Search

Pro-inflammatory cytokines are critical in mechanisms of muscle atrophy. In addition, asparagine (Asn) is necessary for protein synthesis in mammalian cells. We hypothesised that Asn could attenuate lipopolysaccharide (LPS)-induced muscle atrophy in a piglet model. Piglets were allotted to four treatments (non-challenged control, LPS-challenged control, LPS+0·5 % Asn and LPS+1·0 % Asn). On day 21, the piglets were injected with LPS or saline. At 4 h post injection, piglet blood and muscle samples were collected. Asn increased protein and RNA content in muscles, and decreased mRNA expression of muscle atrophy F-box (MAFbx) and muscle RING finger 1 (MuRF1). However, Asn had no effect on the protein abundance of MAFbx and MuRF1. In addition, Asn decreased muscle AMP-activated protein kinase (AMPK) α phosphorylation, but increased muscle protein kinase B (Akt) and Forkhead Box O (FOXO) 1 phosphorylation. Moreover, Asn decreased the concentrations of TNF-α, cortisol and glucagon in plasma, and TNF-α mRNA expression in muscles. Finally, Asn decreased mRNA abundance of muscle toll-like receptor (TLR) 4 and nucleotide-binding oligomerisation domain protein (NOD) signalling-related genes, and regulated their negative regulators. The beneficial effects of Asn on muscle atrophy may be associated with the following: (1) inhibiting muscle protein degradation via activating Akt and inactivating AMPKα and FOXO1; and (2) decreasing the expression of muscle pro-inflammatory cytokines via inhibiting TLR4 and NOD signalling pathways by modulation of their negative regulators.

Musk secreted by male forest musk deer (Moschus berezovskii) musk glands is an invaluable component of medicine and perfume. Musk secretion depends on musk gland maturation; however, the mechanism of its development remains elusive. Herein, using single cell multiome ATAC + gene expression coupled with several bioinformatic analyses, a dynamic transcriptional cell atlas of musk gland development was revealed, and key genes and transcription factors affecting its development were determined. Twelve cell types, including two different types of acinar cells (Clusters 0 and 10) were identified. Single‐nucleus RNA and single‐nucleus ATAC sequencing analyses revealed that seven core target genes associated with musk secretion (Hsd17b2, Acacb, Lss, Vapa, Aldh16a1, Aldh7a1, and Sqle) were regulated by 12 core transcription factors (FOXO1, CUX2, RORA, RUNX1, KLF6, MGA, NFIC, FOXO3, ETV5, NR3C1, HSF4, and MITF) during the development of Cluster 0 acinar cells. Kyoto Encyclopedia of Genes and Genomes enrichment showed significant changes in the pathways associated with musk secretion during acinar cell development. Gene set variation analysis also revealed that certain pathways associated with musk secretion were enriched in 6‐year‐old acinar cells. A gene co‐expression network was constructed during acinar cell development to provide a precise understanding of the connections between transcription factors, genes, and pathways. Finally, intercellular communication analysis showed that intercellular communication is involved in musk gland development. This study provides crucial insights into the changes and key factors underlying musk gland development, which serve as valuable resources for studying musk secretion mechanisms and promoting the protection of this endangered species. [ABSTRACT FROM AUTHOR]

Objective: The aim of this study was to investigate the molecular mechanism by which the transcription factor ETS1 regulates N‐myc downstream regulatory gene 1 (NDRG1) to provide a new theoretical basis for the study of oral squamous cell carcinoma (OSCC). Methods: In this study, eight human OSCC and paraneoplastic samples were collected. The expressions of NDRG1, ETS1, and Ki67 were detected by immunohistochemistry; apoptosis was detected by tdt‐mediated dUTP notched end labeling; cell migration and invasion were detected by Transwell; quantitative real‐time PCR was performed to detect the expression of NDRG1; RNA‐binding protein immunoprecipitation (RIP) assays detected NDRG1 expression; immunofluorescence assays detected ETS1 expression. Results: NDRG1 and ETS1 expression was significantly upregulated in cancer tissues and CAL‐27 and SCC‐6 cells. Knockdown of NDRG1 and ETS1 inhibited cell proliferation, migration, invasion, cloning, and EMT while promoting apoptosis and inhibited tumor development; ETS1 positively regulated NDRG1 expression; Finally, overexpression of NDRG1 in vivo and in vitro reversed the effect of ETS1 knockdown on CAL‐27 and SCC‐6 cells. Conclusions: ETS1 positively regulates the expression of NDRG1 and promotes OSCC. Therefore, ETS1 may serve as a new target for the clinical diagnosis and treatment of OSCC. [ABSTRACT FROM AUTHOR]

