Search

Recent studies have suggested that predatory mirid bugs may be an effective alternative for controlling aphids in sweet pepper greenhouses. This study examined the effect of three constant temperatures (18, 24, and 30 °C) on the life history traits of predatory mirid species Nesidiocoris tenuis, Macrolophus pygmaeus, and Dicyphus bolivari, preying on the aphid Myzus persicae nicotianae in sweet pepper plants. As the temperature increased, the survival rate decreased for M. pygmaeus and D. bolivari, while for N. tenuis, it was the opposite, and their survival increased. When considering all the biological traits studied together, the estimated intrinsic rate of increase (rm) decreased as the temperature increased for M. pygmaeus and D. bolivari. In contrast, the rate increased as the temperature increased for N. tenuis. These results suggest that M. pygmaeus and D. bolivari are better adapted to lower temperatures than N. tenuis, which is more adapted to warm temperatures. The implications of these results for improving the biological control of aphids in sweet pepper greenhouses through the use of mirid bugs are discussed in relation to different temperature regimes.

Cultivar bajo invernadero permite obtener producciones de primicia, calidad y mayores rendimientos, en cualquier momento del año, a la vez que permite alargar el ciclo de cultivo, posibilitando producir en las épocas del año más difíciles (eliminar riesgos climáticos) y obteniéndose mejores precios. Esto se logra al controlar las condiciones de cultivo. La provincia de Corrientes se caracteriza por la producción de hortalizas protegidas, y el sector hortícola bajo invernadero abarca más de 2100 hectáreas, donde más del 80% de la superficie provincial se encuentra ubicada en los departamentos de Bella Vista, Lavalle y Goya. EEA Bella Vista Fil: Pacheco, Roberto Matías. Instituto Nacional de Tecnología Agropecuaria (INTA). Estación Experimental Agropecuaria Bella Vista; Argentina.

Background: The genus Capsicum contains various sweet and hot pepper varieties, including Capsicum annum L. The various species in this genus are used as herbs, vegetables, or medicines, and recent studies have shown that they are a rich source of bioactive compounds as well. Objective: In this study, our objective was to evaluate the antioxidant activity as well as the content of phenols (TPC), the content of flavonoids (TFC) and total condensed tannins (TCT) of ethanolic extracts of the fresh and dried sweet pepper Capsicum annuum L. Methods: The antioxidant activities of the extracts were examined using different biochemical assays, namely diphenylpicrylhydrazyl (DPPH), total antioxidant capacity (TAC) and ferric reducing power (FRAP). The total phenolic contents (TPC) were determined spectrophotometrically according to the Folin-Ciocalteu colorimetric method. Total flavonoid content was measured by the aluminum chloride colorimetric assay. High-performance liquid chromatography (HPLC) has been used to identify the phenolic compounds in ethanolic extracts. Results: The obtained results showed the presence of considerable amounts of total phenolic (757.3±3.5 mgGAE/100g), flavonoid (482.66±1.5 mgQE/100g) and Condensed Tannins (15.97±0.5 mg GAE/100g) content in dry red pepper extract. The use of HPLC has allowed the identification of Gallic Acid, Ascorbic Acid, Chlorogenic Acid, Caffeic Acid, Quercetin, Vanillin, and Rutin in pepper ethanolic extracts. Green and yellow dry peppers contain significant amounts of gallic acid exceeding (134.0 μg /mg). The fresh yellow and red peppers also contained significant amounts of Quercetin exceeding (109.3 μg/mg), the dry red pepper has the strongest antioxidant activity. Conclusion: In conclusion, these findings can be regarded as very promising and justify further study, including the identification of antioxidant components in pepper extracts. Our work constitutes a first step in the study of fresh and dry sweet pepper as a promising source of natural antioxidants.

This study focused on examining the effect of vegetables extract foliar application on storage quality of the grapes grape (Vitis vinifera L. cvs. ‘Perlette’ and ‘King’s Ruby’). The vines were sprayed after fruit set twice at 15 days interval at concentrations of 0, 0.20%, 0.30% and 0.40%. Fruit were harvested and kept under cold-storage at 0.5 ±0.5°C and 90% RH for 28 days. The physicochemical properties of treated and untreated berries were analyzed at 7 days intervals during the cold storage. The results showed that the pre-harvest application of vegetable extracts reduced the weight loss and inhibited the fruit decay. Treated grape also had higher ascorbic acid contents, total phenolics, 2,2-diphenyl-1-picrylhydrazyl-radical (DPPH) scavenging activity, and higher soluble solid contents, titratable acidity, and reduced sugar:acid ratio. The concentration of 0.30% and cultivar ‘Kings Ruby’ gave the best result as compared to untreated control. In conclusion, pre-harvest vegetables extract application on berries showed higher antioxidant activities in grape berries, and maintained their post-harvest quality. These results indicated that foliar spray of vegetables extract could effectively improve the fruit quality, mainly through the reduction of phenolic content.

