Search

Background: Limb-girdle muscular dystrophy (LGMD) is a genetically heterogeneous, hereditary disease characterized by limb-girdle weakness and histologically dystrophic changes. The prevalence of each subtype of LGMD varies among different ethnic populations. This study for the first time analyzed the phenotypes and genotypes in Taiwanese patients with LGMD in a referral center for neuromuscular diseases (NMDs).Results: We enrolled 102 patients clinically suspected of having LGMD who underwent muscle biopsy with subsequent genetic analysis in the previous 10 years. On the basis of different pathological categories, we performed sequencing of target genes or panel for NMDs and then identified patients with type 1B, 1E, 2A, 2B, 2D, 2I, 2G, 2 N, and 2Q. The 1B patients with LMNA mutation presented with mild limb-girdle weakness but no conduction defect at the time. All 1E patients with DES mutation exhibited predominantly proximal weakness along with distal weakness. In our cohort, 2B and 2I were the most frequent forms of LGMD; several common or founder mutations were identified, including c.1097_1099delACA (p.Asn366del) in DES, homozygous c.101G > T (p.Arg34Leu) in SGCA, homozygous c.26_33dup (p.Glu12Argfs*20) in TCAP, c.545A > G (p.Tyr182Cys), and c.948delC (p.Cys317Alafs*111) in FKRP. Clinically, the prevalence of dilated cardiomyopathy in our patients with LGMD2I aged > 18 years was 100%, much higher than that in European cohorts. The only patient with LGMD2Q with PLEC mutation did not exhibit skin lesions or gastrointestinal abnormalities but had mild facial weakness. Muscle imaging of LGMD1E and 2G revealed a more uniform involvement than did other LGMD types.Conclusion: Our study revealed that detailed clinical manifestation together with muscle pathology and imaging remain critical in guiding further molecular analyses and are crucial for establishing genotype-phenotype correlations. We also determined the common mutations and prevalence for different subtypes of LGMD in our cohort, which could be useful when providing specific care and personalized therapy to patients with LGMD. [ABSTRACT FROM AUTHOR]

Purpose: When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives. Methods: We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy. Results: Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42) of the unsolved cases. Conclusion: Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases. [ABSTRACT FROM AUTHOR]

Abstract: Mitochondrial disorders are by far the most genetically heterogeneous group of diseases, involving two genomes, the 16.6kb mitochondrial genome and ~1500 genes encoded in the nuclear genome. For maternally inherited mitochondrial DNA disorders, a complete molecular diagnosis requires several different methods for the detection and quantification of mtDNA point mutations and large deletions. For mitochondrial disorders caused by autosomal recessive, dominant, and X-linked nuclear genes, the diagnosis has relied on clinical, biochemical, and molecular studies to point to a group of candidate genes followed by stepwise Sanger sequencing of the candidate genes one-by-one. The development of Next Generation Sequencing (NGS) has revolutionized the diagnostic approach. Using massively parallel sequencing (MPS) analysis of the entire mitochondrial genome, mtDNA point mutations and deletions can be detected and quantified in one single step. The NGS approach also allows simultaneous analyses of a group of genes or the whole exome, thus, the mutations in causative gene(s) can be identified in one-step. New approaches make genetic analyses much faster and more efficient. Huge amounts of sequencing data produced by the new technologies brought new challenges to bioinformatics, analytical pipelines, and interpretation of numerous novel variants. This article reviews the clinical utility of next generation sequencing for the molecular diagnoses of complex dual genome mitochondrial disorders. [Copyright &y& Elsevier]

The aim of the study was to determine the prevalence of MNGIE-like phenotype in patients with recessive POLG1 mutations. Mutations in the POLG1 gene, which encodes for the catalytic subunit of the mitochondrial DNA polymerase gamma essential for mitochondrial DNA replication, cause a wide spectrum of mitochondrial disorders. Common phenotypes associated with POLG1 mutations include Alpers syndrome, ataxia-neuropathy syndrome, and progressive external ophthalmoplegia (PEO). Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by severe gastrointestinal dysmotility, cachexia, PEO and/or ptosis, peripheral neuropathy, and leukoencephalopathy. MNGIE is caused by TYMP mutations. Rare cases of MNGIE-like phenotype have been linked to RRM2B mutations. Recently, POLG1 mutations were identified in a family with clinical features of MNGIE but no leukoencephalopathy. The coding regions and exon-intron boundaries of POLG1 were sequence analyzed in patients suspected of POLG1 related disorders. Clinical features of 92 unrelated patients with two pathogenic POLG1 alleles were carefully reviewed. Three patients, accounting for 3.3% of all patients with two pathogenic POLG1 mutations, were found to have clinical features consistent with MNGIE but no leukoencephalopathy. Patient 1 carries p.W748S and p.R953C; patient 2 is homozygous for p.W748S, and patient 3 is homozygous for p.A467T. In addition, patient 2 has a similarly affected sibling with the same POLG1 genotype. POLG1 mutations may cause MNGIE-like syndrome, but the lack of leukoencephalopathy and the normal plasma thymidine favor POLG1 mutations as responsible molecular defect. [ABSTRACT FROM AUTHOR]

White matter involvement has recently been recognized as a common feature in patients with multisystem mitochondrial disorders that may be caused by molecular defects in either the mitochondrial genome or the nuclear genes. It was first realized in classical mitochondrial syndromes associated with mitochondrial DNA (mtDNA) mutations, such as mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), Leigh's disease, and Kearns-Sayre's syndrome. Deficiencies in respiratory chain complexes I, II, IV, and V often cause Leigh's disease; most of them are due to nuclear defects that may lead to severe early-onset leukoencephalopathies. Defects in a group of nuclear genes involved in the maintenance of mtDNA integrity may also affect the white matter; for example, mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) caused by thymidine phosphorylase deficiency, Navajo neurohepatopathy (NNH) due to MPV17 mutations, and Alpers syndrome due to defects in DNA polymerase gamma (POLG). More recently, leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) has been reported to be caused by autosomal recessive mutations in a mitochondrial aspartyl-tRNA synthetase, DARS2 gene. A patient with leukoencephalopathy and neurologic complications in addition to a multisystem involvement warrants a complete evaluation for mitochondrial disorders. A definite diagnosis may be achieved by molecular analysis of candidate genes based on the biochemical, clinical, and imaging results. [ABSTRACT FROM AUTHOR]

