Search

The genomic sequence of the horse has been available since 2009, providing critical resources for discovering important genomic variants regarding both animal health and population structures. However, to fully understand the functional implications of these variants, detailed annotation of the horse genome is required. Due to the limited availability of functional data for the equine genome, as well as the technical limitations of short-read RNA-seq, existing annotation of the equine genome contains limited information about important aspects of gene regulation, such as alternate isoforms and regulatory elements, which are either not transcribed or transcribed at a very low level. To solve above problems, the Functional Annotation of the Animal Genomes (FAANG) project proposed a systemic approach to tissue collection, phenotyping, and data generation, adopting the blueprint laid out by the Encyclopedia of DNA Elements (ENCODE) project. Here we detail the first comprehensive overview of gene expression and regulation in the horse, presenting 39,625 novel transcripts, 84,613 candidate cis-regulatory elements (CRE) and their target genes, 332,115 open chromatin regions genome wide across a diverse set of tissues. We showed substantial concordance between chromatin accessibility, chromatin states in different genic features and gene expression. This comprehensive and expanded set of genomics resources will provide the equine research community ample opportunities for studies of complex traits in the horse., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2023 Peng et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Cytosine methylation patterns have not yet been thoroughly studied in horses. Here, we profile n = 333 samples from 42 horse tissue types at loci that are highly conserved between mammalian species using a custom array (HorvathMammalMethylChip40). Using the blood and liver tissues from horses, we develop five epigenetic aging clocks: a multi-tissue clock, a blood clock, a liver clock and two dual-species clocks that apply to both horses and humans. In addition, using blood methylation data from three additional equid species (plains zebra, Grevy's zebras and Somali asses), we develop another clock that applies across all equid species. Castration does not significantly impact the epigenetic aging rate of blood or liver samples from horses. Methylation and RNA data from the same tissues define the relationship between methylation and RNA expression across horse tissues. We expect that the multi-tissue atlas will become a valuable resource., (© 2022. The Author(s).)

Myosinopathies are defined as a group of muscle disorders characterized by mutations in genes encoding myosin heavy chains. Their exact molecular and cellular mechanisms remain unclear. In the present study, we have focused our attention on a MYH1 -related E321G amino acid substitution within the head region of the type IIx skeletal myosin heavy chain, associated with clinical signs of atrophy, inflammation and/or profound rhabdomyolysis, known as equine myosin heavy chain myopathy. We performed Mant-ATP chase experiments together with force measurements on isolated IIx myofibres from control horses ( MYH1 E321G-/- ) and Quarter Horses homozygous ( MYH1 E321G+/+ ) or heterozygous ( MYH1 E321G+/- ) for the E321G mutation. The single residue replacement did not affect the relaxed conformations of myosin molecules. Nevertheless, it significantly increased its active behaviour as proven by the higher maximal force production and Ca 2+ sensitivity for MYH1 E321G+/+ in comparison with MYH1 E321G+/- and MYH1 E321G-/- horses. Altogether, these findings indicate that, in the presence of the E321G mutation, a molecular and cellular hyper-contractile phenotype occurs which could contribute to the development of the myosin heavy chain myopathy.

Recombinant human erythropoietin (rHuEPO) is a well-known performance enhancing drug in human athletes, and there is anecdotal evidence of it being used in horse racing for the same purpose. rHuEPO, like endogenous EPO, increases arterial oxygen content and thus aerobic power. Micro-doping, or injecting smaller doses over a longer period of time, has become an important concern in both human and equine athletics since it is more difficult to detect. Horses offer an additional challenge of a contractile spleen, thus large changes in the red blood cell mass occur naturally. To address the challenge of detecting rHuEPO doping in horse racing, we determined the transcriptomic effects of rHuEPO micro-dosing over seven weeks in exercised Thoroughbreds. RNA-sequencing of peripheral blood mononuclear cells isolated at several time points throughout the study identified three transcripts ( C13H16orf54 , PUM2 and CHTOP ) that were significantly ( P FDR < 0.05) different between the treatment groups across two or three time point comparisons. PUM2 and CHTOP play a role in erythropoiesis while not much is known about C13H16orf54 , but it is primarily expressed in whole blood. However, gene expression differences were not large enough to detect via RT-qPCR, thereby precluding their utility as biomarkers of micro-doping.