Sweet pepper (Capsicum annuum L.) is one of the most consumed vegetables in the world, being recognized as a food with high nutritional value. Recently, the market for sweet and colorful mini peppers has increased, especially among the most demanding consumers in the novelties in vegetables and functional foods. In this sense, we evaluated mini sweet peppers genotypes (Akamu, Kaiki, Kalani, Kaolin e Moke from Isla® seeds) regarding the physical-chemical, nutritional and sensory analysis aspects. A wide variability was observed among genotypes, highlighting the Kalani genotype for total carotenoids, and the genotypes Akamu, Kaiki and Kaolin for phenolic totals content and antioxidant activity. Moke and Kaolin showed higher vitamin C content and fruit firmness. Based on sensory analysis, Kalani, Kaiki, Kaolin and Akamu obtained greater global acceptance. The genotypes can be considered an important marketing strategy of mini sweet peppers trade, associating different shapes, colors and nutritional quality.

Under semi-arid soil conditions, soils are poor in nutrient availability due to the high clay and lime content and high pH; hence, mycorrhizal inoculation is a good strategy for sustainable agriculture. As it is still very difficult to produce a large quantity of mycorrhizal inoculum for a large area, it is reasonable to produce mycorrhizal-inoculated seedlings, which are then transplanted to the field. In order to investigate the effect of mycorrhizal inoculation (Glomus mosseae) techniques on plant yield and nutrient uptake of several horticultural plants, field experiments were conducted using a selected Menzilat soil series (Entic Chromoxerert), located in the Research Farm, Faculty of Agriculture, University of Cukurova, (eastern Mediterranean region) Turkey. Two growth pot sizes and two inoculation technique combinations consisting of six horticultural plants were replicated three times in a factorial randomized block design. The pure culture of G. mosseae was maintained and multiplied with sorghum under glasshouse conditions. Pepper, eggplant, tomato, cucumber, melon and watermelon seedlings were produced in different growth media, comprised of different composting material with several mycorrhizal species. Seedlings were produced using different techniques. Mycorrhizal-inoculated and non-inoculated seedlings were grown under field conditions using different inoculation techniques. The experiments revealed that under field conditions, mycorrhiza-inoculated seedlings are effectively established and result in high plant growth and yield. The results also revealed that for both techniques, plant yields were higher and mycorrhizal-inoculated plants produced more yield than non-mycorrhizal plants. The results showed that mycorrhizal-inoculated plants had higher P and Zn content than non-inoculated plants, but immersed mycorrhizal-inoculated plants had higher P concentration compared with granular application. We conclude that seedling quality is dependent on growth medium and mycorrhizal spore effectiveness. Furthermore, using mycorrhizal-inoculated seedlings appears to be a good strategy for horticultural production. © 2019 International Society for Horticultural Science. All rights reserved.

The paper presents the results of studying the effect of the probiotics biological product (Plex-Em LLC) on green crops (lettuce, parsley, dill, coriander, celery, green onion), strawberries, the development of sweet pepper seedlings and eggplant, when grown in hydroponic greenhouse of Belgorod State Agrarian University; a tendency to increase the linear parameters of cotyledons and true leaves in the treated seedlings of sweet pepper and eggplant plants was noted. With the use of the drug “Probiotics” an increase was observed in the height of plants in green crops by 13-29 % and in the mass of one plant by 19-38 %. The yield of green products per unit area increased from 8 % for parsley to 51 % for coriander. The drug “Probiotics” contributed to the improvement of economically valuable plants of strawberry: the number of fl owering plants increased by 35 %, the berry weight by 38%. The content of vitamin A, C and E in berries increased, but the amount of vitamin B2 decreased.

A study was conducted to investigate the ability of arbuscular mycorrhizal fungi (AMF) in enhancing the growth and control of a root rot caused by different isolates of Fusarium oxysporum in sweet pepper seedlings. The plants were grown in plastic pots filled with sterilized horticultural soils. There were four treatments applied as follows: Fo (seedlings infected with fungus), M (seedlings inoculated with mycorrhizal fungi), Fo + M (seedlings inoculated with mycorrhiza and infected with fungus) and control. A randomized experiment was used and the growth, disease index, and photosynthetic activity of the plants were measured after 4 weeks. The investigations showed that the mycorrhizal inoculation had a protective effect on the F. oxysporum-infected pepper seedlings. The plants were characterized by a higher growth rate and a lower disease index than those growing only in the presence of the pathogenic fungus. The roots inoculated with mycorrhizal fungi were better developed than those infected only with F. oxysporum. The mycorrhiza contributed to an increase in the photosynthetic activity of the pepper seedlings.

