Search

von Willebrand disease (VWD) is the common bleeding disorder with a clinically relevant bleeding prevalence of 1:10,000. von Willebrand disease patients lack both von Willebrand factor (VWF) and factor VIII (FVIII), which are critical for normal haemostasis. The conventional treatment for VWD includes desmopressin and replacement therapy with plasma derived FVIII with VWF concentrates or recombinant VWF. Development of alloantibodies is a rare occurrence, there is a paucity in the literature of treatment modalities in these patients. Not many reports are available in literature on the efficacy of emicizumab in VWD patients with or without alloantibodies to VWF.To do systematic review of literature on emicizumab in VWD and report our experience of emicizumab in two patients of VWD METHODS: We used electronic search engines till May 2021 in 'Google scholar' and 'PubMed', to collect the case reports or case series on use of emicizumab for management of VWD. Two of our severe VWD patients were successfully treated with emicizumab. A systematic review was performed and the results discussed.The electronic search revealed six case reports using emicizumab for treatment of VWD. Two were in vitro studies and four in patients with VWD type 3 disease. In vitro studies and in VWD patients on emicizumab, showed improvement in thrombin generation and fibrin formation. Among four patients, three had alloantibodies to VWD and one was negative. All these patients were treated with emicizumab for 6-12 m. After starting emicizumab, none of them had spontaneous bleeding requiring treatment. During treatment with emicizumab, one patient had trauma-associated soft tissue hematoma, which was treated with rFVIIa and another patient had bleeding following dental exfoliation treated with Humate P. We treated two of our VWD patients one with and one without inhibitors with emicizumab after failure of other therapies. Both the patients showed marked improvement and continued to remain well and free of bleeding episodes. None of the patients had any thrombosis or thrombotic microangiopathy (TMA) during treatment with emicizumab.In conclusion, this review supports the safety and efficacy of emicizumab in type 3 VWD patients with or without alloantibodies. Further large studies are required to confirm the safety and efficacy of emicizumab in VWD.

BACKGROUND The role of PAI-1 4G/5G polymorphism in venous thrombosis has been contradictory. PAI-1 4G/4G genotype is associated with elevated levels of PAI-1 resulting in a hypofibrinolytic state and a higher thrombotic risk. OBJECTIVE In this study, the distribution of genotypes and frequency of alleles of the 4G/5G polymorphism of PAI-1 gene in Indian patients with different types of venous thrombosis was investigated for its role in development of thrombosis. METHOD A total of 87 portal vein thrombosis (PVT), 71 Budd-Chiari syndrome (BCS), 156 cerebral vein thrombosis (CVT), and 163 deep vein thrombosis (DVT) patients were studied alongside 251 healthy controls for the PAI-1 4G/5G polymorphism by allele-specific PCR. RESULTS Frequency of 4G/4G genotype was higher in all groups in comparison with controls. 4G/4G was associated with PVT risk (OR=2.51, 95% CI=1.29-4.96, P=.0075), BCS risk (OR=5.98, 95% CI=2.68-13.42, P

The JAK2 V617F mutation is recurrent in polycythemia vera and essential thrombocythemia, which are myeloproliferative neoplasms frequently associated with arterial and venous thromboembolism. It has also been reported as a marker for occult myeloproliferative disorder (MPD) in patients with splanchnic venous thrombosis. Limited data are available regarding the prevalence of the JAK2 V617F mutation in patients with thrombosis outside the splanchnic region. For the study, 321 cases of venous thrombosis in the splanchnic and nonsplanchnic regions (cerebral venous thrombosis [CVT], 70; deep venous thrombosis [DVT], 36; Budd-Chiari syndrome [BCS], 137; portal venous thrombosis [PVT], 78) were studied for the presence of JAK2 mutations. The prevalence values for the JAK2 mutation were 3% (1/36), 8.8% (12/137), 5% (4/78), and 3% (2/70) in DVT, BCS, PVT, and CVT, respectively; 19 (5.9%) of 321 cases were positive for the JAK2 mutation. Of 111 healthy subjects screened for this mutation, none were found to be carriers. Determination of the JAK2 V617F mutation may be useful to identify patients who should be carefully observed for the development