The horse reference genome assemblies, EquCab2.0 and EquCab3.0, have enabled great advancements in the equine genomics field, from tools to novel discoveries. However, significant gaps of knowledge regarding genome function remain, hindering the study of complex traits in horses. In an effort to address these gaps and with inspiration from the Encyclopedia of DNA Elements (ENCODE) project, the equine Functional Annotation of Animal Genome (FAANG) initiative was proposed to bridge the gap between genome and gene expression, providing further insights into functional regulation within the horse genome. Three years after launching the initiative, the equine FAANG group has generated data from more than 400 experiments using over 50 tissues, targeting a variety of regulatory features of the equine genome. In this review, we examine how valuable lessons learned from the ENCODE project informed our decisions in the equine FAANG project. We report the current state of the equine FAANG project and discuss how FAANG can serve as a template for future expansion of functional annotation in the equine genome and be used as a reference for studies of complex traits in horse. A well-annotated reference functional atlas will also help advance equine genetics in the pan-genome and precision medicine era.

Vitamin E deficiencies can impact normal growth and development in humans and animals, and assessment of circulating levels of vitamin E and its metabolites may be an important endpoint for evaluation. Development of a sensitive method to detect and quantify low concentrations of vitamin E and metabolites in biological specimens allows for a proper diagnosis for patients and animals that are deficient. We developed a method to simultaneously extract, detect, and quantify the vitamin E compounds alpha-tocopherol (α-TP), gamma-tocopherol (γ-TP), alpha-tocotrienol (α-TT), and gamma-tocotrienol (γ-TT), and the corresponding metabolites formed after β-oxidation of α-TP and γ-TP, alpha-carboxymethylbutyl hydroxychroman (α-CMBHC) and alpha- or gamma-carboxyethyl hydroxychroman (α- or γ-CEHC), respectively, from equine plasma and serum. Quantification was achieved through liquid chromatography-tandem mass spectrometry. We applied a 96-well high-throughput format using a Phenomenex Phree plate to analyze plasma and serum. Compounds were separated by using a Waters ACQUITY UPLC BEH C18 column with a reverse-phase gradient. The limits of detection for the metabolites and vitamin E compounds were 8-330 pg/mL. To validate the method, intra-day and inter-day accuracy and precision were evaluated along with limits of detection and quantification. The method was then applied to determine concentrations of these analytes in plasma and serum of horses. Alpha-TP levels were 3-6 µg/mL of matrix; the metabolites were found at much lower levels, 0.2-1.0 ng/mL of matrix.

Many forage types are available, typically divided into cool or warm season grasses and legumes, which can be fed as fresh pasture or after preservation. Testing for nutrient content confirms what should be supplemented to make up shortfalls. Although testing is recommended, it is not always practical. Typical values for the forage type are available; however, they cannot be relied on for actual content. Non-nutritional aspects must also be taken into account. The provision of complementary feeds to ensure adequate vitamin and mineral intake is recommended. Additional supplementary high-quality protein may be required to meet essential amino acid requirements., Competing Interests: Disclosure There are no commercial or financial conflicts of interest or any funding source for any of the authors., (Copyright © 2020 Elsevier Inc. All rights reserved.)

The in vivo metabolism and pharmacokinetics of flunixin meglumine and phenylbutazone have been extensively characterized; however, there are no published reports describing the in vitro metabolism, specifically the enzymes responsible for the biotransformation of these compounds in horses. Due to their widespread use and, therefore, increased potential for drug-drug interactions and widespread differences in drug disposition, this study aims to build on the limited current knowledge regarding P450-mediated metabolism in horses. Drugs were incubated with equine liver microsomes and a panel of recombinant equine P450s. Incubation of phenylbutazone in microsomes generated oxyphenbutazone and gamma-hydroxy phenylbutazone. Microsomal incubations with flunixin meglumine generated 5-OH flunixin, with a kinetic profile suggestive of substrate inhibition. In recombinant P450 assays, equine CYP3A97 was the only enzyme capable of generating oxyphenbutazone while several members of the equine CYP3A family and CYP1A1 were capable of catalyzing the biotransformation of flunixin to 5-OH flunixin. Flunixin meglumine metabolism by CYP1A1 and CYP3A93 showed a profile characteristic of biphasic kinetics, suggesting two substrate binding sites. The current study identifies specific enzymes responsible for the metabolism of two NSAIDs in horses and provides the basis for future study of drug-drug interactions and identification of reasons for varying pharmacokinetics between horses., (© 2020 John Wiley & Sons Ltd.)