APMAP is single transmembrane arylesterase which plays a cardinal role in adipogenesis. In this experiment, three tissue and blood samples of Rex rabbits at 3 growing periods were selected. The expression levels of APMAP gene in different tissues were detected by real-time fluorescence quantitative PCR and the content of APMAP in the blood was detected by Elisa. The results showed that fat deposition, the expression of APMAP in muscle and the content of APMAP in the blood increased rapidly during the growth of Rex rabbits. The correlation analysis showed that the correlation coefficient between APMAP content in the blood and the expression level of APMAP gene in longissimus lumborum muscle was 0.75(p < 0.05); the correlation coefficients between APMAP content in the blood and intramuscular fat and 24-hour pH were 0.90 (p < 0.01) and 0.75 (p < 0.05), respectively. According to the analysis results, we inferred APMAP content in the blood in Rex rabbits may influence meat quality and the meat quality of high APMAP content in the blood in Rex rabbits is better. These results revealed APMAP content in the blood may be one of the important signs for meat quality traits of molecular markers. [ABSTRACT FROM AUTHOR]

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2–4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development. [ABSTRACT FROM AUTHOR]

Simple Summary: At present, one of the main problems hindering the development of rabbit industry is the low intramuscular fat of rabbits. N6-methyladenosine (m6A) is a highly dynamic RNA modification, which plays an important regulatory role in various physiological processes of animals. Sequencing rabbit longissimus lumborum muscle and perirenal fat by MeRIP-seq (methylated RNA immunoprecipitation with next-generation sequencing), we provided key prediction pathway for producing rabbit meat with good taste. N6-methyladenosine (m6A) widely participates in various life processes of animals, including disease, memory, growth and development, etc. However, there is no report on m6A regulating intramuscular fat deposition in rabbits. In this study, m6A modification of Hycole rabbit muscle and adipose tissues were detected by MeRIP-Seq. In this case, 3 methylases and 12 genes modified by m6A were found to be significantly different between muscle and adipose tissues. At the same time, we found 3 methylases can regulate the expression of 12 genes in different ways and the function of 12 genes is related to fat deposition base on existing studies. 12 genes were modified by m6A methylase in rabbit muscle and adipose tissues. These results suggest that 3 methylases may regulate the expression of 12 genes through different pathways. In addition, the analysis of results showed that 6 of the 12 genes regulated eight signaling pathways, which regulated intramuscular fat deposition. RT-qPCR was used to validate the sequencing results and found the expression results of RT-qPCR and sequencing results are consistent. In summary, METTL4, ZC3H13 and IGF2BP2 regulated intramuscular fat by m6A modified gene/signaling pathways. Our work provided a new molecular basis and a new way to produce rabbit meat with good taste. [ABSTRACT FROM AUTHOR]

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics. [ABSTRACT FROM AUTHOR]

Background: In biological cells, promoters drive gene expression by specific binding of RNA polymerase. They determine the starting position, timing and level of gene expression. Therefore, rational fine-tuning of promoters to regulate the expression levels of target genes for optimizing biosynthetic pathways in metabolic engineering has recently become an active area of research. Results: In this study, we systematically detected and characterized the common promoter elements in the unconventional yeast Yarrowia lipolytica, and constructed an artificial hybrid promoter library that covers a wide range of promoter strength. The results indicate that the hybrid promoter strength can be fine-tuned by promoter elements, namely, upstream activation sequences (UAS), TATA box and core promoter. Notably, the UASs of Saccharomyces cerevisiae promoters were reported for the first time to be functionally transferred to Y. lipolytica. Subsequently, using the production of a versatile platform chemical isoamyl alcohol as a test study, the hybrid promoter library was applied to optimize the biosynthesis pathway expression in Y. lipolytica. By expressing the key pathway gene, ScARO10, with the promoter library, 1.1–30.3 folds increase in the isoamyl alcohol titer over that of the control strain Y. lipolytica Po1g KU70∆ was achieved. Interestingly, the highest titer increase was attained with a weak promoter PUAS1B4-EXPm to express ScARO10. These results suggest that our hybrid promoter library can be a powerful toolkit for identifying optimum promoters for expressing metabolic pathways in Y. lipolytica. Conclusion: We envision that this promoter engineering strategy and the rationally engineered promoters constructed in this study could also be extended to other non-model fungi for strain improvement. [ABSTRACT FROM AUTHOR]

