Search

Mitochondrial genome sequences have been used in diverse fields of biology. In this study, we sequenced the complete mitochondrial genomes (mitogenome) of two pear pests: Cacopsylla jukyungi, the most damaging insect pest to commercial pears in South Korea, and Cacopsylla burckhardti (Hemiptera: Psyllidae). The two mitogenomes were compared to confamilial species to accumulate genetic information and understand evolutionary characteristics of the family Psyllidae. The 15,438 bp-and 14,799 bp-long complete mitogenomes of C. jukyungi and C. burckhardti, respectively, had many features typical of insect mitogenomes; however, at 1283 bp, the C. jukyungi mitogenome had an unusually long A+T-rich region, which was composed of two identical 540-bp repeat sequences. Among the intergenic spacer regions, the one located at the ND1 and trnS2 junction was relatively well conserved in length (mostly within 23–36 bp). This region had a high sequence identity in all Psyllidae, possessing a 5-bp consensus sequence (CGGTA), which is speculated to have a functional role. Though the A+T-rich region in available Psyllidae mitogenomes varied substantially in length (662–1430 bp) and sequence divergence, all species had a conserved sequence stretch at the 3′-end of srRNA, which is also speculated to have a functional role. Genetic divergence among genes indicated the lowest variability in srRNA, lrRNA, and COI, whereas ATP8 and ND6 showed the highest variability at both family and genus (Cacopsylla) levels. Our data provide evidence that the family Psyllidae, including current C. jukyungi and C. burckhardti, have evolutionary unique features that were previously undetected, along with the unique A+T-rich region structure in C. jukyungi. [ABSTRACT FROM AUTHOR]

Amynthas seungpanensis Song and Paik, 1970 (Clitellata: Megascolecidae) is an endemic and ecologically important species in Korea; however, knowledge regarding its genetic characteristics is lacking. In this study, we sequenced the complete mitochondrial genome (mitogenome) of A. seungpanensis. The mitogenome is 15,085-bp long and contains 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and 1 major non-coding region, the control region. This mitogenome has an arrangement identical to that observed in the mitogenomes of most earthworms, and all 37 genes are transcribed from the same directional strand. All 13 PCGs have the same start codon (ATG). Six PCGs (COI, COII, ND6, CytB, ATP6, and ND4) end with TAA and ND4 ends with TAG, whereas the remaining genes exhibit an incomplete stop codon, T. The A/T content of the complete mitogenome is 65.8%; however, it varies among regions and genes as follows: control region, 77.8%; srRNA genes, 65.8%; lrRNA genes, 68.8%; tRNA genes, 64.2%; and PCGs, 65.0%. Results of phylogenetic analyses suggested the family Megascolecidae to be a monophyletic group with the highest nodal support, whereas the genus Amynthas, which belongs to Megascolecidae, was determined to be non-monophyletic. [ABSTRACT FROM AUTHOR]

The complete mitochondrial genome (mitogenome) of Monopis longella Walker, 1863 (Lepidoptera: Tineidae) comprises 15,541 bp and contains a typical set of genes and one non-coding region. The gene arrangement of M. longella is unique for Lepidoptera in that it has a trnI-trnM-trnQ sequence in the A + T-rich region and ND2 junction. Unlike most other lepidopteran insects, in which the COI gene has CGA as the start codon, M. longella COI has an ATT codon. Phylogenetic analyses based on the concatenated sequences of 13 protein-coding genes and two rRNA genes, using the Bayesian inference (BI) method, placed M. longella in the Tineidae, sister in position to the cofamilial species, Tineola bisselliella, with the highest nodal support. Tineidae, represented by three species including M. longella, formed a monophyletic group with high support (Bayesian posterior probability = 0.99). Within Tineoidea the sister relationship between Tineidae and Meessiidae was obtained with the highest support, leaving Psychidae occupying the basal lineage of the two families. [ABSTRACT FROM AUTHOR]