Objective: To describe the pharmacokinetics and selected pharmacodynamic variables of codeine and its metabolites in Thoroughbred horses following a single oral administration., Study Design: Prospective experimental study., Animals: A total of 12 Thoroughbred horses, nine geldings and three mares, aged 4-8 years., Methods: Horses were administered codeine (0.6 mg kg -1 ) orally and blood was collected before administration and at various times until 120 hours post administration. Plasma and urine samples were collected and analyzed for codeine and its metabolites by liquid chromatography-mass spectrometry, and plasma pharmacokinetics were determined. Heart rate and rhythm, step counts, packed cell volume and total plasma protein were measured before and 4 hours after administration., Results: Codeine was rapidly converted to the metabolites norcodeine, codeine-6-glucuronide (C6G), morphine, morphine-3-glucuronide (M3G) and morphine-6-glucuronide (M6G). Plasma codeine concentrations were best represented using a two-compartment model. The C max, t max and elimination t ½ were 270.7 ± 136.0 ng mL -1 , 0.438 ± 0.156 hours and 2.00 ± 0.534 hours, respectively. M3G was the main metabolite detected (C max 492.7 ± 35.5 ng mL -1 ), followed by C6G (C max 96.1 ± 33.8 ng mL -1 ) and M6G (C max 22.3 ± 4.96 ng mL -1 ). Morphine and norcodeine were the least abundant metabolites with C max of 3.17 ± 0.95 and 1.42 ± 0.79 ng mL -1 , respectively. No significant adverse or excitatory effects were observed., Conclusions and Clinical Relevance: Following oral administration, codeine is rapidly metabolized to morphine, M3G, M6G, C6G and norcodeine in horses. Plasma concentrations of M6G, a presumed active metabolite of morphine, were comparable to concentrations reported previously following administration of an analgesic dose of morphine to horses. Codeine was well tolerated based on pharmacodynamic variables and behavioral observations., (Copyright © 2020 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.)

Reasons for Performing Study: Although muscle mass strongly influences performance, there is currently no effective means to measure the 3-dimensional muscle mass of horses. We evaluated a 3-dimensional (3D) scanning methodology for its ability to quantify torso and hindquarter volumes as a proxy for regional muscle mass in horses., Objectives: Determine the repeatability of 3D scanning volume (V) measurements and their correlation to body weight, estimated body volume and muscle/fat ultrasound (US) depth., Methods: Handheld 3D photonic scans were performed on 16 Quarter Horses of known body weight 56 days apart (n = 32 scans) with each scan performed in duplicate (n = 32 replicates). Tail head fat, gluteal and longissimus dorsi muscle depths were measured using US. Processed scans were cropped to isolate hindquarter (above hock, caudal to tuber coxae) and torso (hindquarter plus dorsal thoracolumbar region) segments and algorithms used to calculate V. Torso and hindquarter volume were correlated with body weight and US using Pearson's correlation and with estimated torso volume (50% body weight / body density) with Bland-Altman analysis., Results: Scans took 2 min with < 3.5% error for duplicate scans. Torso volume (R = 0.90, P< 0.001) and hindquarter volume (R = 0.82, P< 0.001) strongly correlated with body weight and estimated BV (R = 0.91) with low bias. Torso volume moderately correlated to mean muscle US depth (R = 0.4, P< 0.05) and tail head fat (R = 0.42, P< 0.01). Mean muscle US depth moderately correlated to body weight (R = 0.50, P< 0.01)., Main Limitations: 3D Scans determine body volume not muscle volume., Conclusions: The hand-held 3D scan provided a rapid repeatable assessment of torso and hindquarter volume strongly correlated to body weight and estimated volume. Superimposition of regional scans and volume measures could provide a practical means to follow muscle development when tail head fat depth remain constant., Competing Interests: The authors have declared that no competing interests exist.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype ( p = 2.05 × 10 -7 and 4.72 × 10 -6 ). Within this region, caytaxin ( ATCAY ) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY ® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcay ji -hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcay ji -hes mice. Additionally, supplementation of homozygous Atcay ji -hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM.

The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromere research. Despite extremely low genetic diversity of the Y chromosome, it has been possible to trace patrilines of breeds and pedigrees and show that Y variation was lost in the past approximately 2300 years owing to selective breeding. The high-quality reference genome has led to the development of three different SNP arrays and WGSs of almost 2000 modern individual horses. The collection of WGS of hundreds of ancient horses is unique and not available for any other domestic species. These tools and resources have led to global population studies dissecting the natural history of the species and genetic makeup and ancestry of modern breeds. Most importantly, the available tools and resources, together with the discovery of functional elements, are dissecting molecular causes of a growing number of Mendelian and complex traits. The improved understanding of molecular underpinnings of various traits continues to benefit the health and performance of the horse whereas also serving as a model for complex disease across species., (© 2019 The Authors. Animal Genetics published by John Wiley & Sons Ltd on behalf of Stichting International Foundation for Animal Genetics.)

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit ( TRIM39-RPP21 ) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic ( P = 1.00) or allelic ( P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 ( ADGRL3 ) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs ( P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses.