Pungency is a characteristic trait of pepper (Capsicum spp.). Two genes, Pun1 and pAMT, are known as determinative factors of pepper pungency. To date, it has been considered that most bell-type sweet peppers (called piman and paprika, in Japan) possess the identical mutated Pun1 allele, pun1, whereas pAMT mutated non-pungent pepper has been found only in non-bell-type pepper. In this study, to reconsider the uniformity of the source of non-pungency in sweet bell pepper and explore new genetic resources, the presence of pun1 was investigated in 26 sweet bell pepper varieties. Among them, a seemingly common sweet bell pepper 'Color Piman Yellow' had the intact Pun1, in spite of its non-pungency. Sequencing and linkage analyses revealed that 'Color Piman Yellow' possessed a novel mutated pAMT allele, pamt 10 , that has a nonsense substitution at the 11th exon responsible for non-pungency. This is the first pAMT mutant to be found in sweet bell pepper. The finding that there was a pAMT mutant in sweet bell pepper suggests the possibility that more pAMT mutants exist unconsciously in other sweet bell peppers. The discovery of a new factor of non-pungency contributes to expanding the genetic diversity of sweet pepper varieties.

The experiment was conducted in the Horticultural Farm of Sher-e-Bangla Agricultural University, Dhaka, Bangladesh. Plant growth regulators were applied which had significant effect on yield of sweet pepper (Capsicum annum L.). The experiment consisted of two factors. Factor A: Plant growth regulators (four levels) as G0: Control, G1: Gibberellic Acid (GA3) @ 30 ppm, G2: 4-Chloro Phenoxy Acetic Acid (4-CPA) @ 45 ppm and G3: 4-Chloro Phenoxy Acetic Acid (4-CPA) @ 45 ppm + Gibberellic Acid (GA3) @ 30 ppm and Factor B: Number of spray (three levels) as N0: Control (no spray), N1: two spray, N2: three spray. In case of plant growth regulators, the highest yield (27.77 t/ha) was found from G3 treatment, whereas the lowest (18.87 t/ha) was from G0 treatment. For number of spray the maximum yield (26.0 t/ha) was recorded from N2 treatment, while the minimum yield (19.87 t/ha) was from N0 treatment. The results indicated that the highest yield (31.8 t/ha) was observed from G3N2 treatment combination, while the lowest yield (17.5 t/ha) was from G0N0 treatment combination. Due to combined effect, the highest yield (31.8 t/ha) with net income (Tk/ha 1416558) and BCR (2.46) was observed from G3N2 treatment combination, while the lowest yield (17.5 t/ha) with net income (Tk/ha 433045) and BCR (1.49) from G0N0 treatment combination. Thus, three times spray with (4- Chloro Phenoxy Acetic Acid + Gibberellic Acid) may be recommended for achieving the higher growth, yield and economic benefit of sweet pepper. The Agriculturists 2018; 16(2) 58-64

Turkiye bircok sebze turunun yetismesi icin uygun ekolojik kosullara sahiptir. Bu calisma 2013-2015 yillari arasinda, Ordu ilinde yetistirilen sebzelerden, fasulye ( Phaseolus vulgaris L., Fabaceae), misir ( Zea mays L., Poaceae), hiyar ( Cucumis sativus L., Cucurbitaceae), patlican ( Solanum melongena L., Solanaceae), pirasa ( Allium porrum L., Alliaceae), marul ( Lactuca sativa L., Asteraceae), sogan ( Allium cepa L., Alliaceae), biber ( Capsicum annuum L., Solanaceae), patates ( Solanum tuberosum L., Solanaceae), turp ( Raphanus sativus L., Brassicaceae), domates ( Solanum lycopersicum L., Solanaceae), karpuz ( Citrullus lanatus (Thunb.) Matsum. & Nakai., Cucurbitaceae) ve kabak ( Cucurbita sp., Cucurbitaceae) uzerinde bulunan akar turlerini belirlemek amaci ile yurutulmustur. Orneklemeler her yilin nisan-kasim aylari arasinda haftalik olarak yapilmistir. Calisma boyunca 2030 adet akar toplanmis ve incelenmistir. Uc alt takima bagli 15 familya ve 30 cinsden toplam 43 akar turu saptanmistir. Belirlenen akarlar arasinda en yaygin bitki zararlisi tur, Tetranychus urticae Koch, 1836 (Prostigmata: Tetranychidae) iken en yaygin predator tur ise Amblyseius swirskii Athias-Henriot, 1962 (Mesostigmata: Phytoseiidae) olmustur. Ayrica calisma da belirlenen Amblyseius rademacheri Dosse, 1958 (Mesostigmata: Pyhtoseiidae) turu, Turkiye predator akar faunasi icin yeni kayit niteligindedir. Solanum melongena L. (Solanaceae) uzerinden toplanan bu tur tanimlanarak cizimleri sunulmustur. Ayrica Turkiye’de tespit edilmis Amblyseius cinsi akarlar icin teshis anahtari da verilmistir.