The mitochondrial genome (mitogenome) of Coleophora therinella Tengström, 1848 is the first report for the family Coleophoridae in Lepidoptera. The 15,539-bp long complete genome has an arrangement identical to that observed in most lepidopteran genomes. COI had the atypical CGA codon that is frequently found in the start region of the lepidopteran COI, and COII had the GTG codon found previously in Drosophila yakuba ND5 and Rattus norvegicus ND1. The 457-bp long A + T-rich region was the second largest, next to Blastobasis lacticolella, which belongs to Blastobasidae in the superfamily Gelechioidea. The A/T content of the whole mitogenome was 80.7%; however, it varied among the regions/genes as follows: A + T-rich region, 94.8%; srRNA, 85.0%; lrRNA, 84.3%; tRNAs, 81.5%; and PCGs, 78.9%. Phylogenetic analyses with concatenated sequences of the 13 PCGs and two RNA genes using the maximum likelihood method, placed Coleophoridae, represented only by C. therinella, as the most basal lineage of the Gelechioidea families consisted of Stathmopodidae, Scythrididae, Blastobasidae, Autostichidae, and Oecophoridae, but nodal support for this grouping was very low (27%). Currently, several families of Gelechioidea are represented by a single species. Thus, extended sampling is required for further reasonable inference for the relationships of these families. [ABSTRACT FROM AUTHOR]

To meet the increasing demands of the society in the current era, new strains of the domesticated silkworm Bombyx mori Linnaeus, 1758 (Lepidoptera: Bombycidae) are being continuously bred. Consequently, cataloging the genetic information of pure lines is essential. The strain Jam 146, whose larvae have atypical pale, crescent-shaped body markings, is an important breeding resource due to its excellent fecundity. In this study, we sequenced the mitochondrial genome (mitogenome) of this strain using next-generation sequencing. The complete genome of this strain has a gene arrangement typical of Lepidoptera. The length of the Jam 146 mitogenome (15,661 bp) is well within the range reported in other B. mori strains, i.e. between 15,629 (Baiyun strain, China) and 15,676 bp (Hukpyobeom strain, South Korea). However, the total length of protein-coding genes, 3,733 codons in Jam 146 and two other silkworm strains previously reported from South Korea, is 13 codons longer than that in other B. mori strains. Phylogenetic analysis of 22 silkworm strains from nine countries showed that the Jam 146 strain forms a strong cluster with three other strains from China, Japan, and South Korea, suggesting that after their split from a common ancestor, the evolutionary divergence among the silkworm strains in these countries has been limited. [ABSTRACT FROM AUTHOR]

Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, Apis mellifera ligustica (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite Varroa destructor has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available A. mellifera mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the COIII and trnG junction (88 vs. 70 bp) and ND4 and ND4L junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of A. m. ligustica revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of A. m. ligustica. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines. [ABSTRACT FROM AUTHOR]

We sequenced the mitochondrial genome (mitogeome) of the summer heath fritillary bullterfly, Mellicta ambigua Ménétriès, 1859 (Lepidoptera: Nymphalidae), which is listed as an endangered insect in South Korea. The 15,205-bp long complete genome contained 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and 1 A + T-rich region with an arrangement identical to that observed in most insect mitogenomes. Unlike the other PCGs, COI had the atypical CGA start codon frequently found in lepidopteran COI. The A/T content of the whole mitogenome was 80.57%; however, it varied among the regions/genes as follows: A + T-rich region, 93.39%; srRNA, 85.37%; lrRNA, 84.92%; tRNAs, 81.13%; and PCGs, 79.22%. Phylogenetic analyses using concatenated sequences of the 13 PCGs and 2 rRNAs placed M. ambigua as a sister group to the within-tribe species, Melitaea cinxia, with the highest nodal support both in the maximum-likelihood (ML) and Bayesian inference (BI) methods. [ABSTRACT FROM AUTHOR]

The spotted lanternfly, Lycorma delicatula White, 1845 (Hemiptera: Fulgoridae), is an invasive pest that attacks forest as well as agricultural trees. We sequenced the 15,798-bp long complete mitochondrial genome (mitogenome) of this species; it consists of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region. The orientation and gene order of the L. delicatula mitogenome are identical to that of the ancestral type found in majority of the insects. Bayesian inference (BI) and maximum-likelihood (ML) phylogeny placed the L. delicatula examined in our study, together with other geographical samples of the species in a group with the highest nodal support, forming the subfamily Aphaeninae to which L. delicatula belongs. [ABSTRACT FROM AUTHOR]