The prevalence, cause and the impact of antiphospholipid antibodies (APAs) on the clinical severity in haemophilia patients is poorly studied. We studied 72 severe seronegative (negative for HIV, HBsAg, HCV) haemophilia patients for the presence of four common APAs. Twenty-six (36.1%) were positive for any one of the APAs studied of which eight were positive only for anticardiolipin antibodies, three for beta2 glycoprotein (beta2GP1), four for prothrombin (PT) and six for anti annexin antibodies. Remaining six patients showed multi-specific antibodies. Further, clinically severe haemophilia patients (n = 37) showed higher prevalence of APAs as compared with the clinically milder group (n = 35) suggesting that these antibodies do not contribute in alleviating the clinical severity in haemophilia patients as has been observed with other inherited thrombophilia markers. The study of in vitro thrombin generation showed a higher endogenous thrombin potential (ETP) i.e. almost normal, in case of beta2GP1-positive patients as compared with patients with other types of APAs. High prevalence of APAs in clinically severe haemophilia patients may be a consequence of continuing tissue damage in the clinically severe group; as in India, clotting factor concentrates cannot be used ad lib because of financial constraints. Higher thrombin-generating potential in case of patients positive for beta2GP1 did not seem to have any impact on the clinical severity of haemophilia patients.

Thromboelastography (TEG) assesses the global pattern of blood coagulation in the whole blood. Present day management of haemophilia is based on replacement therapy with lost factor by parenteral administration of factor concentrates. It is very well known that interaction of cellular components in the blood also affect the thrombin generation which in turn might produce varied TEG patterns that might reflect the clinical severity in haemophilia patients. We evaluated 66 severe haemophilia A and B patients (as assessed by one-stage assay) by TEG and correlated the varied TEG patterns with the clinical severity in the patients. Four distinct TEG patterns were observed; Group A consisted of eight patients with hypercoagulable patterns while group B consisted of two patients showing hyperfibrinolytic patterns. Group C comprised of 17 patients whose TEG tracings did not show the initiation of clot formation at all while group D comprising of 39 patients showed varied clot initiation times ranging from almost normal pattern to a highly prolonged split times. Groups A and D patients were relatively milder clinically while groups B and C were clinically severe as assessed by the number of bleeding episodes, the frequency of transfusion and joint deformity. Subsequently we also evaluated the in vitro efficacy of the antifibrinolytic drug, EACA in normalizing the TEG patterns in 12 patients (group C) who did not show the initiation of clot formation in the TEG tracings to see the contribution of fibrinolysis in producing such patterns. The use of EACA in vitro in this group improved the TEG profile of these patients. In conclusion, the classification of severe haemophilia patients based on TEG patterns correlated well with the clinical severity and the ex vivo use of antifibrinolytics like EACA are effective in improving the TEG profile of all patients who had an abnormal TEG pattern without any clot initiation.