Mutations in the POLG gene have emerged as one of the most common causes of inherited mitochondrial diseases in children and adults. This study sequenced the exons and flanking intronic regions of the POLG gene from 2697 unrelated patients with clinical presentations suggestive of POLG deficiency. Informative mutations have been identified in 136 unrelated individuals (5%), including 92 patients with two recessive pathogenic alleles and three patients harbouring a dominant mutation. Twenty-four novel recessive mutations and a novel possible dominant mutation, p.Y951N, were identified. All missense mutations occurred at evolutionarily conserved amino acids within functionally important regions identified by molecular modelling analyses. Oligonucleotide array comparative genomic hybridisation analyses performed on DNA samples from 81 patients with one mutant POLG allele identified a large intragenic deletion in only one patient, suggesting that large deletions in POLG are rare. The 92 patients with two mutant alleles exhibited a broad spectrum of disease. Almost all patients in all age groups had some degree of neuropathy. Seizures, hepatopathy, and lactic acidaemia were predominant in younger patients. By comparison, patients who developed symptoms in adulthood had a higher percentage of myopathy, sensory ataxia, and chronic progressive external ophthalmoplegia (CPEO)/ptosis. In conclusion, POLG mutations account for a broad clinical spectrum of mitochondrial disorders. Sequence analysis of the POLG gene should be considered as a part of routine screening for mitochondrial disorders, even in the absence of apparent mitochondrial DNA abnormalities. [ABSTRACT FROM AUTHOR]

Abstract: Although mitochondrial disorders are increasingly being recognized, confirming a specific diagnosis remains a great challenge due to the genetic and clinical heterogeneity of the disease. The heteroplasmic nature of most pathogenic mitochondrial DNA mutations and the uncertainties of the clinical significance of novel mutations pose additional complications in making a diagnosis. Suspicion of mitochondrial disease among patients with multiple, seemingly unrelated neuromuscular and multi-system disorders should ideally be confirmed by the finding of deleterious mutations in genes involving mitochondrial biogenesis and functions. The genetics are complex, as the primary mutation can be either in the nuclear or the mitochondrial DNA (mtDNA). MtDNA mutations are often maternally inherited, but can also be sporadic or secondary to mutations in nuclear-encoded mitochondrial-targeted genes. Several well-defined clinical syndromes associated with specific mutations have been described, yet the genotype–phenotype correlation is often unclear and most patients do not fit within any defined syndrome and even within a family the expressivity of the disease can be extremely variable. This article describes examples representing diagnostic challenges of mitochondrial diseases that include the limitations of the mutation detection method, the occurrence of mitochondrial disease in families with another known neuromuscular disorder, atypical clinical presentation, the lack of correlation between the degree of mutant heteroplasmy and the severity of the disease, variable penetrance, and nuclear gene defects causing mtDNA depletion. [Copyright &y& Elsevier]

Focuses on the mutation analysis by the use of temporal temperature gradient gel electrophoresis. Combinations needed in detecting mutations in DNA and RNA; Types of mutation analysis; Highlights on the several commonly used screening methods for unknown mutations.

Abstract: In this article, we review the current methodologies used for the molecular diagnosis of mitochondrial DNA defects. Definition of mitochondrial disorders at the molecular level has been difficult because of both clinical and genetic heterogeneity. Direct DNA analysis for common point mutations and large mtDNA deletions is readily performed and can be done routinely. However, a large number of patients who have the clinical manifestations and muscle pathology findings consistent with mitochondrial DNA disorders do not have detectable common mutations. Additional mutation screening methods are required for the detection of rare and previously undescribed mutations in the mitochondrial genome. [Copyright &y& Elsevier]

Somatic mitochondrial DNA alteration is a general phenomenon that occurs in cancerous cells. Although numerous mtDNA mutations have been identified in various tumors, the pathogenic significance of these mutations remains unclear. In order to better understand the role of mtDNA mutations in the neoplastic process of oral cancer, the occurrence of mtDNA mutations in oral squamous cell carcinomas was screened by temporal temperature gradient gel electrophoresis (TTGE). The entire mitochondrial genome was amplified with 32 pairs of overlapping primers. The DNA fragments showing different banding patterns between normal and tumor mtDNA were sequenced for the identification of the mutations. Fourteen of 18 (77.8%) tumors had somatic mtDNA mutations with a total of 26 mutations. Among them, 6 were in mRNA coding region. Three were missense mutations (C14F, H186R, T173P) in NADH dehydrogenase subunit 2 (ND2). One frameshift mutation, 9485delC, was in cytochrome c oxidase subunit III. Eight (44%) tumors had insertion or deletion mutations in the np303-309 poly C region of the D-loop. Our results demonstrate that somatic mtDNA mutations occur in oral cancer. The missense and frameshift mutations in the evolutionary conserved regions of the mitochondrial genome may have functional significance in the pathogenesis of oral cancer. [ABSTRACT FROM AUTHOR]

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC- 5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases. [ABSTRACT FROM AUTHOR]

Mitochondrial DNA (mtDNA) disorders represent a group of heterogeneous diseases that are caused by mutations in mtDNA. We examined 45 pairs of mother and the affected child, by screening the entire mitochondrial genome with temporal temperature gradient gel electrophoresis (TTGE), using 32 pairs of overlapping primers. TTGE is an effective method of mutation detection. It detects and distinguishes heteroplasmic mutations from homoplasmic mutations. By running the mother and child's DNA samples side by side and sequencing only the DNA fragments showing different TTGE patterns, excessive sequencing can be avoided, particularly because most sequence variations represent benign polymorphisms. Mutations identified by sequencing were further confirmed by PCR/ASO (allele-specific oligonucleotide) dot blot analysis or PCR/RFLP (restriction fragment length polymorphism). A total of seven differences in sequence between mother and child pairs were identified: A189G, T5580C, G5821A, C5840T, A8326G, G12207A, and G15995A. All but two mutations were novel. The most significant are the A8326G, G12207A, and G15595A mutations. The A8326G is located at the anticodon region of tRNALys, right next to the first nucleotide of the triplet codon, and it is highly conserved throughout evolution. The G12207A mutation is located at the first base of tRNAser (AGY). The G15995A mutation occurs at a stem region that results in the disruption of the first base pair at the anticodon loop of tRNAPro and is highly conserved throughout evolution from sea urchins to mammals. Running TTGE side by side with DNAs from mother and the affected child is a novel method to detect deleterious mutations. [ABSTRACT FROM AUTHOR]