Supplemental lighting is essential for year-round greenhouse crop production in regions with low natural light. Supplemental lighting to increase the daily light integral can be added via lengthening photoperiods or increasing light intensity. Light addition via long photoperiods is preferred because of the lower light-fixture costs in comparison with the use of high light intensity. However, long photoperiods cause photoinjury, such as leaf chlorosis in tomatoes and sweet peppers. This photoinjury has limited the yield increase from long-photoperiod lighting. In our previous study, we found that a temperature drop with dynamic temperature integration (TI) can promote photoassimilate translocation from leaf to fruit and thus has the potential to reduce photoinjury. Therefore, this study was initiated in 2013 with the aim of testing this temperature-control strategy to improve the response to long photoperiods, including both overhead high-pressure sodium (HPS) lighting and light-emitting diode (LED) intra-canopy lighting. The study was conducted over three winters (from 2013 to 2016) in eight greenhouse compartments, each with 50 m2 growing area. Two photoperiods (control and long photoperiod) of overhead HPS lighting and two temperature integration strategies (control TI with no temperature drop; dynamic TI with a temperature drop to 13.5°C for tomatoes or 15.5°C for sweet peppers at the end of the photoperiod) were applied in eight greenhouse compartments. Four intra-canopy LED photoperiods were applied to the four plots inside each compartment. Dynamic TI with a temperature drop significantly reduced photoinjury and increased fruit yield at long photoperiods for both tomatoes and sweet peppers. It also reduced heating energy use during cold winter months in the tomato experiments. Therefore, dynamic TI with a temperature drop is an energy-efficient climate-control strategy for improving the response of greenhouse tomatoes and sweet peppers to long photoperiods of supplemental lighting.

Each year, large volumes of sweet pepper seeds (Capsicum annuum L.) are exported from Thailand to many countries. As a result, seed quality is very important. Sweet pepper seeds are very small, both in dimension and mass, therefore they are very difficult to inspect manually. Thus, we designed and constructed an automated sweet pepper seed sorting machine. It consists of three main stations: 1) seed feeder, 2) seed inspector using a camera and 3) seed sorter using a vacuum suction system. To transport seeds through each station, we designed a circular rotating plate with radial rows of blind holes. This allows all three stations to process a row of seeds in parallel. To identify discolored seeds, images were captured and processed to detect dark areas on the surface of the seeds. Our machine accurately sorted 90.9% of input seeds. The maximum potential capacity (in terms of seed processing rate) was 16,500 seeds per hour and we achieved actual rates of approximately 12,700 seeds per hour or roughly twice as fast as an experienced operator. Thus, this machine is faster and more accurate than human operators and can replace them.

Um dos atributos responsáveis pela boa qualidade das mudas é o seu cultivo em substratos com boa drenagem e disponibilidade de nutrientes. O objetivo a produção de mudas de pimentão em diferentes doses de compostos orgânicos no substrato. O experimento foi conduzido durante o mês de agosto de 2018, na Fundação Educacional de Andradina, localizada no município de Andradina, estado de São Paulo. Foi utilizado o delineamento inteiramente casualizado, em esquema fatorial de 2x5 sendo dois substratos orgânicos, sendo eles: composto exaurido turfoso (EC) e composto com fibras de coco (CC) interagindo com cinco concentrações (C), ou seja: zero%; 25%; 50%; 75% e 100% e com cinco repetições, totalizando 50 parcelas ou tubetes plásticos. A elevação na concentração de compostos orgânicos no substrato para produção de mudas de pimentão proporcionou um maior desenvolvimento das plântulas. É recomendada a utilização de 70% de composto exaurido turfoso na composição do substrato na produção de mudas de pimentão. Pode utilizar a concentração de 100% o composto com fibra de coco na composição do substrato na produção de mudas de pimentão.Palavras-chave: Capsicum annuum L.; nutrição de plantas; hortaliça. ABSTRACT: One of the main responsible attributes for the good quality of seedlings is its cultivation in substrates with a good drainage and nutrients availability. This work aimed to study the production of pepper seedlings with different doses of organic compounds in substrate. The experiment was carried out in August, 2018, at Educational Foundation of Andradina, in Andradina, São Paulo State, Brazil. The experimental design was completely randomized, in a 2x5 factorial scheme, with two organic substrates: peaty exhausted compound (EC) and coconut fiber compound (CC), in five different concentrations: null %; 25%; 50%; 75% and 100%, with five repetitions, in total of fifty plots. The increase in the concentration of organic compounds in production of pepper seedlings promoted a greater development. It is recommended using 70% of peaty exhausted in the composition of substrate to the production of pepper seedlings and using 100% of coconut fiber in the composition of the substrate to the production of pepper seedlings.Keywords: Capsicum annuum L.; nutrition of plants; vegetables.