Glanzmann's thrombasthenia is an autosomal recessive disorder, rare in a global context, but a relatively more common platelet function defect in communities where consanguineous marriages are more frequent. On clinical grounds alone, it cannot be distinguished from other congenital platelet function defects. Epistaxis, gum bleeding, menorrhagia are the common clinical manifestations, whereas large muscle hematoma or hemarthrosis seldom occur in these patients. Essential diagnostic features are a normal platelet count and morphology, a greatly prolonged bleeding time, absence of platelet aggregation in response to ADP, collagen, epinephrine, thrombin and to all aggregating agents which ultimately depend on fibrinogen binding to platelets for this effect, flow cytometry, studies of GPIIb-IIIa receptors on the platelet membrane surface using monoclonal antibodies. The present review describes some of the uncommon features of the disorders and the currently available options which the treating physicians should be aware of during the management of these patients. Although by definition all patients with Glanzmann's thrombasthenia have a virtually complete failure of platelet aggregation, a number of variant forms of GT have been described in which the glycoproteins are present in normal or near normal amounts but are functionally defective. Understanding the pathophysiology of the disorder by the treating physicians is of utmost importance. Presence of high affinity platelet receptors resulting in thrombasthennia-like phenotype may require an antagonistic treatment atypical of classical GT management. It has now been established that different genetic mutations of either GPIIb or IIIa genes results in such a heterogeneity of thrombasthenia phenotype. Glanzmann's thrombasthenia is a paradigm for treating coronary artery disease patients with GPIIb-IIIa antibody and inhibitors. By using these medicines we create a temporary GT-like situation. Hence, understanding this disease is of utmost importance to the practicing cardiologist. As mutations for different variant forms of GT become known, our understanding of how GPIIb-IIIa molecules can be activated to act as a receptor for fibrinogen molecules will be increased. Such understanding undoubtedly will help us to devise better drugs with GPIIb-IIIa inhibitors. Molecular biology techniques have enabled us to equivocally detect heterozygote carriers who are clinically asymptomatic. However, there may be several laboratories in the developing world, which have no access to molecular biology techniques. Development of more robust techniques of quantitation of platelet receptors has enabled an accurate diagnosis of heterozygote carriers or an unborn fetus in the second trimester. The importance of the GPIIb-IIIa polymorphisms in carrier and prenatal diagnosis has not been properly studied. Nowadays the less direct method of PLA1 typing (determination of the levels of platelet antigen) of the foetal platelets as early as 16 weeks of intrauterine life can be used for prenatal diagnosis of GT.

Four hundred and seven patients (352 haemophilia A and 55 haemophilia B) were investigated for the presence of factor VIII and IX inhibitors. Twenty-four out of 292 severe and two out of 36 moderate haemophilia A patients showed the presence of inhibitors. The mean age at development of inhibitors was 17.7 years (range 6-52 years). In 12 patients the inhibitors were detected due to suboptimal response to factor replacement therapy (symptomatic) and in the remaining 14 patients the inhibitors were detected during the routine screening of the patients' samples for inhibitors. They had, however, responded well to the usual doses of factor concentrates and there was no suspicion in these patients that they had developed an inhibitor (asymptomatic). There were two families in which the inhibitors were detected in more than one family member. The level of inhibitors in symptomatic patients ranged from 2.2 Bethesda units (BU) mL(-1) to 460.6 BU mL(-1), and in asymptomatic patients it ranged from 0.8 BU mL(-1) to 3.2 BU mL(-1). The inhibitors persisted in all patients except one, who developed an inhibitor postoperatively for a brief period of 3 months. All these patients were followed up from first factor exposure and were tested for inhibitors at least twice a year. The mean number of exposure days before they developed inhibitors was 47.5 exposure days (range 17-98 exposure days). No inhibitors appeared after more than 100 exposure days in any of the patients. When 50 consecutive patients were investigated for intron 22 inversions of the factor VIII gene, 17 patients were found to be positive for inversions (10 proximal inversion; seven distal inversion) out of whom four patients developed inhibitors, three patients belonging to the same family. Out of 35 haemophilia B patients, only one patient developed an inhibitor. The overall prevalence of inhibitors was thus 8.2%, which is similar to the reports from western countries, prior to the introduction of highly purified factor concentrate therapy.