The Functional Annotation of Animal Genomes (FAANG) project aims to identify genomic regulatory elements in both sexes across multiple stages of development in domesticated animals. This study represents the first stage of the FAANG project for the horse, Equus caballus. A biobank of 80 tissue samples, two cell lines and six body fluids was created from two adult Thoroughbred mares. Ante-mortem assessments included full physical examinations, lameness, ophthalmologic and neurologic evaluations. Complete blood counts and serum biochemistries were also performed. At necropsy, in addition to tissue samples, aliquots of serum, ethylenediaminetetraacetic acid (EDTA) plasma, heparinized plasma, cerebrospinal fluid, synovial fluid, urine and microbiome samples from all regions of the gastrointestinal and urogenital tracts were collected. Epidermal keratinocytes and dermal fibroblasts were cultured from skin samples. All tissues were grossly and histologically evaluated by a board-certified veterinary pathologist. The results of the clinical and pathological evaluations identified subclinical eosinophilic and lymphocytic infiltration throughout the length of the gastrointestinal tract as well as a mild clinical lameness in both animals. Each sample was cryo-preserved in multiple ways, and nuclei were extracted from selected tissues. These samples represent the first published systemically healthy equine-specific biobank with extensive clinical phenotyping ante- and post-mortem. The tissues in the biobank are intended for community-wide use in the functional annotation of the equine genome. The use of the biobank will improve the quality of the reference annotation and allow all equine researchers to elucidate unknown genomic and epigenomic causes of disease., (© 2018 Stichting International Foundation for Animal Genetics.)

Background: To date, genome-scale analyses in the domestic horse have been limited by suboptimal single nucleotide polymorphism (SNP) density and uneven genomic coverage of the current SNP genotyping arrays. The recent availability of whole genome sequences has created the opportunity to develop a next generation, high-density equine SNP array., Results: Using whole genome sequence from 153 individuals representing 24 distinct breeds collated by the equine genomics community, we cataloged over 23 million de novo discovered genetic variants. Leveraging genotype data from individuals with both whole genome sequence, and genotypes from lower-density, legacy SNP arrays, a subset of ~5 million high-quality, high-density array candidate SNPs were selected based on breed representation and uniform spacing across the genome. Considering probe design recommendations from a commercial vendor (Affymetrix, now Thermo Fisher Scientific) a set of ~2 million SNPs were selected for a next-generation high-density SNP chip (MNEc2M). Genotype data were generated using the MNEc2M array from a cohort of 332 horses from 20 breeds and a lower-density array, consisting of ~670 thousand SNPs (MNEc670k), was designed for genotype imputation., Conclusions: Here, we document the steps taken to design both the MNEc2M and MNEc670k arrays, report genomic and technical properties of these genotyping platforms, and demonstrate the imputation capabilities of these tools for the domestic horse.

Background: Efforts to resolve the transcribed sequences in the equine genome have focused on protein-coding RNA. The transcription of the intergenic regions, although detected via total RNA sequencing (RNA-seq), has yet to be characterized in the horse. The most recent equine transcriptome based on RNA-seq from several tissues was a prime opportunity to obtain a concurrent long non-coding RNA (lncRNA) database., Results: This lncRNA database has a breadth of eight tissues and a depth of over 20 million reads for select tissues, providing the deepest and most expansive equine lncRNA database. Utilizing the intergenic reads and three categories of novel genes from a previously published equine transcriptome pipeline, we better describe these groups by annotating the lncRNA candidates. These lncRNA candidates were filtered using an approach adapted from human lncRNA annotation, which removes transcripts based on size, expression, protein-coding capability and distance to the start or stop of annotated protein-coding transcripts., Conclusion: Our equine lncRNA database has 20,800 transcripts that demonstrate characteristics unique to lncRNA including low expression, low exon diversity and low levels of sequence conservation. These candidate lncRNA will serve as a baseline lncRNA annotation and begin to describe the RNA-seq reads assigned to the intergenic space in the horse.

In the horse, the term occipitoatlantoaxial malformation (OAAM) is used to describe a developmental defect in which the first cervical vertebra (atlas) resembles the base of the skull (occiput) and the second cervical vertebra (axis) resembles the atlas. Affected individuals demonstrate an abnormal posture and varying degrees of ataxia. The homeobox (HOX) gene cluster is involved in the development of both the axial and appendicular skeleton. Hoxd3-null mice demonstrate a strikingly similar phenotype to Arabian foals with OAAM. Whole-genome sequencing was performed in an OAAM-affected horse (OAAM1) and seven unaffected Arabian horses. Visual inspection of the raw reads within the region of HOXD3 identified a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3. A genotyping assay revealed that both parents of OAAM1 were heterozygous for the deletion. Additional genotyping identified two of 162 heterozygote Arabians, and the deletion was not present in 371 horses of other breeds. Comparative genomics studies have revealed that this region is highly conserved across species and that the entire genomic region between Hoxd4 and Hoxd3 is transcribed in mice. Two additional Arabian foals diagnosed with OAAM (OAAM 2 and 3) were genotyped and did not have the 2.7-kb deletion. Closer examination of the phenotype in these cases revealed notable variation. OAAM3 also had facial malformations and a patent ductus arteriosus, and the actual malformation at the craniocervical junction differed. Genetic heterogeneity may exist across the HOXD locus in Arabian foals with OAAM., (© 2017 Stichting International Foundation for Animal Genetics.)