Mitochondrial disorders can be caused by mutations in nuclear or mitochondrial encoded genes. Point mutations and large deletions in mitochondrial DNA (mtDNA) are responsible for a small portion of the molecular defects in the mitochondrial oxidative phosphorylation system. A significant number of molecular defects of respiratory chain disorders are probably due to mutations in nuclear genes. Molecular diagnosis of mitochondrial disorders has been difficult because of broad genetic and clinical heterogeneity. Mutational analysis of common point mutations of mtDNA such as A3243G, A8344G, and T8993G/C is routinely performed. However, many patients who clearly have clinical manifestations and muscle pathology consistent with oxidative phosphorylation deficiency do not have detectable common mtDNA point mutations. A more comprehensive mutation screening method, temporal temperature gradient gel electrophoresis, was used to scan for unknown mutations in the entire mitochondrial genome. Novel mutations have been discovered but only account for a small portion of patients with suspected mitochondrial RC disorders. Real-time quantitative PCR analysis was used to measure cellular mtDNA content. Abnormal levels of mtDNA were found in many patients with respiratory chain disorders. Molecular analysis revealed that mutations in the thymidine phosphorylase gene are not seen in young patients with severe mtDNA depletion who do not demonstrate clinical features of mitochondrial neurogastrointestinal encephalomyopathy. It was also noted that an increase in the size or number of mitochondria was not necessarily associated with an increase in mtDNA content. On the contrary, in some cases the mtDNA was depleted. Respiratory activity in patients with a defective mitochondrial genome due to either point mutations or deletions may be compensated by amplification of mtDNA. Therefore, a comprehensive molecular analysis of mitochondrial respiratory chain disorders should include qualitative identification of the mutation and quantitative measurement of both the degree of mutant heteroplasmy and the total amount of mtDNA. [ABSTRACT FROM AUTHOR]

The article focuses on cystic fibrosis (CF) in East Asia. It includes information on the case of a 28-year-old Vietnamese woman who was referred for prenatal diagnosis because her previous children had died of CF. CF is one of the most common autosomal recessive diseases in Caucasians and is very rare in Asian countries. The mutation spectrum can be identified and molecular diagnosis of carriers will become available with the growing number of mutations found in the Asian CF population.

A correction to the article "Identification of Novel and Rare Mutations in California Hispanic and African American Cystic Fibrosis Patients" published in an issue is presented.

Chronic Progressive External Ophthalmoplegia (CPEO) is characterized by ptosis and ophthalmoplegia and is usually caused by mitochondrial DNA (mtDNA) deletions or mt-tRNA mutations. The aim of the present work was to clarify the genetic defect in a patient presenting with CPEO and elucidate the underlying pathogenic mechanism. This 62-year-old female first developed ptosis of the right eye at the age of 12 and subsequently the left eye at 45 years, and was found to have external ophthalmoplegia at the age of 55 years. Histopathological abnormalities were detected in the patient's muscle, including ragged-red fibres, a mosaic pattern of COX-deficient muscle fibres and combined deficiency of respiratory chain complexes I and IV. Genetic investigation revealed the “common deletion” in the patient's muscle and fibroblasts. Moreover, a novel, heteroplasmic mt-tRNA Ser(UCN) variant (m.7486G>A) in the anticodon loop was detected in muscle homogenate (50%), fibroblasts (11%) and blood (4%). Single-fibre analysis showed segregation with COX-deficient fibres for both genetic alterations. Assembly defects of mtDNA-encoded complexes were demonstrated in fibroblasts. Functional analyses showed significant bioenergetic dysfunction, reduction in respiration rate and ATP production and mitochondrial depolarization. Multilamellar bodies were detected by electron microscopy, suggesting disturbance in autophagy. In conclusion, we report a CPEO patient with two possible genetic origins, both segregating with biochemical and histochemical defect. The “common mtDNA deletion” is the most likely cause, yet the potential pathogenic effect of a novel mt-tRNA Ser(UCN) variant cannot be fully excluded. [ABSTRACT FROM AUTHOR]

Mutations in the MUT gene, which encodes the mitochondrial enzyme methylmalonyl-CoA mutase, are responsible for the mut form of methylmalonic aciduria (MMA). In this study, a next generation sequencing (NGS) based gene panel was used to analyze 53 patients that had been diagnosed with mut MMA by somatic cell complementation analysis. A total of 54 different mutations in MUT were identified in 48 patients; 16 novel mutations were identified, including 1 initiation site mutation (c.2T > C [p.M1?]), 1 missense mutation (c.566A > T [p.N189I]), 2 nonsense mutations (c.129G > A [p.W43*] and c.1975C > T [p.Q659*]), 2 mutations affecting splice sites (c.753 + 3A > G and c.754-2A > G), 8 small insertions, deletions, and duplications (c.29dupT [p.L10Ffs*39], c.55dupG [p.V19Gfs*30], c.631_633delGAG [p.E211del], c.795_796insT [p.M266Yfs*7], c.1061delCinsGGA [p.S354Wfs*20], c.1065_1068dupATGG [p.S357Mfs*5], c.1181dupT [p.L394Ffs*30], c.1240delG [p.E414Kfs*17]), a large insertion (c.146_147ins279), and a large deletion involving exon 13. Phenotypic rescue and cDNA analysis were used to confirm that the c.146_147ins279 and c.631_633delGAG mutations were associated with the decreased methylmalonyl-CoA mutase function observed in the patient fibroblasts. In five patients, the NGS panel did not confirm the diagnosis made by complementation analysis. One of these patients was found to carry 2 novel mutations (c.433G > A [p.E145K] and c.511A > C [p.N171H]) in the SUCLG1 gene. [ABSTRACT FROM AUTHOR]

Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2 . In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo , heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype. [ABSTRACT FROM AUTHOR]

Abstract: Deficiency caused by mutations in the creatine transporter gene (SLC6A8/CT1) is an X-linked form of intellectual disability. The presence of highly homologous pseudogenes and high GC content of SLC6A8 genomic sequence complicates the molecular diagnosis of this disorder. To minimize the pseudogene interference, exons 2 to 13 of SLC6A8 were amplified as a single PCR product using gene-specific long-range PCR (LR-PCR) primers. The GC-rich exon 1 and its flanking intronic sequences were amplified separately in a short fragment under GC-rich conditions and a touchdown PCR program. Traditional Sanger sequence analysis of all coding exons of SLC6A8 from a 3-year-old boy with creatine transporter deficiency did not detect deleterious mutations. The long-range PCR product was used as template followed by massively parallel sequencing (MPS) on HiSeq2000. We were able to detect a tandem duplication involving part of exons 11 and 12 in the SLC6A8 gene. The deduced c.1592_1639dup133 mutation was confirmed to be a hemizygous insertion by targeted genomic DNA and cDNA Sanger sequencing. Combination of deep sequencing technology with long-range PCR revealed a novel intragenic duplication in the SLC6A8 gene, providing a definitive molecular diagnosis of creatine transporter deficiency in a male patient. [Copyright &y& Elsevier]

Nuclear genetic disorders causing mitochondrial DNA (mtDNA) depletion are clinically and genetically heterogeneous, and the molecular etiology remains undiagnosed in the majority of cases. Through whole-exome sequencing, we identified recessive nonsense and splicing mutations in FBXL4 segregating in three unrelated consanguineous kindreds in which affected children present with a fatal encephalopathy, lactic acidosis, and severe mtDNA depletion in muscle. We show that FBXL4 is an F-box protein that colocalizes with mitochondria and that loss-of-function and splice mutations in this protein result in a severe respiratory chain deficiency, loss of mitochondrial membrane potential, and a disturbance of the dynamic mitochondrial network and nucleoid distribution in fibroblasts from affected individuals. Expression of the wild-type FBXL4 transcript in cell lines from two subjects fully rescued the levels of mtDNA copy number, leading to a correction of the mitochondrial biochemical deficit. Together our data demonstrate that mutations in FBXL4 are disease causing and establish FBXL4 as a mitochondrial protein with a possible role in maintaining mtDNA integrity and stability. [ABSTRACT FROM AUTHOR]

Abstract: Mitochondrial DNA (mtDNA) depletion syndromes (MDSs) are a clinically and molecularly heterogeneous group of mitochondrial cytopathies characterized by severe mtDNA copy number reduction in affected tissues. Clinically, MDSs are mainly categorized as myopathic, encephalomyopathic, hepatocerebral, or multi-systemic forms. To date, the myopathic form of MDS is mainly caused by mutations in the TK2 gene, which encodes thymidine kinase 2, the first and rate limiting step enzyme in the phosphorylation of pyrimidine nucleosides. We analyzed 9 unrelated families with 11 affected subjects exhibiting the myopathic form of MDS, by sequencing the TK2 gene. Twelve mutations including 4 novel mutations were detected in 9 families. Skeletal muscle specimens were available from 7 out of 11 subjects. Respiratory chain enzymatic activities in skeletal muscle were measured in 6 subjects, and enzymatic activities were reduced in 3 subjects. Quantitative analysis of mtDNA content in skeletal muscle was performed in 5 subjects, and marked mtDNA content reduction was observed in each. In addition, we outline the molecular and clinical characteristics of this syndrome in a total of 52 patients including those previously reported, and a total of 36 TK2 mutations are summarized. Clinically, hypotonia and proximal muscle weakness are the major phenotypes present in all subjects. In summary, our study expands the molecular and clinical spectrum associated with TK2 deficiency. [Copyright &y& Elsevier]

Abstract: Cerebral creatine deficiency syndromes (CCDS) are a group of inborn errors of creatine metabolism that involve AGAT and GAMT for creatine biosynthesis disorders and SLC6A8 for creatine transporter (CT1) deficiency. Deficiencies in the three enzymes can be distinguished by intermediate metabolite levels, and a definitive diagnosis relies on the presence of deleterious mutations in the causative genes. Mutations and unclassified variants were identified in 41 unrelated patients, and 22 of these mutations were novel. Correlation of sequencing and biochemical data reveals that using plasma guanidinoacetate (GAA) as a biomarker has 100% specificity for both AGAT and GAMT deficiencies, but AGAT deficiency has decreased sensitivity in this assay. Furthermore, the urine creatine:creatinine ratio is an effective screening test with 100% specificity in males suspected of having creatine transporter deficiency. This test has a high false-positive rate due to dietary factors or dilute urine samples and lacks sensitivity in females. We conclude that biochemical screening for plasma GAA and measuring of the urine creatine:creatinine ratio should be performed for suspected CCDS patients prior to sequencing. Also, based on the results of this study, we feel that sequencing should only be considered if a patient has abnormal biochemical results on repeat testing. [Copyright &y& Elsevier]

Abstract: We report a novel heteroplasmic mutation p.Y440C in the mitochondrial DNA-encoded subunit I of the cytochrome c oxidase (COX) gene in a patient with late onset progressive painless weakness. Her muscle biopsy showed scattered COX-negative fibers and several small collections of inflammatory cells. The mutation was detected in the patient''s muscle but not in her blood. The low mutant load in muscle could explain the patient''s late onset of the myopathy and milder phenotype when compared to the previously published cases with MTCO1 mutations. [Copyright &y& Elsevier]