Dear Editor, The human von Willebrand factor gene (VWF) is located on the short arm of chromosome 12 and spans approximately 178 kb, comprising of 52 exons. The mRNA has a length of 8.7 kb coding for precursor protein of 2813 amino acids that includes a 22 amino acid signal peptide, a pro-peptide of 741 amino acids and a mature subunit of 2050 amino acids [1]. The gene is highly polymorphic with more than 2000 polymorphisms reported in different ethnic populations [2]. Single nucleotide variations (SNVs) contribute to normal phenotypic variations and diseases as well. A chance combination of two SNVs in a single codon changing the nature of the mutation though uncommon, yet higher prevalence of the variant alleles across populations, makes such a deleterious combination possible resulting in the disease phenotype. We report here a severe VWD patient (VWF TGA) by the presence of two heterozygous changes (c.2878C>T, rs370984712; c.2880G>A, rs1800380) in the same codon. The single change c.2878C>T results in a variant (p.R960W), while c.2880G>A results in a synonymous change (p.R960=). The effect of SNV c.2878C>T on the function of VWF is unclear though it has been reported as a polymorphism in the single nucleotide polymorphism database (NCBI dbSNP. NM_000552.3); the prediction softwares however showed the effect of this change as deleterious. Only one such case has been reported earlier wherein the patient was found to have two mutations, i.e., a partial deletion extending the whole gene, i.e., exons 1–52 in heterozygous condition and R960* in homozygous condition, though the details of the second mutation are not discussed in this report [4]. The allelic frequencies of c.2880G>A are quite high varying between 0 and 32 % in different populations, while the frequency of c.2878C>T has been reported to be quite low, i.e., 0.05 % (http://asia.ensembl.org/Homo_sapiens/Info/ Index). One limitation here is that the parents were unavailable for mutation studies, but it is logical to presume that both the variants were in cis position, as the whole gene was sequenced and the patient was found to carry only two single nucleotide variations in heterozygous state. In conclusion, we report an interesting mechanism of two single nucleotide variations occurring together in cis in a single codon changing the nature of the pathogenic mutation. In the presence of the first variant, it would have been a missense variant, probably pathogenic, but the coexistence of a second SNV has changed the nature of the mutation, i.e., from a missense to a premature termination codon mutation. The two SNVs are mutually * Shrimati Shetty shrimatishetty@yahoo.com

As compared to haemophilia, although the clinical features and the management strategies for rare coagulation factor deficiencies are discussed, little is known about them. This study was undertaken to assess the distribution, clinical presentation and treatment of patients with rare coagulation factor deficiency disorders in a cross-sectional population of India. Blood samples and other clinical details from patients suspected of rare coagulation factor deficiencies were collected by the Haemophilia Treatment Centers across India and were diagnosed at National Institute of Immunohaematology, Mumbai. A total of 321 cases of rare clotting factor deficiencies were diagnosed, of which 88% were severe, 10% moderate and 2% mild. Commonest deficiency encountered was factor XIII (FXIII) (30%) followed by FX (15.6%), FVII (15%), fibrinogen (12.1%), FXI (9%), combined V and VIII deficiency (5.6%) and congenital multiple vitamin K-dependent coagulation factor deficiency (MCFD, 2.1%). Major representation of these deficiencies was from Southern and Western India (82%). Mucocutaneous bleeding was the commonest clinical presentation (59%); intracranial (IC) haemorrhage was seen in 18% of the patients; menorrhagia was an important clinical pointer in women in the reproductive age group (78%); 8% of the severe cases had no history of bleeding and 73% of the FXIII deficiency cases had umbilical stump bleeding. The major therapeutic products used was fresh frozen plasma (64%), cryoprecipitate (15%), whole blood (15%), antifibrinolytics (5%) and recombinant FVIIa (1%). A distinct pattern in the distribution of rare clotting factor deficiencies was observed which was based on multiple factors that include ethnicity and the available diagnostic facilities in different regions of this vast country.

A sensitive and specific sandwich ELISA was developed for the diagnosis of Glanzmann’s thrombasthenia (GT) and the heterozygote carriers of the disease using whole blood platelets. The assay used anti-CD36 antibody to capture platelets from platelet-rich plasma which was subsequently treated with a bioengineered disintegrin/alkaline phosphatase hybrid protein specific for GP IIb/IIIa. The test allows large number of samples to be typed and can also be used on stored samples. The assay correctly diagnosed 40 normal healthy individuals, 10 GT cases, 10 heterozygotes, 3 Bernard–Soulier syndrome cases and 2 type 3 GT cases. ELISA plates were stable at room temperature up to 3 weeks without any loss of activity. This novel and simple test can be widely used for heterozygote detection besides diagnosing GT cases without using a sophisticated flow cytometer or a platelet aggregometer and has wide applicability in countries like India where many of these cases remain undiagnosed due to the lack of diagnostic facilities.