WOS: 000432227100003 The host resistance level of pure line materials was assessed in the genepool for the purpose of breeding. The highest resistance to the pathogen was observed in bell-type pepper. Moreover, genetic diversity of pure lines was investigated using selected inter-simple sequence repeat (ISSR) primers. Generally, genetic markers showed genetic diversity, so that long-type pure lines were separated from the other accessions. This is the first report on host reactions of Turkish pure lines as breeding material. These results provide significant information for future pepper breeding programs. TUBITAK (The Scientific and Technological Research Council of Turkey)Turkiye Bilimsel ve Teknolojik Arastirma Kurumu (TUBITAK) [113O882, COST 1208] Supported by COST 1208 actions through TUBITAK (The Scientific and Technological Research Council of Turkey), Project No. 113O882.

Purpose In this study, vermicomposted tannery wastes were applied in the organic cultivation of sweet pepper in a greenhouse. The effects of this organic matter addition on plant development and on the distributions of Cr(III) and Cr(VI) in plant tissues and organs were assessed. Methods In a greenhouse, organic sweet peppers were cultivated adding vermicomposted tannery to the substrate (sample VRC) and the results were compared with the samples control (dYL; only soil) and reference (NPK; adding mineral fertilizer). The growth, nutritive value and fruit production were assessed to evaluate the plant development in different types of substrate. Besides evaluating the biostimulant effect of vermicomposts, the distributions of Cr in plant tissues were also studied. Results Up to three harvested sweet peppers were obtained per plant, compared with only one fruit for the reference treatment with NPK addition. Based on the Cr dynamics in the plants, the highest concentration was found in the fruits, varied as follows: fruits > stem and stalks > leaves = root; however, the Cr concentration in the fruits was statistically the same across all treatments. Additionally, only Cr(III) was detected and quantified in the fruits. Conclusion The addition of vermicompost was biostimulating to plants and positively influenced their development. Based on the Cr dynamics in the plants, since the Cr concentration was the same across all treatments, it demonstrated that the addition of tannery residues to the vermicompost did not negatively influence the health benefits or food security of the produced fruits.

Pepper is very popular vegetable crop in Southeast Europe and in Serbia as well. Wide genetic variability is essential in pepper breeding programs. The aim of this study was to evaluate variability for the most important fruit traits and differences between 28 sweet pepper genotypes from the working collection from the Institute of Field and Vegetable Crops (Novi Sad, Serbia). The following traits were analyzed: fruit weight (g), fruit length (cm), fruit diameter (cm), fruit index, number of locules, number of apexes, pericarp thickness (mm), and total soluble solids (°Brix). Results confirmed great variability in evaluated pepper fruit traits. Genotypes were separated into individual groups based on fruit characteristics. According to our research, hierarchical cluster analysis represented differentiation among groups of genotypes more clearly than PCA, but not comparing to k-means. Hierarchical cluster analysis showed the similarity between genotypes, but k-means clustering did not. Genotypes from group 3 will be used in breeding for higher fruit weight and group 6 for thicker pericarp. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. TR 31030]

The present study was conducted to determine growth and yield responses of green pepper to varying manure rates under field and high tunnel conditions. Experiment 1 was a pot experiment to evaluate three rates (0.5 and 10 t/ha) of poultry manure (PM) on green pepper production under high tunnel and open field conditions. Experiment 2 was to determine the performance of green pepper as influenced by different manure rates (0, 5 and 10 t/ha of PM, 300 kg/ha of NPK, 5 t/ha of PM + 200 kg of NPK and 10 t/ha of PM + 100 kg of NPK) on the field. High tunnel produced about 3.1 fruits/plant that weighted 102.8 g, which was significantly higher than open field experiment in which 1.7 fruits/plant, with a medium weight of 32.3 g were noted. High tunnel enhanced successful production of green pepper during rainy season, whereas the open field production during the same season was near failure. Application of 10 t/ha of PM produced significantly larger fruits in the pot experiment. Good fertilizer effects on growth and yield components were recorded for the field study. Plant height, number of leaves and branches, number and weight of harvested fruit followed similar trend in 5 and 10 t/ha of PM which gave statistically similar results, and provided the best performance during the experiment. Application of 5 t/ha of PM produced the highest total fruits yield.