Abstract: Mutations in POLG account for one of the most frequent nuclear encoded causes of mitochondrial disorders to date. Individuals harboring POLG mutations exhibit fairly heterogeneous clinical presentations leading to increasing difficulties in classifying these patients into defined clinical phenotypes. This study aims to investigate the molecular basis of a mitochondrial cytopathy in a patient with 3-methylglutaconic aciduria and to expand the clinical phenotype associated with POLG mutations. Clinical, molecular and genetic analyses as well as neurophysiological examinations were carried out for a 23-year-old woman of mixed Caucasian and Latin American ancestry with a history of cataracts diagnosed at age 1year, she had onset of distal muscle weakness at age 2years progressing to atrophy and ovarian dysgenesis at puberty. The patient was found to have 3-methylglutaconic acid with normal 3 hydroxyisovaleric acid on urine organic acid analysis. POLG sequencing was done and a heterozygous variant, c.2851T>A (p.Y951N) was found which is predicted to be deleterious. There are limited reports of POLG mutations in individuals with 3-methylglutaconic aciduria. This case report of a young woman with a heterozygous mutation in POLG, presenting with muscle weakness and atrophy at a young age aims to aid clinicians in similar challenging diagnostic situations as well as enhances our understanding of POLG-related disease phenotypes. [Copyright &y& Elsevier]

Abstract: Leigh syndrome is a severe neurodegenerative disease with heterogeneous genetic etiology. We report a novel m.4296G>A variant in the mitochondrial tRNA isoleucine gene in a child with Leigh syndrome, mitochondrial proliferation, lactic acidosis, and abnormal respiratory chain enzymology. The variant is present at >75% heteroplasmy in blood and cultured fibroblasts from the proband, <5% in asymptomatic maternal relatives, and is absent in 3000 controls. It is located in the highly conserved anticodon region of tRNA(Ile) where three other pathogenic changes have been described. We conclude that there is strong evidence to classify m.4296G>A as a pathogenic mutation causing Leigh syndrome. [Copyright &y& Elsevier]

Abstract: This paper reports studies of two patients proven by a variety of studies to have mitochondrial depletion syndromes due to mutations in either their MPV17 or DGUOK genes. Each was initially investigated metabolically because of plasma methionine concentrations as high as 15–21-fold above the upper limit of the reference range, then found also to have plasma levels of S-adenosylmethionine (AdoMet) 4.4–8.6-fold above the upper limit of the reference range. Assays of S-adenosylhomocysteine, total homocysteine, cystathionine, sarcosine, and other relevant metabolites and studies of their gene encoding glycine N-methyltransferase produced evidence suggesting they had none of the known causes of elevated methionine with or without elevated AdoMet. Patient 1 grew slowly and intermittently, but was cognitively normal. At age 7years he was found to have hepatocellular carcinoma, underwent a liver transplant and died of progressive liver and renal failure at age almost 9years. Patient 2 had a clinical course typical of DGUOK deficiency and died at age 8 ½months. Although each patient had liver abnormalities, evidence is presented that such abnormalities are very unlikely to explain their elevations of AdoMet or the extent of their hypermethioninemias. A working hypothesis is presented suggesting that with mitochondrial depletion the normal usage of AdoMet by mitochondria is impaired, AdoMet accumulates in the cytoplasm of affected cells poor in glycine N-methyltransferase activity, the accumulated AdoMet causes methionine to accumulate by inhibiting activity of methionine adenosyltransferase II, and that both AdoMet and methionine consequently leak abnormally into the plasma. [Copyright &y& Elsevier]

Abstract: Carnitine–acylcarnitine translocase (CACT) deficiency is a rare autosomal recessive disease of fatty acid oxidation, mainly affecting long chain fatty acid utilization. The disease usually presents at neonatal period with severe hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy and/or arrhythmia, hepatic dysfunction, skeletal muscle weakness, and encephalopathy. Definitive diagnosis of CACT deficiency by molecular analysis of the SLC25A20 gene has recently become clinically available. In contrast to biochemical analysis, sequence analysis is a more rapid and reliable method for diagnosis of CACT deficiency. In this study, we used Sanger sequencing and target array CGH to identify molecular defects in the SLC25A20 gene of patients with clinical features and an acylcarnitine profile consistent with CACT deficiency. Eight novel mutations, including a large 25.9kb deletion encompassing exons 5 to 9 of SLC25A20 were found. Review of the published cases revealed that CACT deficiency is a pan-ethnic disorder with a broad mutation spectrum. Mutations are distributed along the entire gene without a hot spot. Two thirds of them are nonsense, frame-shift, or splice site mutations resulting in premature stop codons. This study underscores the importance of comprehensive molecular analysis, including sequencing and targeted array CGH of the SLC25A20 gene when CACT deficiency is suspected. [Copyright &y& Elsevier]

Abstract: Introduction: Pathogenic mutations in the OPA1 gene are the most common identifiable cause of autosomal dominant optic atrophy (DOA), which is characterized by selective retinal ganglion cell loss, a distinctive pattern of temporal pallor of the optic nerve and a typical color vision deficit, with variable effects on visual acuity. Haploinsufficiency has been suggested as the major pathogenic mechanism for DOA. Here we present two siblings with severe ataxia, hypotonia, gastrointestinal dysmotility, dysphagia, and severe, early-onset optic atrophy who were found to be compound heterozygotes for two pathogenic OPA1 mutations. This example expands the clinical phenotype of OPA1-associated disorders and provides additional evidence for semi-dominant inheritance. Methods and results: Molecular analysis of the OPA1 gene in this family by Sanger sequencing revealed compound heterozygosity for two mutations in trans configuration, a p.I382M missense mutation and a p.V903GfsX3 frameshift deletion in both affected siblings. Electron microscopy of a skeletal muscle biopsy of the older sibling revealed dense osmiophilic bodies within the mitochondria. Mitochondrial DNA (mtDNA) content was within normal limits, and electron transport chain analysis showed no deficiencies of the mitochondrial respiratory chain enzymes. Multiple mtDNA deletions were not found. Conclusion: Compound heterozygosity of pathogenic OPA1 mutations may cause severe neuromuscular phenotypes in addition to early-onset optic atrophy. While a role for OPA1 in mtDNA maintenance has been discussed, compound biallelic pathogenic OPA1 mutations in our patients did not result in altered mtDNA copy number, mtDNA deletions, or deficiencies of the electron transport chain, despite the severe clinical phenotype. [Copyright &y& Elsevier]