Background The identification of pathogenic mutations in haemophilia A (HA) patients is important as a basis for genetic diagnosis and also for the assessment of clinical manifestations. Method We analyzed 36 inversion negative congenital HA cases (28 unrelated and 8 familial) by multiplex PCR and the conformation sensitive gel electrophoresis (CSGE) technique, followed by DNA sequencing. The pathogenicity of each of these mutations was assessed using various prediction software. Results We found 17 missense, 5 deletions, 3 insertions, and 2 nonsense mutations, out of which 16 were recurrent and 11 novel. All novel substitution mutations were found to be deleterious using the prediction softwares. We also encountered a double mutation (1 novel and 1 hot-spot mutation) in a family with a strong family history. A missense mutation in heterozygous state was also detected in a female bleeder with very low factor VIII levels, probably due to extreme lyonization. Conclusion High heterogeneity in mutational profile has been observed in the present study. The outcome of this study would enable us to give an accurate diagnosis in all affected families by direct mutation analysis.

We assessed the clinical manifestations in upper and lower limb deep venous thrombosis patients from India and difference in etiological factors. Fifty-three patients with primary upper extremity deep vein thrombosis (UEDVT; males 30, females 23) and 236 patients with lower limb deep vein thrombosis (LLDVT; males 157, females 79) were included in this study. The thrombophilia markers studied were protein C (PC), protein S (PS), antithrombin (AT) III, and factor V Leiden (FVL) mutation. Females had significantly higher prevalence of prothrombotic markers as compared to males (P = .046) in the UEDVT group. No statistically significant differences in the prevalence of prothrombotic markers were observed between the LLDVT and the UEDVT patients. The clinical picture however revealed greater involvement of thrombus of the iliofemoral vein (P = .009) and the proximal tibial vein (P = .005) in males than females, while no differences were observed in the clinical manifestations between the 2 sexes in UEDVT patients. Our study is able to give a broad perspective of the prevalence data of UEDVT and LLDVT in the city of Mumbai of approximately 5 million population served by this hospital. We conclude that the topology of thrombosis in deep vein thrombosis (DVT) patients in India is different from that of the Western countries.

The modern thrombin generation tests describe different phases of generation of thrombin that is initiation, amplification and inhibition of thrombin generation as well as the integral amount of generated thrombin. We investigated 55 patients with congenital deficiencies of different coagulation factors and analysed the relationship between the nature and the concentration of clotting factors, with different parameters of thrombin generation curve that is lag time, peak, time to peak and the area under curve or endogenous thrombin potential. The endogenous thrombin potential was unaffected by severe deficiency of factors XI and XII, and reduced in factor IX, VII and factor V and VIII deficiencies. The lag time was significantly prolonged in cases of severe factor VII, X and V deficiencies, and was almost normal in cases of factors VIII, IX, combined factors V and VIII, factor XI, XII and XIII deficiencies. The peak height was severely affected in cases of severe factor X, V, VIII and IX deficiency and combined deficiency of multiple vitamin K dependant coagulation factors, and significantly reduced in factor VIII, V, X, XIII and combined vitamin K deficiency.In all the patients with less than 40% thrombin generation, the clinical symptoms were severe. Bleeding symptoms were restricted to epistaxis and ecchymosis when thrombin generation was more than 90% of the normal. In the cases of combined deficiency of factors V and VIII all the values were intermediate as they exhibit mild deficiencies of both factors V and VIII and correlated well with the clinical symptoms. Endogenous thrombin potential of inherited isolated deficiencies of coagulation factors may thus provide an interesting insight about involvement of the deficient factor(s) at different phases of thrombin generation.

Erratum to: Annals of Hematology 91(6): 917–921. DOI 10.1007/s00277-011-1390-1 . The authors inadvertently omitted 2 fellow authors from the author list: Dr. Diego Butera should be listed as the fourth author. His affiliation is Lowy Cancer Research Centre and Prince of Wales Clinical School, University of New South Wales, Sydney, NSW, Australia. His contributions are as follows: Designed, synthesized and produced EcAPv. He has no competing interests to declare. Dr. Geraldo S. Magalhaes should be listed as the fifth author. His affiliation is Laboratory of Immunopathology, Butantan Institute, Sao Paulo, SP, Brazil. His contributions are as follows: Produced more EcAPv when requested in October 2009. He has no competing interests to declare.