Growing vegetables under shade nets is currently becoming popular in summer to provide protection from high intensities of light. High temperatures and light quality affect postharvest quality and storage life of vegetables. Photo-selective shade netting technology is an emerging agro-technological concept that aims at the improvement of crop quality by the modification of spectral light and provides physical protection of the crop. Incorporation of various light-dispersive and reflective chromatic additives in the photo-selective nets is responsible for the modification of spectral quality, especially in the UV 200–400 nm, visible (400–700 nm), or far-red (FR; also known as “near infrared”; 705–740 nm) in the infrared region of the spectral region. Altered light-quality changes under the photo-selective nets were shown to improve the accumulation of phytochemicals and aroma compounds, and ultimately, the growth, yield, and quality of the selected vegetables such as tomatoes, sweet peppers, lettuc...

RESUMO Objetivou-se avaliar a capacidade combinatória de linhagens de pimentão, identificar combinações híbridas superiores quanto à produtividade e qualidade de frutos e inferir sobre os modos de ação gênica envolvidos na expressão dos caracteres agronômicos de importância econômica. Para isso, cinco linhagens de pimentão do Projeto Melhoramento Genético de Solanáceas Para Sistema de Cultivo, da Universidade Federal Rural de Pernambuco foram cruzadas, em um esquema dialélico parcial, com dois híbridos simples: Atlantis (ATL) e Valdor (VAL), utilizados como testadores. As linhagens, bem como os híbridos utilizados, foram escolhidas em função de apresentarem características morfológicas divergentes, tais como: formato, comprimento e diâmetro do fruto, espessura da polpa e produtividade. O delineamento experimental utilizado foi em blocos casualizados, com quatro repetições, vinte tratamentos, constituídos pelas cinco linhagens, dois testadores, dez híbridos experimentais e três híbridos comerciais como testemunhas, os quais foram analisados através do método 2 do modelo I de Griffing, adaptado por Geraldi & Miranda Filho (1988). Detectou-se suficiente variabilidade genética a ser explorada nos componentes do dialelo para a maioria dos caracteres; os efeitos aditivos e não-aditivos foram importantes e significativos, mostrando o desempenho dos genótipos e sua contribuição para a produção de híbridos superiores, as linhagens L1B, L6 e L7 e o testador Valdor destacaram-se como bons combinadores por apresentarem maior capacidade geral de combinação para a maioria dos caracteres agronômicos; o híbrido triplo L1B x VAL destacou-se pelo melhor desempenho, com as melhores capacidades específicas de combinação.

The use of mixed models for evaluating diallel crosses is a highly timely option to the reliable prediction of progeny genetic values. In the sweet pepper crop, hybrids are commercially explored on a large scale, mainly because of their characteristics of economic importance. This study aimed to assess the potential of hybrids obtained from a partial diallel among five sweet pepper lines developed for the hydroponic cultivation system and two simple hybrids, by applying mixed models. It was performed crosses in the partial diallel scheme among the (L1B, L6, L7, L18, and L19) lines and the simple hybrids ‘Valdor’ and ‘Atlantis’. Plants were cultivated in hydroponic system with substrate and irrigated three times a day using nutrient solution. On the basis of mixed models, the following traits were assessed: mean fruit diameter (FD), mean fruit length (FL), mean fruit number per plant (FNP), mean fruit mass (FM), early yield (EYIELD), and mean fruit mass per plant (FMP). The L6 line was the one that showed the highest estimate of general combination capacity for FMP, FM, and EYIELD, proving to be promising for recommendation. The hybrid that provided the best specific combining ability for FD, FM, FMP, and EYIELD was L6 x ‘Valdor’. Triple hybrids were efficient to maximize yield for the traits of interest by the use of the mixed model. RESUMO: A utilização de modelos mistos na avaliação de cruzamentos dialélicos é uma opção altamente oportuna para a fidedigna predição dos valores genéticos das progênies. Na cultura do pimentão, os híbridos são largamente explorados comercialmente, principalmente por suas características de importância econômica. O objetivo deste trabalho foi avaliar o potencial de híbridos resultantes de um dialelo parcial entre cinco linhagens de pimentão desenvolvidas para o sistema de cultivo hidropônico e dois híbridos simples, utilizando modelos mistos. Foram realizados cruzamentos no esquema de dialelo parcial entre as linhagens (L1B, L6, L7, L18 e L19) e os híbridos simples ‘Valdor’ e ‘Atlantis’. As plantas foram cultivadas em sistema hidropônico com substrato e irrigadas três vezes ao dia com solução nutritiva. Com base em modelos mistos, foram avaliadas as características: diâmetro médio de frutos (DF); comprimento médio de frutos (CF); número médio de frutos por planta (NFP); massa média de frutos (MMF); produção precoce (PP) e massa média de frutos por planta (MFP). A linhagem L6 foi a que expressou maior estimativa de capacidade geral de combinação para MFP, MMF e PP, revelando-se promissora para recomendação. O híbrido triplo que apresentou melhor capacidade específica de combinação para DF, MMF, MFP e PP, foi L6 x ‘Valdor’. Os híbridos triplos foram eficientes para incrementar a produtividade para as características de interesse com a aplicação da modelagem mista.