Horses belong to the order Perissodactyla and bear the majority of their weight on their third toe; therefore, tremendous force is applied to each hoof. An inherited disease characterized by a phenotype restricted to the dorsal hoof wall was identified in the Connemara pony. Hoof wall separation disease (HWSD) manifests clinically as separation of the dorsal hoof wall along the weight-bearing surface of the hoof during the first year of life. Parents of affected ponies appeared clinically normal, suggesting an autosomal recessive mode of inheritance. A case-control allelic genome wide association analysis was performed (ncases = 15, ncontrols = 24). Population stratification (λ = 1.48) was successfully improved by removing outliers (ncontrols = 7) identified on a multidimensional scaling plot. A genome-wide significant association was detected on chromosome 8 (praw = 1.37x10-10, pgenome = 1.92x10-5). A homozygous region identified in affected ponies spanned from 79,936,024-81,676,900 bp and contained a family of 13 annotated SERPINB genes. Whole genome next-generation sequencing at 6x coverage of two cases and two controls revealed 9,758 SNVs and 1,230 indels within the ~1.7-Mb haplotype, of which 17 and 5, respectively, segregated with the disease and were located within or adjacent to genes. Additional genotyping of these 22 putative functional variants in 369 Connemara ponies (ncases = 23, ncontrols = 346) and 169 horses of other breeds revealed segregation of three putative variants adjacent or within four SERPIN genes. Two of the variants were non-coding and one was an insertion within SERPINB11 that introduced a frameshift resulting in a premature stop codon. Evaluation of mRNA levels at the proximal hoof capsule (ncases = 4, ncontrols = 4) revealed that SERPINB11 expression was significantly reduced in affected ponies (p<0.001). Carrier frequency was estimated at 14.8%. This study describes the first genetic variant associated with a hoof wall specific phenotype and suggests a role of SERPINB11 in maintaining hoof wall structure.

Genome sequencing of the domestic horse and subsequent advancements in the field of equine genomics have led to an explosion in the development of tools for mapping traits and diseases and evaluating gene expression. The objective of this review is to discuss the current progress in the field of equine genomics, with specific emphasis on assembly and analysis of the reference sequence and subsequent sequencing of a Quarter Horse mare; the genomic tools currently available to researchers and their implications in genomic investigations in the horse; the genomics of Mendelian and non-Mendelian traits; the genomics of performance traits and considerations regarding genetic testing in the horse. The whole-genome sequencing of a Quarter Horse mare has provided additional variants within the equine genome that extend past single nucleotide polymorphisms to include insertions/deletions and copy number variants. Equine single nucleotide polymorphism arrays have allowed for the investigation of both simple and complex genetic traits while DNA microarrays have provided a tool for examining gene expression across various tissues and with certain disease conditions. Recently, next-generation sequencing has become more affordable and both whole-genome DNA sequencing and transcriptome-wide RNA sequencing are methodologies that are being applied to equine genomic research. Research in the field of equine genomics continues to expand rapidly as the cost of genotyping and sequencing decreases, resulting in a need for quality bioinformatics software and expertise to appropriately handle both the size and complexity of these data., (© 2014 EVJ Ltd.)

BackgroundIn humans, the drug metabolizing enzyme CYP2D6 is highly polymorphic resulting in substantial differences in the metabolism of drugs including anti-arrhythmics, neuroleptics, and opioids. The objective of this study was to phenotype a population of 100 horses from five different breeds and assess differences in the metabolic activity of the equine CYP2D6 homolog using codeine as a probe drug. Administration of a probe drug is a common method used for patient phenotyping in human medicine, whereby the ratio of parent drug to metabolite (metabolic ratio, MR) can be used to compare relative enzyme function between individuals. A single oral dose of codeine (0.6 mg/kg) was administered and plasma concentrations of codeine and its metabolites were determined using liquid chromatography mass spectrometry. The MR of codeine O-demethylation [(codeine)/(morphine + morphine-3-glucuronide + morphine-6-glucuronide)] was determined using the area under the plasma concentration-time curve extrapolated from time zero to infinity (AUC0-∞) for each analyte and used to group horses into predicted phenotypes (high-, moderate-, and low-MR).ResultsThe MR of codeine O-demethylation ranged from 0.002 to 0.147 (median 0.018) among all horses. No significant difference in MR was observed between breeds, age, or sex. Of the 100 horses, 11 were classified as high-MR, 72 moderate-MR, and 17 low-MR. Codeine AUC0-∞ and O-demethylation MR were significantly different (p

BackgroundCatastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic breakdown.ObjectivesEstimate the frequency of the WFFS allele (PLOD1 c.2032G>A) and determine if it is a risk factor for catastrophic breakdown in the Thoroughbred.Study designCase-control genetic study.MethodsGenomic DNA from hair and/or tissue samples was genotyped for the WFFS allele. Fisher's Exact tests were performed to compare allele and carrier frequencies between the case cohort (catastrophic breakdown, n = 22) and several cohorts with no record of injury (n = 138 raced/trained at same track and season and n = 185 older than 7 years and raced during same season), nonracers (n = 92), and a random sample without consideration for racing history (n = 279).ResultsThe frequency of the PLOD1 c.2032G>A variant in the Thoroughbred breed is low (1.2%). Seventeen of 716 Thoroughbreds tested were carriers (2.4%) and no WFFS homozygotes were detected. Only one catastrophic breakdown case carried the WFFS allele. No statistically significant difference in allele or carrier frequency was identified between case and control cohorts (P>0.05 in all comparisons performed).Main limitationsThis study evaluated cases from one single track.ConclusionsThis study demonstrated that the PLOD1 c.2032G>A associated with WFFS is present at very low frequency in Thoroughbreds and is not a genetic risk factor for catastrophic breakdown.

Cerebellar Abiotrophy (CA) is a neurodegenerative disease in Arabian horses affecting the cerebellum, more specifically the Purkinje neurons. Although CA occurs in several domestic species, CA in Arabian horses is unique in that a single nucleotide polymorphism (SNP) has been associated with the disease. Total RNA sequencing (RNA-seq) was performed on CA-affected horses to address the molecular mechanism underlying the disease. This research expands upon the RNA-seq work by measuring the impact of the CA-associated SNP on the candidate gene MutY homolog (MUTYH) and its regulation, isoform-specific expression and protein localization. We hypothesized that the CA-associated SNP compromises the promoter region of MUTYH, leading to differential expression of its isoforms. Our research demonstrates that the CA-associated SNP introduces a new binding site for a novel transcription factor (Myelin Transcription Factor-1 Like protein, MYT1L). In addition, CA-affected horses show differential expression of a specific isoform of MUTYH as well as different localization in the Purkinje and granular neurons of the cerebellum.

BackgroundThe carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown.Hypothesis/objectivesTo determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE.AnimalsTen foals with JIE.Materials and methodsArchived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalographic examination.ResultsTen Egyptian Arabian horses (5 females and 5 males) were phenotyped as foals with JIE by electroencephalography (EEG). All foals were negative for the genetic mutations that cause LFS, CA, SCID, and OAAM1 except for 1 foal that was a carrier of CA.Conclusions and clinical importanceJuvenile idiopathic epilepsy of Egyptian Arabian foals and LFS appear to be phenotypically and genetically distinct disorders. There was no apparent association between JIE and LFS, CA, SCID, and OAAM1.

BackgroundTranscriptome interpretation relies on a good-quality reference transcriptome for accurate quantification of gene expression as well as functional analysis of genetic variants. The current annotation of the horse genome lacks the specificity and sensitivity necessary to assess gene expression especially at the isoform level, and suffers from insufficient annotation of untranslated regions (UTR) usage. We built an annotation pipeline for horse and used it to integrate 1.9 billion reads from multiple RNA-seq data sets into a new refined transcriptome.ResultsThis equine transcriptome integrates eight different tissues from 59 individuals and improves gene structure and isoform resolution, while providing considerable tissue-specific information. We utilized four levels of transcript filtration in our pipeline, aimed at producing several transcriptome versions that are suitable for different downstream analyses. Our most refined transcriptome includes 36,876 genes and 76,125 isoforms, with 6474 candidate transcriptional loci novel to the equine transcriptome.ConclusionsWe have employed a variety of descriptive statistics and figures that demonstrate the quality and content of the transcriptome. The equine transcriptomes that are provided by this pipeline show the best tissue-specific resolution of any equine transcriptome to date and are flexible for several downstream analyses. We encourage the integration of further equine transcriptomes with our annotation pipeline to continue and improve the equine transcriptome.