Osteosarcoma is one of the leading causes of cancer mortality in children and teenagers. Dysregulation of lipid metabolism has been reported to involve tumor progression. Our previous evidence has revealed that circular RNA hsa_circ_0000073 enhanced the proliferation and metastasis of osteosarcoma cells. However, the effect of hsa_circ_0000073 on the lipid metabolism of osteosarcoma remains unclear. In this paper, we focused on the effect of hsa_circ_0000073 in lipid metabolism and investigated a network among hsa_circ_0000073/ miR-1184 /FADS2 in osteosarcoma, which provides a new idea to treat osteosarcoma. The osteosarcoma and its adjacent tissue samples were collected for further validation. qRT-PCR or western blot was employed to detect the expression of hsa_circ_0000073, miR-1184, and FADS2 in OS cells and tissues. Microarray analysis, mass spectrometry, metabolomics analysis, and bioinformatics analysis were used to explore the potential function and target gene of hsa_circ_0000073. Oil red o, Nile red staining, and Triglyceride content assay were adopted to confirm the effect of hsa_circ_0000073 on the lipid metabolism of OS. Dual-luciferase reporter assays and RNA immunoprecipitation were applied to construct and validate the ceRNA network of hsa_circ_0000073. The xenograft mouse model was taken to verify the effect of hsa_circ_0000073 on lipid metabolism in vivo. The results confirmed that hsa_circ_0000073 was raised in the tumor tissues more than its adjacent tissue. Moreover, the higher expression of hsa_circ_0000073 was associated with worse survival rates, advanced clinical stage, large tumor size, and metastasis. After hsa_circ_0000073 silence, the gene chip and metabolomics result implied that hsa_circ_0000073 expression is positively correlated with a 91 genes signature and 78 metabolites in MG-63 and Saos-2 cells. The bioinformatics analysis indicated that hsa_circ_0000073 might involve in the biological processes of lipid metabolism. Further loss and gain of function experiments affirmed that hsa_circ_0000073 could impact cell lipid synthesis. Mechanically, hsa_circ_0000073 favored the expression of FADS2 genes by sponging miR-1184. Consistent with these observations, silencing of hsa_circ_0000073 inhibited lipid synthesis in vivo xenograft mouse model. Our study revealed that hsa_circ_0000073 contributed to the lipid synthesis of osteosarcoma by decreasing the expression of miR-1184, thereby increasing FADS2, which provides new insights into treating osteosarcoma. [Display omitted] • hsa_circ_0000073 was raised in cells and tissues of OS and associated with worse survival rates, advanced clinical stage, large tumor size, and metastasis. • In vitro and in vivo experiments validated that hsa_circ_0000073 contributed to OS cell lipid synthesis progression. • Hsa_circ_0000073 promotes lipid synthesis of osteosarcoma by sponging hsa-miR-1184 and releasing FADS2. [ABSTRACT FROM AUTHOR]