Resumen La utilización de especies del hongo Trichoderma es de uso frecuente en el control biológico, donde inicialmente se aplicó por sus propiedades micoparásitas y antibióticas. Numerosas publicaciones han demostrado también su capacidad para colonizar las raíces y sus múltiples efectos favorables sobre los cultivos. Para Costa Rica no hay referencias que hagan mención al uso de filtrado de metabolitos secundarios para incrementar la producción de chile dulce. El objetivo de esta investigación consistió en comparar el efecto de filtrado de metabolitos secundarios presentes en un biofiltrado del hongo Trichoderma asperellum en la estimulación del crecimiento en chile dulce (Capsicum annum var Nathalie) en ambientes protegidos. Se evaluaron tratamientos a diferentes concentraciones de T. asperellum y de sus biofiltrados, en almácigos de esta hortaliza. Los efectos obtenidos con la aplicación de T. asperellum sobre la estimulación del crecimiento indican que la utilización de este biocontrolador tiene un impacto mayor en la etapa de almácigo. El tratamiento de T50 (T. asperellum al 50%) resultó ser la mejor opción durante los dos años de análisis en la elongación de la raíz, además promovió un incremento en la biomasa de la raíz y el área foliar. Sin embargo, la utilización de este microorganismo en invernadero en la etapa de productividad, no presentó diferencias significativas entre los tratamientos, aunque se observó un buen desarrollo foliar de las plantas comparadas con el testigo. Abstract The use of Trichoderma fungus species is frequently used in biological control, where it was initially applied for its mycoparasitic and antibiotic properties. Numerous publications have also demonstrated its capacity to colonize the roots and their multiple favorable effects on crops. For Costa Rica there are no references that mention the use of secondary metabolites to increase production in sweet peppers. The objective of this research was to compare the effect of secondary metabolites present in a Trichoderma asperellum’s cultured filtrated in the stimulation of growth in sweet pepper (Capsicum annum var Nathalie) in protected environments. Treatments were evaluated at different concentrations of T. asperellum and its biofiltrates, in sweet pepper seedlings of the variety. The effects obtained with the application of T. asperellum on the stimulation of growth indicate that the use of this biocontroller has a major impact on the nursery stage. The treatment of T50 (T. asperellum 50%) was the best option during the two years of analysis in the elongation of the root, promoted an increase in the biomass of the root, besides it promoted an increase in the biomass of the root and the foliar area. However, the use of this microorganism in the greenhouse in the stage of productivity did not show significant differences between treatments, although a good foliar development of the plants compared with the control was observed.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5′ CTGTTGTCTATTGAGGATTGTG 3′ AND TSWV-LR 5′ CAGAGAGCTTGTTAATGCAGGAC 3′ to amplify part of the TSWV L RNA, the pairs TCSV-SF 5′ AACTGGGAAAGCAGAAAACC 3′ and TCSV-SR 5′ CCTTACTCCGAACATTGCA 3′, and GRSV-SF 5′ CTGTCAGGAAAATCTTGACCTG 3′ and GRSV-SR 5′ CTTGACTCCAAACATCTCGT 3′ to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5′ CACACTGAACTGAACTATAACACAC 3′ and TCSV-NF 5′ ACCTTGAATCATATCTCTCG 3′ and primers N-TSWV_FW 5′ TACGGATCCGATGTCTAAGGTTAAGCTCAC 3′ and N-TSWV_RV 5′ TTATCTCGAGTCAAGCAAGTTCTGCGAG 3′. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