BackgroundAlpha-tocopherol (α-TP) supplementation is recommended for the prevention of various equine neuromuscular disorders. Formulations available include RRR-α-TP acetate powder and a more expensive but rapidly water-dispersible liquid RRR-α-TP (WD RRR-α-TP). No cost-effective means of rapidly increasing serum and cerebrospinal fluid (CSF) α-TP with WD RRR-α-TP and then sustaining concentrations with RRR-α-TP acetate has yet been reported.ObjectivesTo evaluate serum, CSF and muscle α-TP concentrations in an 8-week dosing regimen in which horses were transitioned from WD RRR-α-TP to RRR-α-TP acetate.Study designNon-randomised controlled trial.MethodsHealthy horses with serum α-TP of

BackgroundTo report a novel exertional myopathy, myofibrillar myopathy (MFM) in Warmblood (WB) horses.ObjectivesTo 1) describe the distinctive clinical and myopathic features of MFM in Warmblood horses and 2) investigate the potential inheritance of MFM in a Warmblood family.Study designRetrospective selection of MFM cases and prospective evaluation of a Warmblood family.MethodsRetrospectively, muscle biopsies were selected from Warmblood horses diagnosed with MFM and clinical histories obtained (n = 10). Prospectively, muscle biopsies were obtained from controls (n = 8) and a three generation WB family (n = 11). Samples were assessed for histopathology [scored 0-3], fibre types, cytoskeletal and Z disc protein aggregates, electron microscopic alterations (EM) and muscle glycogen concentrations.ResultsMyofibrillar myopathy-affected cases experienced exercise intolerance, reluctance to go forward, stiffness and poorly localised lameness. Abnormal aggregates of the cytoskeletal protein desmin were found in up to 120 type 2a and a few type 2x myofibres of MFM cases. Desmin positive fibres did not stain for developmental myosin, α actinin or dystrophin. Scores for internalised myonuclei (score MFM 0.83 ± 0.67, controls 0.22 ± 0.45), anguloid atrophy (MFM 0.95 ± 0.55, controls 0.31 ± 0.37) and total myopathic scores (MFM 5.85 ± 2.10, controls 1.41 ± 2.17) were significantly higher in MFM cases vs.ControlsFocal Z disc degeneration, myofibrillar disruption and accumulation of irregular granular material was evident in MFM cases. Muscle glycogen concentrations were similar between MFM cases and controls. In the Warmblood family, desmin positive aggregates were found in myofibres of the founding dam and in horses from two subsequent generations.Main limitationsRestricted sample size due to limited availability of well phenotyped cases.ConclusionsA distinctive and potentially heritable form of MFM exists in Warmblood horses that present with exercise intolerance and abnormal hindlimb gait. Muscle tissue is characterised by ectopic accumulation of desmin and Z disc and myofibrillar degeneration.

Equine cerebellar abiotrophy (CA) is a hereditary neurodegenerative disease that affects the Purkinje neurons of the cerebellum and causes ataxia in Arabian foals. Signs of CA are typically first recognized either at birth to any time up to 6 months of age. CA is inherited as an autosomal recessive trait and is associated with a single nucleotide polymorphism (SNP) on equine chromosome 2 (13074277G>A), located in the fourth exon of TOE1 and in proximity to MUTYH on the antisense strand. We hypothesize that unraveling the functional consequences of the CA SNP using RNA-seq will elucidate the molecular pathways underlying the CA phenotype. RNA-seq (100 bp PE strand-specific) was performed in cerebellar tissue from four CA-affected and five age-matched unaffected horses. Three pipelines for differential gene expression (DE) analysis were used (Tophat2/Cuffdiff2, Kallisto/EdgeR, and Kallisto/Sleuth) with 151 significant DE genes identified by all three pipelines in CA-affected horses. TOE1 (Log2(foldchange) = 0.92, p = 0.66) and MUTYH (Log2(foldchange) = 1.13, p = 0.66) were not differentially expressed. Among the major pathways that were differentially expressed, genes associated with calcium homeostasis and specifically expressed in Purkinje neurons, CALB1 (Log2(foldchange) = -1.7, p

Reasons for performing studyAlthough exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER.ObjectivesTo prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER).Study designProspective and retrospective histopathological description.MethodsMiddle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests.ResultsCentrally located myonuclei in mature myofibres were found in significantly more (P