Mink are susceptible to viruses such as SARS-CoV-2, H1N1 and H9N2, so they are considered a potential animal model for studying human viral infections. Therefore, it is important to study the immune system of mink. Immunoglobulin (Ig) is an important component of humoral immunity and plays an important role in the body's immune defense. In this study, we described the gene loci structure of mink Ig germline by genome comparison, and analysed the mechanism of expression diversity of mink antibody library by 5′RACE and next-generation sequencing (NGS). The results were as follows: the IgH, Igκ and Igλ loci of mink were located on chromosome 13, chromosome 8 and chromosome 3, respectively, and they had 25, 36 and 7 V genes, 3, 5 and 7 J genes and 10 DH genes, respectively. Mink Ig heavy chain preferred the IGHV1, IGHD2 and IGHJ4 subgroups, κ chain mainly use the IGKV1, IGKJ1 and IGHL4 subgroups, and λ chain mainly use the IGLV3 and IGLJ3 subgroups. Linkage diversity analysis revealed that N nucleotide insertion was the main factor affecting the linkage diversity of mink Igs. On the mutation types of mink Ig Somatic Hypermutation (SHM), the high mutation types of heavy chain were mainly G > A, C > T, T > C, A > G, C > A, G > T, A > C, and T > G; the high mutation types of κ chain were G > A and T > C; and the high mutation types of λ chain were G > A and A > G. The objective of this study was to analyse the loci structure and expression diversity of Ig in mink. The results contribute to our comprehension of Ig expression patterns in mink and were valuable for advancing knowledge in mink immunogenetics, exploring the evolution of adaptive immune systems across different species, and conducting comparative genomics research. • The structure of immunoglobulin loci in mink was resolved for the first time. • The recombinant expression sequences of IgH, Igλ and Igκ in mink were obtained for the first time by 5′RACE. • The recombinant expression sequences of mink immunoglobulins were obtained for the first time using high-throughput sequencing, which enabled the expression diversity analysis of mink to reach the order of magnitude of 103-104. [ABSTRACT FROM AUTHOR]

Idesia polycarpa is a valuable oil-producing tree and can potentially be used for edible oil and biofuel production. The fruits of I. polycarpa are unique in that they contain both saturated and unsaturated lipids. Fatty acid desaturase 2 (FAD2), also as known as omega-6 fatty acid desaturase in endoplasmic, is a key enzyme for linoleic acid and α-linolenic acid biosynthesis. However, bioinformatics and expression of FAD2 in I. polycarpa are still absent. Here, to gain insight into the lipid and linoleic synthesis of I. polycarpa , we compared the fruits from different growth stages. Lipid accumulation rates, final lipid content, linoleic accumulation rates and final linoleic content were significantly different among the different stages. In a further step, the FAD2 gene from fruits of I. polycarpa , named IpFAD2 , was cloned and characterized. A partial fragment of 169 bp of IpFAD2 was amplified by degenerate PCR. Full cDNA of IpFAD2 was obtained by the RACE technique. The open-reading frame of IpFAD2 was 1149 bp in length, encoding 382 amino acids. A comparison of the deduced amino acids sequence of IpFAD2 with FAD2 from other species showed high similarities, ranging from 78.8 to 92.6%. The IpFAD2- predicted protein has a theoretical molecular mass of 44.03 kDa and an isoelectric point (pI) of 8.04. It has five transmembrane helices located on the endoplasmic reticulum. The IpFAD2- predicted protein was classified as belonging to the Membrane-FADS-like superfamily based on its conserved domain analysis. Expression analysis based on qRT-PCR indicated that IpFAD2 was expressed in different fruit growth stages, with the highest expression level at 80 DAP and the lowest at 130 DAP. The expression of IpFAD2 was positively correlated with the linoleic accumulation rates in I. polycarpa fruits. Prokaryotic expression in Escherichia. Coli BL21(DE3) indicated that IpFAD2 gene could encode a bio-functional omega-6 fatty acid desaturase. Heterologous expression in Arabidopsis thaliana confirmed that the isolated IpFAD2 proteins could catalyse linoleic synthesis. This is the first cloning and expression analysis of FAD2 from I. polycarpa , significantly contributing to our understanding of the role of IpFAD2 in linoleic synthesis, esp. in terms of genetic engineering breeding for linoleic production. Isolating FAD2 from I. polycarpa by RACE. Transfoming IpFAD2 into E. Coli and A. thaliana. It provides a candidate gene for quality improvement of staple oil-producing plants by genetic engineering breeding. Image 1 • Isolating FAD2 from I. polycarpa for the first time. Comparing with IpFAD2 mRNA expression pattern and I. polycarpa fruits linoleic content. •Prokaryotic expression in E. Coli indicated that IpFAD2 gene could encode a bio-functional omega-6 fatty acid desaturase. •Transfoming IpFAD2 into A. thaliana for the first time. •It provides a candidate gene for quality improvement of staple oil-producing plants by genetic engineering breeding. •Facilitating the selection of I. polycarpa fruits with various LA content requirements in different development stages. [ABSTRACT FROM AUTHOR]