The silver stripped skipper, Leptalina unicolor Bremer and Grey, 1853 (Lepidoptera: Hesperiidae), is listed as endangered insect in South Korea. We sequenced the whole genome (15,854 bp) of L. unicolor species using Next-Generation Sequencing method and the subsequent gap-filling method. This genome included a set of typical genes and one major non-coding A + T-rich region, with an arrangement identical to that observed in most lepidopteran genomes. Twelve protein-coding genes (PCGs) had the typical ATN start codon, whereas COI had the atypical CGA codon that is frequently found in the start region of the lepidopteran COI. The 757-bp long A + T-rich region was the second largest among completely sequenced Hesperiidae, which ranged from 234 to 793 bp. Phylogenetic reconstruction was performed by maximum-likelihood method using the concatenated sequences of 13 PCGs and two rRNAs of available species of Hesperiidae, including that of L. unicolor (a total of 28 species). The resulting phylogeny provided strong support for monophyletic Heteropterinae in which L. unicolor belongs, with the highest nodal support and a sister relationship between current L. unicolor and co-subfamilial species Carterocephalus silvicola with a bootstrap value of 91%. [ABSTRACT FROM AUTHOR]

We sequenced the complete mitochondrial genome (mitogenome) of the black-tailed hornet, Vespa ducalis (Hymenoptera: Vespidae). The genome was 15,779-bp long and contained typical sets of genes [13 protein-coding genes (PCGs), 22 tRNAs, and 2 rRNAs]. The V. ducalis A + T-rich region was 166-bp long and was the shortest of all sequenced Vespoidea genomes, including Vespa. The genome was highly biased toward A/T nucleotides-80.1 % in the whole genome, 77.8 % in PCGs, 83.4-85.6 % in RNAs, and 92.8 % in the A + T-rich region. These values are well within the typical range for genes and regions of Vespoidea mitogenomes. Start and stop codons in several Vespa species-including V. ducalis-were diversified, despite these species belonging to the same genus. In comparison with the ancestral mitogenomes, Vespa mitogenomes-including that of V. ducalis-showed substantial gene rearrangement; however, we detected no gene rearrangement among Vespa species. We conducted phylogenetic reconstruction based on concatenated sequences of 13 PCGs and two rRNAs (12,755 bp) in available species of Vespoidea-21 species in six subfamilies in two families (Vespidae and Formicidae). The Bayesian inference and maximum likelihood (ML) methods revealed that each family formed strong monophyletic groups [Bayesian posterior probability (BPP) = 1; ML, 100 %]. Moreover, V. ducalis and V. mandarinia formed a strong sister group (BPP = 1; ML, 94 %). [ABSTRACT FROM AUTHOR]

The complete mitochondrial genome (mitogenome) of Ostrinia palustralis memnialis Walker, 1859 (Lepidoptera: Crambidae) was determined to be 15,246 bp with a typical set of genes (13 protein-coding genes [PCGs], 2 rRNA genes, and 22 tRNA genes) and one non-coding region, with an arrangement identical to that observed in most lepidopteran genomes. Twelve PCGs have the typical ATN start codon, whereas COI has an atypical CGA codon frequently found in the start region of the lepidopteran COI. At 330 bp, the A + T-rich region is well within the range found in other Pyraloidea. The A + T content of the whole genome, PCGs, srRNA, lrRNA, tRNAs, and the A + T-rich region all are well within the range found in other Pyraloidea. Phylogenetic analyses of the concatenated sequences of the 13 PCGs using Bayesian inference (BI) and maximum-likelihood (ML) methods placed O. palustralis as a sister group to Ostrinia furnacalis and Ostrinia nubilalis, with the highest nodal support. The subfamilies within Crambidae, such as Nymphulinae, Spilomelinae, and Pyraustinae, all formed monophyletic groups with the highest nodal support. [ABSTRACT FROM AUTHOR]

We sequenced 15,803 bp of the leaf-rolling-weevil, Apoderus jekelii (Coleoptera: Attelabidae) mitochondrial genome (mitogenome) that lacked ∼8000 bp of the A + T-rich region for the completion of the genomic sequence. The A. jekelii mitogenome, which includes 1169 bp of A + T-rich region, possesses typical sets of genes [13 protein-coding genes (PCGs), 22 tRNA genes, and 2 rRNA genes] and gene arrangement of the species was identical to that commonly found in the majority of the insects. The start codon for ND1 was a rare TTG instead of typical ATN. Nearly, all PCGs ended with complete stop codons, TAA or TAG, except for ND5 which ended with an incomplete T. Phylogenetic analyses using the eight concatenated PCG sequences, which are commonly available for the mitogenome sequences of Curculionoidea, revealed Attelabidae as monophyletic, as well as the sister relationship between current A. jekelii and congeneric species A. coryli in Attelabidae, with the highest nodal supports both in Bayesian inference and maximum likelihood methods. In order to gain a more comprehensive picture of the phylogenetic relationships among the lineages of Attelabidae, an extended analysis with more taxonomic sampling will be necessary. [ABSTRACT FROM AUTHOR]