Sir, Isolated coagulation factor V (FV) deficiency (parahaemphilia) is a rare autosomal recessive bleeding disorder affecting both sexes with a prevalence of about one in one million1. Patients with FV deficiency exhibit mild to severe bleeding symptoms with clinical manifestations ranging from ecchymosis, menorrhagia, epistaxis to haemarthrosis and intracranial bleeds1,2. The factor V (F5) gene is located on chromosome 1q23, spans about 80 kb and has 25 exons and 24 introns with a 7 kb mRNA which encodes a protein of 2224 amino acids. The complete F5 cDNA sequence has already been published3,4. More than 100 mutations and 700 polymorphisms have been reported in the F5 mutation database5. Among all coagulation disorders, FV deficiency is the least characterized disorder at the molecular level. Patients with FV deficiency generally exhibit a bleeding tendency of variable severity; intracranial and gastrointestinal haemorrhages, haematomas and haemarthroses are also reported in a few patients. Major phenotypic determinant in FV deficiency has been reported to be platelet FV levels6. Though the disease is rare in countries like India where consanguineous marriages are common, there is a high prevalence of autosomal recessive disorders including FV deficiency. Except one report7, there is no published study on the molecular characterization of FV deficient cases from India. Direct sequencing of the gene though accurate, is not cost-effective due to the large size of the gene and heterogeneity of mutations and is thus difficult to implement in many laboratories. Indirect method of gene tracking is an extremely simple and accurate method, when it is based on intragenic markers. However, assessing the informativeness of the marker in each population is important as there is a considerable variation in the heterozygotic frequency of these markers in different populations8,9,10. In the present study, polymorphisms in F5 were analysed in a group of healthy individuals with an objective to utilize them for genetic diagnosis in FV deficient families by direct DNA sequencing. The study was conducted at the Department of Haemostasis and Thrombosis, National Institute of Immunohaematology, Mumbai, India, including 65 unrelated healthy subjects from the Institute. After obtaining informed written consent, 10 ml blood sample was collected from each participant in EDTA and DNA was extracted from these samples using commercial kits (Invitrogen, CA, USA). PCR amplification was performed using primers designed by primers 3 and UCSC genome browser (Sigma Aldrich, India). The PCR reaction mixture consisted of 1U Taq polymerase (Bioron, Ludwigshafen, Germany), 1.5 mmol/l magnesium chloride, 1 μmol/l of the forward and reverse primers and 150 ng of DNA. The primer sequences and PCR conditions for exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms were as follows: Exon 13 (637 bp) - forward (5’-3’) TGCTGACTATGATTACCAGA, reverse (5’-3’) GAGTAACAGATCACTAGGAGG. PCR conditions: Denaturation at 94°C for 5 min followed by 35 cycles of denaturation (95°C, 40 sec), annealing (56°C, 40 sec), and extension (72°C for 40 sec) along with a final extension at 72°C for five minutes. Exon 16 (286 bp) - forward (5’-3’) GAGGCAATACAATTTACTC, reverse (5’-3’) CAGTGTGATTTAATTAGGAG. PCR conditions: Denaturation at 94°C for 5 min followed by 30 cycles of denaturation (95°C, 1 min), annealing (55°C, 2 min), extension (72°C for 1 min), followed by a final extension at 72°C for seven minutes. Amplified products were subjected to direct sequencing of the exons and the intron - exon boundaries of F5 using an ABI 3130 genetic analyzer (Applied Biosystems, USA). The study protocol was approved by the Institutional Ethics Committee. A total of 12 polymorphisms were detected, of which three showed high heterozygosity frequency in our population i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) (Table). The cumulative heterozygosity frequency of these three markers was 67.69 per cent. Table Heterozygosity frequencies of polymorphic markers of F5 During the course of the study, a family was referred from Uttar Pradesh for antenatal diagnosis in the first trimester of pregnancy. After obtaining a detailed medical and family history, blood samples of both parents and index case were collected and the chorionic villus sampling (CVS) was done at 11th weeks of pregnancy in the mother. DNA from blood samples and CVS was isolated using commercial kits (Invitrogen, USA) and subjected to gene tracking analysis by direct DNA sequencing technique using the above three markers i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms. The diagnosis could be successfully offered to this family using exon 13 A2663G (K830R) polymorphism. The family was non-informative for exon 13 A2684G (H837R) and exon 16 A5380G (M1736V) markers. As the mother was homozygous for this marker, the foetus is either normal or a carrier of the mutation. Thus the diagnosis of an ‘unaffected’ foetus was offered. The child was subsequently followed up after delivery and was found to be normal for factor V levels with a normal genotype. The present study shows that these three markers can successfully be used in carrier diagnosis and prenatal diagnosis in majority of the FV deficient families in India. Due to the high cost involved in direct DNA or mRNA analysis involved in mutation detection, indirect linkage analysis using such highly informative polymorphic markers may be considered as the method of choice for genetic diagnosis in developing countries.