Abstract: Mutations in DGUOK result in mitochondrial DNA (mtDNA) depletion and may present as neonatal liver failure. Neonatal hemochromatosis (NH1) is a liver disorder of uncertain and varied etiology characterized by hepatic and non-reticuloendothelial siderosis. To date, deoxyguanosine kinase (dGK2) deficiency has not been formally recognized in cases of NH. We report an African American female neonate with clinical and autopsy findings consistent with NH, and mtDNA depletion due to a homozygous mutation in DGUOK. This report highlights hepatocerebral mtDNA depletion in the differential of neonatal tyrosinemia, advocates considering dGK deficiency in cases of NH, and posits mitochondrial oxidative processes in the pathogenesis of NH. [Copyright &y& Elsevier]

Abstract: Metabolic disorders are inborn errors that often present in the neonatal period with a devastating clinical course. If not treated promptly, these diseases can result in severe, irreversible disease or death. Determining the molecular defects in metabolic diseases is important in providing a definitive diagnosis for patient management. Therefore, prenatal diagnosis for families with known mutations causing metabolic disorders is crucial for timely intervention. Here we present three families in which standard Sanger sequencing failed to provide a definitive diagnosis, but the detection of genomic deletions by array comparative genomic hybridization (CGH) specifically targeted to mitochondrial and metabolic disease genes, MitoMet®, was fundamental in providing accurate prenatal diagnosis. In addition, to our knowledge, two deletions are the smallest detected by oligonucleotide array CGH reported for their respective genes, OTC and ARG1. These data highlight the importance of targeted array CGH in patients with suspected metabolic disorders and incomplete or negative sequencing results, as well as its emerging role in prenatal diagnosis. [Copyright &y& Elsevier]

Abstract: Leber hereditary optic neuropathy (LHON) is caused by point mutations in mitochondrial DNA (mtDNA), and is characterized by bilateral, painless sub-acute visual loss that develops during the second decade of life. Here we report the case of a five year old girl who presented with clinical and neuroradiological findings reminiscent of Leigh syndrome but carried a mtDNA mutation m.11778G>A (p.R340H) in the MTND4 gene usually observed in patients with LHON. This case is unusual for age of onset, gender, associated neurological findings and evolution, further expanding the clinical spectrum associated with primary LHON mtDNA mutations. [Copyright &y& Elsevier]

Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are autosomal recessive conditions in which the mtDNA copy number is greatly decreased in affected tissues. The encephalomyopathic group of these syndromes comprise mutations in SUCLA2 and SUCLG1 subunits . In this report, we describe a patient with fatal infantile lactic acidosis associated with mutations in the SUCLG1 gene and mtDNA depletion. Histological and enzymatic abnormalities in skeletal muscle support the diagnosis of this recently described mitochondrial disorder. This case is unique in that prenatal imaging suggested the diagnosis and that the confirmatory molecular diagnosis was established at 2 weeks of age. We describe prenatal MRI and neonatal laboratory disturbances that can point the clinician toward consideration of this diagnosis when treating infantile lactic acidosis. [ABSTRACT FROM AUTHOR]

Abstract: Mutations in the polymerase γ (POLG) gene are among the most common causes of mitochondrial disease and more than 160 POLG mutations have been reported. However, a large proportion of patients suspected of having POLG mutations only have one (heterozygous) definitive pathogenic mutation identified. Using oligonucleotide array CGH, we identified a compound heterozygous large intragenic deletion encompassing exons 15–21 of this gene in a child with Alpers syndrome due to mtDNA depletion. This is the first large POLG deletion reported and the findings show the clinical utility of using array CGH in cases where a single heterozygous mutation has been identified in POLG. [ABSTRACT FROM AUTHOR]

Abstract: CPSI deficiency usually results in severe hyperammonemia presenting in the first days of life warranting prompt diagnosis. Most CPS1 defects are non-recurrent, private mutations, including point mutation, small insertions and deletions. In this study, we report the detection of large deletions varying from 1.4kb to >130kb in the CPS1 gene of 4 unrelated patients by targeted array CGH. These results underscore the importance of analysis of large deletions when only one mutation or no mutations are identified in cases where CPSI deficiency is strongly indicated. [ABSTRACT FROM AUTHOR]

Abstract: Mitochondrial disorders are a large and genetically heterogeneous group of disorders posing a significant diagnostic challenge. Only approximately 10–20% of patients have identifiable alterations in their mitochondrial DNA (mtDNA). The remaining ~80–90% of affected patients likely harbor mutations in nuclear genes, most of which are still poorly characterized, and therefore not amenable to efficient screening using currently available molecular methods. Here we present a patient, who has been followed since birth after presenting with neonatal hyperammonemia, lactic acidosis, Reye-like syndrome episodes, and ventricular tachyarrhythmia. Initial biochemical work-up revealed hyperalaninemia, normal plasma glutamine, mild orotic aciduria and significant amounts of urinary 3-methylglutaconic (3-MGC) and 3-methylglutaric (3-MGA) acids. Muscle biopsy demonstrated the presence of ragged-red fibers and non-specific structural abnormalities of mitochondria. The activities of respiratory chain enzymes (complexes I–IV) showed no deficiency. Mutational analysis of the entire mitochondrial genome did not reveal deleterious point mutations or large deletions. Long-term follow-up was significant for a later-onset hypertrophic cardiomyopathy, muscle weakness, and exercise intolerance. Although she had frequent episodes of Reye-like episodes in infancy and early childhood, mostly triggered by illnesses, these symptoms improved significantly with the onset of puberty. In the light of recent reports linking cases of type IV 3-methylglutaconic aciduria (3-MGCA) and hypertrophic cardiomyopathy to mutations in TMEM70, we proceeded with sequencing analysis of this gene. We identified one previously reported splice site mutation, c.317-2A>G and a novel mutation c.494G>A (p.G165D) in an evolutionarily conserved region predicted to be deleterious. This variant was not identified in 100 chromosomes of healthy control subjects and 200 chromosomes of patients with cardiomyopathies. Western blotting using a polyclonal antibody against ATP5J, subunit F6 of ATP synthase, on patient''s skin fibroblasts showed undetectable amount of the ATP5J protein. In comparison to the previously reported cases, we note that our patient had normal growth parameters and cognitive development, absence of structural heart and urinary tract defects, no dysmorphic features, improvement of symptoms with age, and persistence of hypertrophic cardiomyopathy. [Copyright &y& Elsevier]