A partial sequence of the mitochondrial cytochrome oxidase subunit I (COI) gene is widely used as a molecular marker for species identification in animals, also termed a DNA barcode. However, the presence of more than one sequence type in a single individual, also known as heteroplasmy, is one of the shortcomings of barcode identification. In this study, we examined the extent and divergence of COI heteroplasmy, including nuclear-encoded mitochondrial pseudogenes (NUMTs), at the genomic-DNA level from 13 insect species including orthopteranAnapodisma miramae, and a long fragment of mitochondrial DNA and cDNA fromA. miramaeas templates. When multiple numbers of clones originated from genomic DNA were sequenced, heteroplasmy was prevalent in all species and NUMTs were observed in five species. Long fragment DNA (∼13.5 kb) also is a source of heteroplasmic amplification, but the divergent haplotypes and NUMTs obtained from genomic DNA were not detected inA. miramae. On the other hand, cDNA was relatively heteroplasmy-free. Consistently, one dominant haplotype was always obtained from the genomic DNA-origin clones in all species and also from the long fragment- and cDNA-origin clones in the two tested individuals ofA. miramae. Furthermore, the dominant haplotype was identical in sequence, regardless of the DNA source inA. miramae. Thus, one possible solution to avoid the barcoding problem in relationship to heteroplasmy could be the acquisition of multiple numbers of barcoding sequences to determine a dominant haplotype that can be assigned as barcoding sequence for a given species. [ABSTRACT FROM AUTHOR]

Abstract: Lepidoptera is one of the largest insect orders, but the phylogenetic relationships within this order, have yet to be adequately described. Among these unresolved relationships include those regarding the monophyly of the Macrolepidoptera and interfamilial relationships of the true butterflies superfamily Papilionoidea. We present two new mitochondrial genomes (mitogenomes) belonging to the butterfly family Lycaenidae to explore the phylogenetic relationships existing among lepidopteran superfamilies and true butterfly families from a mitogenome perspective, and to evaluate the characteristics of the lepidopteran mitogenomes. Our consensus phylogeny of the Lepidoptera largely supported the superfamilial relationships (((((Bombycoidea+Geometroidea)+Noctuoidea)+Pyraloidea)+Papilionoidea)+Tortricoidea), signifying a lack of support for a traditionally defined Macrolepidoptera. The familial relationships of the true butterflies concordantly recovered the previously proposed phylogenetic hypothesis (((Lycaenidae+Nymphalidae)+Pieridae)+Papilionidae). The test for the effect of optimization schemes (exclusion and inclusion of third codon position of PCGs and two rRNA genes, with and without partitions) on the resolution and relationships within the Lepidoptera have demonstrated that the majority of analyses did not substantially alter the relevant topology and node support, possibly as the result of relatively strong signal in mitogenomes for intraordinal relationships in Lepidoptera. [Copyright &y& Elsevier]

We report the complete mitochondrial genome (mitogenome) ofApodemia mormoin the lepidopteran family Riodinidae. The 15,262 bp long complete genome was comprised of 13 protein-coding genes, two rRNA genes, 22 tRNA genes and 1 major non-coding A + T-rich region, with the arrangement typically found in the majority of Lepidoptera. The genes ofA. mormowere interleaved with a total of 168 bp, which were spread over 16 regions and overlapped 58 bp at eight locations. All tRNAs of theA. mormomitogenome formed a typical cloverleaf structure, except tRNASer(AGN), which formed a truncated dihydrouridine arm. The COI gene started with CGA as seen in other Lepidoptera, instead of canonical ATN. The 349 bp long A + T-rich region harbored conserved sequence blocks, such as an ATAGA motif, a poly-T stretch, a conserved ATTTA sequence, and a microsatellite A/T repeat typically found in Lepidoptera, but absent from the tRNA-like pseudogene. [ABSTRACT FROM AUTHOR]