Four hundred and ninety seven patients were referred to our center for platelet aggregation studies because of spontaneous mucocutaneous bleeds. All these patients had normal complete blood count, platelet count and peripheral smears except in ten patients of Bernard Soulier Syndrome where platelet count was marginally reduced in the presence of giant platelets. Two hundred and eighty patients were found to have normal platelet aggregation to ADP, collagen, ristocetin and arachidonic acid. Out of the remaining 217 patients, 62 patients were diagnosed to have Glanzmanns thrombasthenia, 10 Bernard Soulier Syndrome, 6 storage pool deficiencies, 7 cyclooxygenase deficiencies and 72 von Willebrand disease. In all the patients with GT and BSS, diagnosis was confirmed with flow cytometry using multiple monoclonal antibodies to GPIIb-IIIa and GPIb-IX. There were sixty patients where initial platelet aggregation studies showed reduced (

Dear Editor, Prothrombin (coagulation factor II) is a zymogen which is proteolytically cleaved to form its active derivative, thrombin, a serine protease, in the penultimate step of the coagulation cascade. The prothrombin gene is located on chromosome 11 (11p11-q12) [1]. Homozygous prothrombin deficiency is a rare autosomal recessive bleeding disorder occurring approximately in one of two million individuals. The Human Genome Mutation Database shows reports of only 32 mutations causing prothrombin deficiency [2]. The molecular basis is diverse, and mutations or polymorphisms in f2 gene are known to lead to both thrombosis and bleeding [3, 4]. A 5-month-old female child from Nepal, born of nonconsanguinous marriage, was referred with acute intracranial hemorrhage (Fig. 1a). Since birth, the baby had few episodes of bleeding ranging from hematemesis, umbilical stump bleed, and right-sided subdural hematoma. During these episodes, the baby was given an injection of vitamin K, fresh frozen plasma, and whole blood. Coagulation investigations done during these episodes showed consistently deranged prothrombin time (PT) and activated partial thromboplastin time (APTT); however, no reports of factor assays were available. Both the parents were clinically normal with neither any history of bleeding nor thrombosis during their life time. Blood samples of the patient and parents were collected in 3.2 % tri-sodium citrate after an informed consent. All the coagulation tests were performed in a semi-automated coagulometer using commercial reagents and calibrators (Diagnostica Stago, Asnieres, France). All the 14 exons and their flanking intronic regions were amplified using 12 sets of primers as described earlier [5]. The amplicons were sequenced using BigDye Terminator cycle sequencing kit in a ABI 3130XL genetic analyzer (Applied Biosystems, Foster City, CA, USA). The primary amino acid sequences of prothrombin from Homo sapiens (NC_000011.9), Pan troglodytes (NC_006478.2), Macaca mulatta (NC_007871.1), and Mus musculus (NC_000068.6) were obtained from NCBI gene [6]. Multiple sequence alignment was performed with ClustalW [7] to study the conservation of amino acids mutated by missense variations. Ensembl Genome Browser [8] was used to refer to the reported variations in the prothrombin gene. PolyPhen, Sorting Intolerant from Tolerant (SIFT), and Panther were used to predict the severity of the amino acid substitution on the protein function. The coagulation parameters of the patient were as follows: PT 27 s/control 14.5 s, APTT 40 s/control 29 s, thrombin time (TT) 18 s/control 15 s, fibrinogen 222 g/dL (normal range, 150–400 mg/dL). Mixing studies were normal for PT, APTT, and TT. Factor II (prothrombin) was found to be