Abstract: Pyruvate dehydrogenase complex deficiency is a clinically heterogeneous disorder. Most cases are due to mutations in an X-linked PDHA1 gene encoding the E1α subunit of the multienzyme complex. Females with mutations in the PDHA1 gene may be asymptomatic or have a milder phenotype as a result of skewed X-inactivation, while males are typically more severely affected. We report a case of PDHA1 mosaicism in a male patient who had a milder phenotype. [Copyright &y& Elsevier]

Abstract: Deoxyguanosine kinase (DGUOK) catalyzes the first step of the mitochondrial deoxypurine salvage pathway, the phosphorylation of purine deoxyribonucleosides. Mutations in the DGUOK gene have been linked to inherited mtDNA depletion syndromes, neonatal liver failure, nystagmus, and hypotonia. Previously, we reported the first case of a heterozygous unclassified c.592-4_c.592-3delTT alteration in a patient with DGUOK deficiency without the demonstration of its pathogenicity (). This alteration was predicted to cause aberrant splicing based upon two computer algorithms. We now report a homozygous c.592-4_c.592-3delTT mutation found in two affected siblings of asymptomatic consanguineous parents. The proband presented with symptoms of idiopathic hepatitis, liver dysfunction, nystagmus, and retinal blindness. This individual died at 6months of age due to liver failure. This individual’s affected sibling presented similarly and has remarkable elevations of tyrosine, methionine, and alanine. Many organic acids were elevated in urine, including lactic acid, Krebs cycle intermediates, and para-hydroxy compounds; ketone bodies were also present. RNA studies support aberrant splicing. Sequencing of cDNA detected exon 5 skipping in the two affected siblings, but not in the normal control. These results indicate that the homozygous c.592-4_c.592-3delTT is deleterious and responsible for the DGUOK deficiency. The parents were subsequently confirmed to be carriers of this mutation. In summary, we have demonstrated that c.592-4_c.592-3delTT is a pathogenic splice acceptor site mutation leading to DGUOK deficiency. [Copyright &y& Elsevier]

Abstract: Mitochondrial DNA depletion syndromes are autosomal recessive diseases characterized by a severe decrease in mitochondrial DNA content leading to dysfunction of the affected organ. They are phenotypically heterogeneous and classified as myopathic, encephalomyopathic, or hepatocerebral. The latter group has been associated with mutations in TWINKLE, POLG1, DGUOK genes and recently with mutations in the MPV17 gene. MPV17 encodes a mitochondrial inner membrane protein and plays an as yet poorly understood role in mitochondrial DNA maintenance. Mutations in the MPV17 gene have been reported in patients who came to medical attention during infancy with liver failure, hypoglycemia, failure-to-thrive and neurological symptoms. In addition, a homozygous p.R50Q mutation has been identified in patients with Navajo neurohepatopathy. To date, 13 different mutations in 21 patients have been reported. We report eight new patients with seven novel mutations, including four missense mutations (c.262A>G (p.K88E), c.280G>C (p.G94R), c.293C>T (p.P98L), and c.485C>A (p.A162D)), one in-frame deletion (c.271_273del3 (p.L91del)), one splice site substitution (c.186+2T>C), and one insertion (c.22_23insC). The p.R50Q mutation, which occurs in a CpG dinucleotide, is the most common MPV17 mutation and, to date, has only been found in the homozygous state. Clinically, patients homozygous for p.R50Q or compound heterozygous for the p.G94R and p.P98L mutations have a better prognosis, with all the other mutations associated with early death if not treated by liver transplantation. Localizing the mutations within the predicted MPV17 protein structure reveals clustering of mutations in the region of the putative protein kinase C phosphorylation site. [Copyright &y& Elsevier]

Abstract: Somatic mitochondrial DNA alterations have been found in all types of cancer. To better understand the role of mitochondria and their involvement in the pathogenic mechanisms of cancer development, the effects of cancer mitochondria were investigated in a defined nuclear background using a transmitochondrial cybrid system. Our results demonstrated that cancer mitochondria confer a significant reduction in cell growth when cells are metabolically stressed in a galactose medium. Activities of the respiratory chain complexes, cellular oxygen consumption, and ATP synthesis rates were found to be much lower in breast cancer cells, than those in normal breast epithelial cells of MCF-10A (10A). These results suggest that there is reduced mitochondrial function in the studied breast cancer cell lines. Similarly reduced mitochondrial function was observed in cybrids containing cancer mitochondria. Novel tRNA mutations were also identified in two breast cancer cell lines, possibly responsible for the observed mitochondrial dysfunction. We conclude that altered mitochondria in cancer cells may play a crucial role in tumor development. [Copyright &y& Elsevier]

Abstract: The mitochondrial DNA depletion syndromes (MDS) are autosomal recessive disorders with a decreased mitochondrial DNA copy number. Mutations in thymidine kinase 2 (TK2) have been responsible for the myopathic form of MDS. We describe a child with congenital muscle weakness who had a progressive mitochondrial myopathy associated with extensive fibro-fatty replacement of myofibers resembling muscular dystrophy. MDS was suspected based upon findings in the initial muscle biopsy. Sequence analysis of the TK2 gene revealed two novel heterozygous mutations: the frame shift mutation, c.255_c.258delAGAA, and the heterozygous missense mutation, c.515G>A, (p.R172Q). This report extends the phenotype and genotype of TK2 defects. [Copyright &y& Elsevier]