In this study, we determined the complete mitochondrial genome of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae), from four overlapping fragments. The 15,592 bp C. fulgidissima mitogenome exhibits a gene arrangement and content identical to the most common type in insects. The start codon of the C. fulgidissima COI gene is unusual, in that no typical ATN codon is available. The 875 bp A+T-rich region is the shortest among the coleopteran mitogenomes that have thus far been sequenced in their entirety. The most unusual feature of the genome is the presence of three tRNA-like sequences within the A+T-rich region: two tRNALeu(UUR)-like sequences and one tRNAAsn-like sequence. These sequence stretches have the proper anticodon sequence and the potential to form secondary structures, but also harbor many mismatches in the stems. Phylogenetic analysis using a concatenation of 13 amino acid sequences of protein-coding genes among the available sequenced species of coleopteran superfamilies (Buprestoidea and Elateroidea belonging to the infraorder Elateriformia, and Chrysomeloidea and Tenebrioroidea belonging to the infraorder Cucujiformia) by Bayesian inference, maximum-likelihood analysis, and maximum-parsimony analysis revealed a lack of strong support for monophyletic Elateriformia. [ABSTRACT FROM AUTHOR]

Simple Summary: Bombyx mandarina (Lepidoptera: Bombycidae), the presumed ancestor of B. mori, has long been a subject of study to illustrate the geographic variation in relationship to origin of B. mori. We report 37 mitochondrial genome (mitogenome) sequences of B. mori strains obtained by whole-genome sequencing and four of B. mandarina individuals obtained by Sanger sequencing from South Korea. These mitogenome sequences were combined with 45 public data to uncover the population genetic and phylogenetic relationships among regional populations of B. mandarina and their relationships to B. mori. A substantial genetic reduction in B. mori strains compared to the B. mandarina was detected, with the highest diversity detected in the Chinese origin B. mori. Chinese B. mandarina were divided into northern and southern groups, largely concordant to the Qinling–Huaihe line, and the northern group was placed as an immediate progenitor of monophyletic B. mori strains in phylogenetic analyses. The enigmatic South Korean population of B. mandarina, which has often been regarded as a closer genetic group to Japan, was most similar to the northern Chinese group, evidencing substantial gene flow between the two regions. This is the first report that the South Korean B. mandarina are closer genetically to the northern Chinese group. We report 37 mitochondrial genome (mitogenome) sequences of Bombyx mori strains (Lepidoptera: Bombycidae) and four of B. mandarina individuals, each preserved and collected, respectively, in South Korea. These mitogenome sequences combined with 45 public data showed a substantial genetic reduction in B. mori strains compared to the presumed ancestor B. mandarina, with the highest diversity detected in the Chinese origin B. mori. Chinese B. mandarina were divided into northern and southern groups, concordant to the Qinling–Huaihe line, and the northern group was placed as an immediate progenitor of monophyletic B. mori strains in phylogenetic analyses, as has previously been detected. However, one individual that was in close proximity to the south Qinling–Huaihe line was exceptional, belonging to the northern group. The enigmatic South Korean population of B. mandarina, which has often been regarded as a closer genetic group to Japan, was most similar to the northern Chinese group, evidencing substantial gene flow between the two regions. Although a substantial genetic divergence is present between B. mandarina in southern China and Japan, a highly supported sister relationship between the two regional populations may suggest the potential origin of Japanese B. mandarina from southern China instead of the Korean peninsula. [ABSTRACT FROM AUTHOR]

Acropteris iphiata belongs to the family Uraniidae in the superfamily Geometroidea (Lepidoptera). We sequenced 15,346-bp long complete mitochondrial genome (mitogenome) of the species, which consists of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region. The A. iphiata mitogenome harbored the gene order tRNAMet, tRNAIle, and tRNAGln between the A + T-rich region and ND2 that is found in most lepidopteran mitogenomes. Bayesian inference (BI) and maximum likelihood (ML) phylogeny, using 13 protein-coding genes (PCGs) and 2 rRNAs showed that A. iphiata was placed as a sister to Geometridae with the highest nodal support (Bayesian posterior probabilities for BI = 1.00 and Bootstrap support for ML = 100). [ABSTRACT FROM AUTHOR]