BackgroundMajor histocompatibility complex (MHC) I and II expression is not normally detected on sarcolemma, but is detected with lymphocytic infiltrates in immune-mediated myositis (IMM) of humans and dogs and in dysferlin-deficient muscular dystrophy.Hypothesis/objectivesTo determine if sarcolemmal MHC is expressed in active IMM in horses, if MHC expression is associated with lymphocytic subtype, and if dysferlin is expressed in IMM.AnimalsTwenty-one IMM horses of Quarter Horse-related breeds, 3 healthy and 6 disease controls (3 pasture myopathy, 3 amylase-resistant polysaccharide storage myopathy [PSSM]).MethodsImmunohistochemical staining for MHC I, II, and CD4+, CD8+, CD20+ lymphocytes was performed on archived muscle of IMM and control horses. Scores were given for MHC I, II, and lymphocytic subtypes. Immunofluorescent staining for dysferlin, dystrophin, and a-sarcoglycan was performed.ResultsSarcolemmal MHC I and II expression was detected in 17/21 and 15/21 of IMM horses, respectively, and in specific fibers of PSSM horses, but not healthy or pasture myopathy controls. The CD4+, CD8+, and CD20+ cells were present in 20/21 IMM muscles with CD4+ predominance in 10/21 and CD8+ predominance in 6/21 of IMM horses. Dysferlin, dystrophin, and a-sarcoglycan staining were similar in IMM and control muscles.Conclusions and clinical importanceDeficiencies of dysferlin, dystrophin, and a-sarcoglycan are not associated with IMM. Sarcolemmal MHC I and II expression in a proportion of myofibers of IMM horses in conjunction with lymphocytic infiltration supports an immune-mediated etiology for IMM. The MHC expression also occured in specific myofibers in PSSM horses in the absence of lymphocytic infiltrates.

Equine degenerative myeloencephalopathy (EDM) is characterized by a symmetric general proprioceptive ataxia in young horses, and is likely underdiagnosed for 2 reasons: first, clinical signs overlap those of cervical vertebral compressive myelopathy; second, histologic lesions--including axonal spheroids in specific tracts of the somatosensory and motor systems--may be subtle. The purpose of this study was (1) to utilize immunohistochemical (IHC) markers to trace axons in the spinocuneocerebellar, dorsal column-medial lemniscal, and dorsospinocerebellar tracts in healthy horses and (2) to determine the IHC staining characteristics of the neurons and degenerated axons along the somatosensory tracts in EDM-affected horses. Examination of brain, spinal cord, and nerves was performed on 2 age-matched control horses, 3 EDM-affected horses, and 2 age-matched disease-control horses via IHC for calbindin, vesicular glutamate transporter 2, parvalbumin, calretinin, glutamic acid decarboxylase, and glial fibrillary acidic protein. Primary afferent axons of the spinocuneocerebellar, dorsal column-medial lemniscal, and dorsospinocerebellar tracts were successfully traced with calretinin. Calretinin-positive cell bodies were identified in a subset of neurons in the dorsal root ganglia, suggesting that calretinin IHC could be used to trace axonal projections from these cell bodies. Calretinin-immunoreactive spheroids were present in EDM-affected horses within the nuclei cuneatus medialis, cuneatus lateralis, and thoracicus. Neurons within those nuclei were calretinin negative. Cell bodies of degenerated axons in EDM-affected horses are likely located in the dorsal root ganglia. These findings support the role of sensory axonal degeneration in the pathogenesis of EDM and provide a method to highlight tracts with axonal spheroids to aid in the diagnosis of this neurodegenerative disease.

BackgroundEquine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (NAD/EDM) is a neurodegenerative disorder affecting genetically predisposed foals maintained on α-tocopherol (α-TP)-deficient diet.ObjectiveIntramuscular α-TP and selenium (Se) administration at 4 days of age would have no significant effect on serum or cerebrospinal fluid (CSF) α-TP in healthy foals. Serum and CSF α-TP, but not Se, would be significantly decreased in NAD/EDM-affected foals during first year of life.AnimalsFourteen Quarter horse foals; 10 healthy foals supplemented with 0.02 mL/kg injectable α-TP and Se (n = 5) or saline (n = 5) at 4 days of age and 4 unsupplemented NAD/EDM-affected foals.MethodsComplete neurologic examinations were performed, blood and CSF were collected before (4 days of age) and after supplementation at 10, 30, 60, 120, 180, 240, and 360 days of age. Additional blood collections occurred at 90, 150, 210, and 300 days. At 540 days, NAD/EDM-affected foals and 1 unsupplemented healthy foal were euthanized and necropsies performed.ResultsSignificant decreases in blood, CSF α-TP and Se found in the first year of life in all foals, with most significant changes in serum α-TP from 4-150 days. Dam α-TP and Se significantly influenced blood concentrations in foals. Injection of α-TP and Se did not significantly increase CSF Se, blood or CSF α-TP in healthy foals. NAD/EDM-affected foals had significantly lower CSF α-TP through 120 days.Conclusions and clinical importanceInjection of α-TP and Se at 4 days of age does not significantly increase blood or CSF α-TP. Despite all 14 foals remaining deficient in α-TP, only the 4 genetically predisposed foals developed NAD/EDM.