Abstract: Ornithine transcarbamylase (OTC) deficiency is an X-linked inborn error of metabolism characterized by impaired synthesis of citrulline from carbamylphosphate and ornithine. Previously reported data suggest that only approximately 80% of OTC deficiency (OTCD) patients have a mutation identified by OTC gene sequencing. To elucidate the molecular etiology in patients with clinical signs of OTCD and negative OTC sequencing, we subjected their DNA to array comparative genomic hybridization (aCGH) using a custom-designed targeted 44k oligonucleotide array. Whenever possible, parental DNA was analyzed to determine the inheritance or to rule out copy number variants in the OTC locus. DNA samples from a total of 70 OTCD patients were analyzed. Forty-three patients (43/70 or 61.5%) were found to have disease-causing point mutations in the OTC gene. The remaining 27 patients (27/70 or 38.5%) showed normal sequencing results or failure to amplify all or part of the OTC gene. Among those patients, eleven (11/70 or 15.7%) were found to have deletions ranging from 4.5kb to 10.6Mb, all involving the OTC gene. Sixteen OTCD patients (16/70 or 22.8%) had normal sequencing and oligoarray results. Analysis of the deletions did not reveal shared breakpoints, suggesting that non-homologous end joining or a replication-based mechanism might be responsible for the formation of the observed rearrangements. In summary, we demonstrate that approximately half of the patients with negative OTC sequencing may have OTC gene deletions readily identifiable by the targeted oligonucleotide-based aCGH. Thus, the test should be considered in OTC sequencing-negative patients with classic symptoms of the disease. [Copyright &y& Elsevier]

Abstract: Mitochondrial cytopathies are characterized by a large variability of clinical phenotypes and severity. The 14487T>C mutation in mtDNA has been recently described to be associated with Leigh syndrome. The 12297T>C mutation has been described in isolated dilated cardiomyopathy patients. Here, we report a family with multiple members who harbor both mutations, with only a few individuals who are affected with Leigh syndrome. Mitochondrial whole genome sequencing analysis in the proband’s muscle specimen detected two nearly homoplasmic mutations: 14487T>C (M63V in ND6) and 12297T>C in the tRNA Leu (CUN) gene. These two mutations were also detected in the blood, urine sediments, hair follicles, and buccal swab samples of all matrilineal relatives tested. All individuals tested were nearly homoplasmic for the 12297T>C mutation, but had variable degrees of heteroplasmy for 14487T>C. We also screened for the frequency of these two mutations. Of 268 patients with Leigh or Leigh-like disease, one case was found to harbor the 14487T>C mutation (0.3%), and one had the 12297T>C mutation (0.3%). Neither mutation was detected in the 88 patients meeting MELAS syndrome criteria nor in the 56 patients with respiratory chain complex I or I+III deficiency. In conclusion, the 14487T>C mutation appears as the primary etiology of Leigh syndrome in this family, demonstrating the high level of heteroplasmy needed for a clinically significant phenotype with this mutation. The 12297T>C mutation was not associated with dilated cardiomyopathy for the family members who were clinically evaluated and who were shown by testing to be nearly homoplasmic for that mutation. [Copyright &y& Elsevier]

Abstract: Citrin deficiency, caused by mutations in SLC25A13, can present with neonatal intrahepatic cholestasis or with adult onset neuropsychiatric, hepatic and pancreatic disease. Until recently, it had been thought to be found mostly in individuals of East Asian ancestry. A key diagnostic feature has been the deficient argininosuccinate synthetase (ASS) activity (E.C. 6.3.4.5) in liver, with normal activity in skin fibroblasts. In this series we describe the clinical presentation of 10 patients referred to our laboratories for sequence analysis of the SCL25A13 gene, including several patients who presented with elevated citrulline on newborn screening. In addition to sequence analysis performed on all patients, ASS enzyme activity, citrulline incorporation and Western blot analysis for ASS and citrin were performed on skin fibroblasts if available. We have found 5 unreported mutations including two apparent founder mutations in three unrelated French-Canadian patients. In marked contrast to previous cases, these patients have a markedly reduced ASS activity in skin fibroblasts. The presence of citrin protein on Western blot in three of our cases reduces the sensitivity of a screening test based on protein immunoblotting. The finding of citrin mutations in patients of Arabic, Pakistani, French Canadian and Northern European origins supports the concept that citrin deficiency is a panethnic disease. [Copyright &y& Elsevier]

Abstract: The mitochondrial 13513G>A (D393N) mutation in the ND5 subunit of the respiratory chain complex I was initially described in association with MELAS syndrome. Recent observations have linked this mutation to Leigh disease. We screened for the 13513G>A mutation in a cohort of 265 patients with Leigh and Leigh-like disease. The mutation was found in a total of 5 patients. An additional patient who had clinical presentation consistent with a Leigh-like phenotype but with a normal brain MRI was added to the cohort. None of an additional 88 patients meeting MELAS disease criteria, nor 56 patients with respiratory chain deficiency screened for the 13513G>A were found positive for the mutation. The most frequent clinical manifestations in our patients were hypotonia, ocular and cerebellar involvement. Low mutation heteroplasmy in the range of 20–40% was observed in all 6 patients. This observation is consistent with the previously reported low heteroplasmy of this mutation in some patients with the 13513G>A mutation and complex I deficiency. However, normal complex I activity was observed in two patients in our cohort. As most patients with Leigh-like disease and the 13513G>A mutation have been described with complex I deficiency, this report adds to the previously reported subset of patients with normal respiratory complex function. We conclude that in any patient with Leigh or Leigh-like disease, testing for the 13513G>A mutation is clinically relevant and low mutant loads in blood or muscle may be considered pathogenic, in the presence of normal respiratory chain enzyme activities. [Copyright &y& Elsevier]

Abstract: OPA1 is highly expressed in retina and optic nerve. OPA1 mutations were first identified in patients with non-syndromic autosomal dominant optic atrophy. Recently, OPA1 mutations were detected in a multisystemic disorder which has optic atrophy as the core clinical feature and multiple mitochondrial DNA (mtDNA) deletions in muscle. We report a patient with a multisystemic disorder and multiple muscle mtDNA deletions, carrying an in-frame deletion in OPA1 in the absence of optic atrophy. This patient provides evidence that optic atrophy is not the main clinical manifestation of OPA1-related disorders. OPA1 analysis should be considered in mitochondrial disorders despite the lack of optic atrophy. [Copyright &y& Elsevier]