Recently, a new silkworm strain with a peculiar larval marking and rare cocoon colour was bred in Korea for educational learning and exhibition. In order to obtain the genetic information of the newly bred strain, Chilseongjam Bombyx mori (Lepidoptera: Bombycidae), its complete mitochondrial genome (mitogenome) was sequenced. The mitogenome is 15,660 bp in length, contains a typical set of genes, and has gene arrangement and composition typical of Lepidoptera. However, the Chilseongjam strain mitogenome is 4–36 bp longer than 19 other strains originating from other countries and 16 bp shorter than the whole genome of a Korean Hukpyobeom strain. In particular, the Chilseongjam strain has an intergenic spacer sequence that is shorter than that of the Hukpyobeom strain at the tRNAHis and ND4 junction as it has fewer microsatellite-like AT repeats. Phylogenetic analyses conducted using a total of 21 silkworm strains originating from nine countries revealed a few subgroups with moderate-to-high nodal support (80–94%). The Korean Chilseongjam strain formed a relatively strong subgroup (85%) with a Japanese strain (J106) instead of the Korean Hukpyobeom strain. [ABSTRACT FROM AUTHOR]

In Korea, a new Bombyx mori (Lepidoptera: Bombycidae) strain, which has a peculiar larval body marking was bred to draw public attention to the importance of national resources. We sequenced the complete mitochondrial genome (mitogenome) of the strain "Hukpyobeom" and phylogenetic relationships of the strain were analyzed. The complete genome of the strain comprised 15,671 bp, contained a typical set of genes of animals, and had a gene arrangement and composition typical in Lepidoptera. The newly bred "Hukpyobeom" strain had a 20-50 bp longer whole genome size, 39 bp longer protein-coding genes, and 5-23 bp shorter intergenic spacer regions compared to the other strains. Phylogenetic analyses showed the "Hukpyobeom" to form a strong subgroup together with each one Japan- and China-originated strain. A strain originating from Russia (strain name Soviet_Union_No.1) was placed as the most basal lineage, forming a sister to the remaining strains, indicating genetic divergence within B. mori. [ABSTRACT FROM AUTHOR]

The complete mitochondrial genome (mitogenome) of the seven-spotted lady beetle, Coccinella septempunctata (Coleoptera: Coccinellidae), which is one of the best known insects capable of predation, is described with an emphasis on the noteworthy composition of the A+T-rich region. The C. septempunctata genome consists of 2 rRNAs, 22 tRNAs, 13 protein-coding genes, and 1 control region, designated as the A+T-rich region in insects. Along with an unusually long A+T-rich region (4469 bp), the 18,965-bp long C. septempunctata mitogenome was the largest in Coleoptera. The A+T-rich region is composed of a 2214-bp long non-repeat region composed of 80.17% A/T nucleotides and a 2256-bp long repeat region composed of 65.71% A/T nucleotides. The repeat region harbors 32 identical 70-bp long tandem repeats plus one 15-bp long incomplete first repeat. These repeat sequences may possibly have been caused by slipped-strand mispairing and unequal crossing-over events during DNA replication. [ABSTRACT FROM AUTHOR]

The complete mitochondrial genome sequence of the nerippe fritillary butterfly, Argynnis nerippe, which is listed as an endangered species in Korea, is described with an emphasis on the A++T-rich region. The 15,140-bp long circular molecule consisted of 13 protein-coding genes, two rRNA genes, 22 tRNA genes and 1 control region, known in insect as the A++T-rich region, as found in typical metazoans. The 329-bp long A++T-rich region located between srRNA and tRNAMet possessed the highest A/T content (95.7%) than any other region of the genome. Along with the several conserved sequences found typically in the lepidopteran insects the genome contained one tRNAMet-like and tRNALeu(UUR)-like sequence in the A++T-rich region. [ABSTRACT FROM AUTHOR]

We sequenced the complete mitochondrial genome (mitogenome) of Zeuzera multistrigata Moore, 1881 (Lepidoptera: Cossidae), which is an economically damaging pest to a diverse range of Casuarina trees. The 15,260-bp-long mitogenome of this species consists of a typical set of genes, with an arrangement typical of ditrysian Lepidoptera. Of the 13 protein-coding genes (PCGs), 12 have a typical ATN start codon, whereas the COI gene begins with CGA. Ten of the 13 PCGs end with TAA, whereas COI, COII, and ND5 ended with an incomplete termination codon, T. Phylogenetic analysis using 13 PCGs of available superfamilies in Apoditrysia indicated that Z. multistrigata, belonging to the superfamily Cossoidea, formed a sister group with the confamilial species Eogystia hippophaecolus; however, the nodal support for this group was low (46%). As more mitogenomes from ancient groups of Lepidoptera become available, further robust phylogenetic analysis and inference will be possible. [ABSTRACT FROM AUTHOR]