nm excitation, it focusses on quadruplexes formed by folding of GGG(TTAGGG) 3 single strands in the presence of K + ions, TEL21/K + . The quantum yield for one-photon ionization (9.4 × 10 -3 ) was found to be twice as high as that reported previously for TEL21/Na + . The overall population of guanine radicals decayed faster, their half times being, respectively, 1.4 and 6.7 ms. Deprotonation of radical cations extended over four orders of magnitude of time; the faster step, concerning 40% of their population, was completed within 500 ns. A reaction intermediate, issued from radicals, whose absorption spectrum peaked around 390 nm, was detected.

G-Quadruplexes are formed by guanine rich DNA/RNA sequences in the presence of metal ions, which occupy the central cavity of these four-stranded structures. We show that these metal ions have a significant effect on the photogeneration and the reactivity of guanine radicals. Transient absorption experiments on G-quadruplexes formed by association of four TGGGGT strands in the presence of K + reveal that the quantum yield of one-photon ionization at 266 nm (8.1 × 10 -3 ) is twice as high as that determined in the presence of Na + . Replacement of Na + with K + also suppresses one reaction path involving deprotonated radicals, (G-H2) • → (G-H1) • tautomerization. Such behavior shows that the underlying mechanisms are governed by dynamical processes, controlled by the mobility of metal ions, which is higher for Na + than for K + . These findings may contribute to our understanding of the ultraviolet-induced DNA damage and optimize optoelectronic devices based on four-stranded structures, beyond DNA.

Guanine quadruplexes (G4) are four-stranded DNA structures involved in biological processes and are promising candidates for potential nanotechnological applications. This study examines how the G4 topology affects the electronic absorption and the delocalization of electron holes, which play a key role in charge transport and oxidative damage. Combining transient absorption spectroscopy with PCM/TD-DFT calculations both parallel (P) and antiparallel (A) G4 are investigated, which are formed, respectively, by association of four TGGGGT strands and folding of the human telomeric sequence GGG(TTAGGG) 3 . The experimental absorption spectra obtained upon photo-ionization of A and P are different. This is explained by the different topology of the two G4, as well as by hole delocalization between two stacked guanines, possible only in P + . The spectral signature of delocalized hole in guanine-rich regions is provided and the chemical physical effects which rule the hole delocalization are discussed., (© 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Telomeres, which are involved in cell division, carcinogenesis, and aging and constitute important therapeutic targets, are prone to oxidative damage. This propensity has been correlated with the presence of guanine-rich sequences, capable of forming four-stranded DNA structures (G-quadruplexes). Here, we present the first study on oxidative damage of human telomere G-quadruplexes without mediation of external molecules. Our investigation has been performed for G-quadruplexes formed by folding of GGG(TTAGGG) 3 single strands in buffered solutions containing Na + cations (TEL21/Na + ). Associating nanosecond time-resolved spectroscopy and quantum mechanical calculations (TD-DFT), it focuses on the primary species, ejected electrons and guanine radicals, generated upon absorption of UV radiation directly by TEL21/Na + . We show that, at 266 nm, corresponding to an energy significantly lower than the guanine ionization potential, the one-photon ionization quantum yield is 4.5 × 10 -3 . This value is comparable to that of cyclobutane thymine dimers (the major UV-induced lesions) in genomic DNA; the quantum yield of these dimers in TEL21/Na + is found to be (1.1 ± 0.1) × 10 -3 . The fate of guanine radicals, generated in equivalent concentration with that of ejected electrons, is followed over 5 orders of magnitude of time. Such a quantitative approach reveals that an important part of radical cation population survives up to a few milliseconds, whereas radical cations produced by chemical oxidants in various DNA systems are known to deprotonate, at most, within a few microseconds. Under the same experimental conditions, neither one-photon ionization nor long-lived radical cations are detected for the telomere repeat TTAGGG in single-stranded configuration, showing that secondary structure plays a key role in these processes. Finally, two types of deprotonated radicals are identified: on the one hand, (G-H 2 ) • radicals, stable at early times, and on the other hand, (G-H 1 ) • radicals, appearing within a few milliseconds and decaying with a time constant of ∼50 ms.

Doxorubicin (DOX) is a natural anthracycline widely used in chemotherapy; its combined application as a chemotherapeutic and photodynamic agent has been recently proposed. In this context, understanding the photoinduced properties of DOX complexes with nucleic acids is crucial. Herein, the study of photoinduced electron transfer in DOX-DNA complexes by femtosecond fluorescence spectroscopy is reported. The behaviour of complexes with two model DNA structures, a G-quadruplex (G4) formed by the human telomeric sequence (Tel21) and a d(GC) duplex, is compared. The DOX affinity for these two sequences is similar. Although both 1:1 and 2:1 stoichiometries have been reported for DOX-G4 complexes, only 1:1 complexes form with the duplex. The steady-state absorption indicates a strong binding interaction with the duplex due to drug intercalation between the GC base pairs. In contrast, the interaction of DOX with Tel21 is much weaker and arises from drug binding on the G4 external faces at two independent binding sites. As observed for DOX-d(GC) complexes, fluorescence of the drug in the first binding site of Tel21 exhibits decays within a few picoseconds following a biphasic pattern; this is attributed to the existence of two drug conformations. The fluorescence of the drug in the second binding site of Tel21 shows slower decays within 150 ps. These timescales are consistent with electron transfer from the guanines to the excited drug, as favoured by the lower oxidation potential of the stacked guanines of G4 with respect to those in the duplex., (© 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K(+) cations, noted Tel21/K(+) . Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K(+) is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects., (© 2014 The American Society of Photobiology.)

Guanine rich DNA strands, such as those encountered at the extremities of human chromosomes, have the ability to form four-stranded structures (G-quadruplexes) whose building blocks are guanine tetrads. G-quadruplex structures are intensively studied in respect of their biological role, as targets for anticancer therapy and, more recently, of their potential applications in the field of molecular electronics. Here we focus on their electronic excited states which are compared to those of non-interacting mono-nucleotides and those of single and double stranded structures. Particular emphasis is given to excited state relaxation processes studied by time-resolved fluorescence spectroscopy from femtosecond to nanosecond time scales. They include ultrafast energy transfer and trapping of ππ* excitations by charge transfer states. The effect of various structural parameters, such as the nature of the metal cations located in the central cavity of G-quadruplexes, the number of tetrads or the conformation of the constitutive single strands, are examined.