The objective of this study was to evaluate the plant and fruit characteristics in advanced lines of Jalapeño pepper for mechanical harvesting. Thus, two experiments were carried out in the field. Experiment I (2015) was conducted as a randomized block design (three replications and eight plants per plot) and Experiment II (2016) in a completely randomized design (five replications and ten plants per plot). In 2015, lines CNPH 30,112, CNPH 30,118, CNPH 30,147, CNPH 30,159, CNPH 30,183, and CNPH 30,245 were evaluated, together with the control ‘BRS Sarakura’. Significant differences were detected for fruit and plant characteristics (P10cm), large fruits (11 cm x 4 cm), high pulp firmness (11 N), wall thickness (about 5mm), and content of capsaicinoid substances (>50,000 SHU). Selected lines are undergoing additional field evaluation for mechanical harvesting with the Etgar Moses 1010 pepper harvester. RESUMO: O objetivo desse estudo foi avaliar as características de planta e fruto em linhagens avançadas de pimenta do tipo Jalapeño visando à colheita mecanizada. Assim, foram feitos dois experimentos em campo. O Experimento I (2015) foi conduzido em delineamento de blocos casualizados (três repetições e oito plantas por parcela) e o Experimento II (2016) em delineamento inteiramente casualizado (cinco repetições e dez plantas por parcela). Em 2015, foram avaliadas as linhagens CNPH 30,112, CNPH 30,118, CNPH 30,147, CNPH 30,159, CNPH 30,183 e CNPH 30,245, juntamente com o controle ‘BRS Sarakura’. Foram detectadas diferenças significativas para as características de planta e fruto (P10cm), frutos grandes (11 cm x 4cm), polpa de elevada firmeza (11 N), espessura de parede (5mm) e teor de substâncias capsaicinóides (>50.000 SHU). As linhagens selecionadas estão passando por avaliação adicional em campo para colheita mecânica com a colhedora de pimentas Etgar Moses 1010.

Изложены подходы к выбору сортов и гибридов перца сладкого с учетом сортовых особенностей, специфики местных почвенно-климатических условий и использования продукции на юге России. Представлен разнообразный сортимент перца сладкого от Агрохолдинга «Поиск»., Outlines approaches to the choice of varieties and hybrids of sweet pepper, taking into account the varietal characteristics, the specifics of the local soil and climatic conditions and the use of products in the South of Russia. Presented a varied assortment of sweet pepper from Poisk Agro holding., №11 (2018)

Fresh pepper (Capsicum) fruit that are sliced and/or diced are referred to as fresh-cut products. The current report evaluates the inheritance of postharvest attributes that contribute to pepper fresh-cut quality. Marketable green fruit of large-fruited Capsicum annuum accessions with bell and related pod types (Class 1), C. annuum accessions with jalapeno and serrano pod types (Class 2), and thin-walled “aji”-like tabasco pod types from Capsicum baccatum, Capsicum frutescens, and Capsicum chinense (Class 3) were processed and stored up to 14 days in selective oxygen transmission rate packaging. Fresh-cut attributes were influenced by genotype as well as year. For all pod types, O2 and CO2 partial pressures in storage packages, tissue weight loss, and electrolyte leakage differed among accessions, days of storage, and years of testing. Percent O2 declined and CO2 and electrolyte leakage generally increased during storage. Some accessions in Class 1 and Class 2 maintained acceptable product quality during storage. Changes in fruit weight loss were small with greater weight loss observed in Class 1 accessions relative to weight loss for Class 2 and Class 3. Broad-sense heritability for fresh-cut attributes was moderate to low indicating that it will be difficult to breed for fresh-cut quality.

Bacterial spot in pepper (Capsicum annuum L.) is caused by Xanthomonas euvesicatoria and X. vesicatoria. The natural Bulgarian population of X. vesicatoria belongs to pepper-tomato pathotypes (PT), whereas Macedonian population of X. euvesicatoria refers to pepper pathotypes (P). Bacterial spot of pepper caused by X. vesicatoria and X. euvesicatoria has become a very serious disease in Bulgaria during the past few years. The use of resistant pepper cultivars is the most economically and technically efficient method for control. Pepper varieties with immune and/or resistant reaction were not found in this study. Moderately susceptible to both pathogens were the following varieties: Kapia UV-Vertus, Sofijska kapia and Familiya of Kapia type, Quadrato D"Asti Giallo of Dolma type and Chorbadzhiyski of long pungent fruits. All varieties with cone-shaped fruits and the ones for sweet powder performed with highly susceptible reaction to X. еuvesicatoria.

In this study tomato (Punjab Ratta) and sweet pepper (Indira) were subjected to three different drying temperatures (40, 50 and 60 °C) to examine the effect of drying temperatures and storage period (180 days) on the chemical and bioactive parameters of dried tomatoes (T) and sweet peppers (SP). The drying of T and SP at 60 °C results in better retention of phenolics (738.44 ± 0.10 and 593.78 ± 0.09 mg/100 g db), antioxidant activity (42.79 ± 0.11 and 27.56 ± 0.07%) and flavonoids (499.56 ± 0.04 and 286.31 ± 0.07 mg/100 g db), respectively however chemical parameters significantly (p