Search

We describe a March 2020 co-occurrence of Legionnaires' disease (LD) and coronavirus disease in France. Severe acute respiratory syndrome coronavirus 2 co-infections were identified in 7 of 49 patients from LD case notifications. Most were elderly men with underlying conditions who had contracted severe pneumonia, illustrating the relevance of co-infection screening.

Legionnaires’ Disease (LD) is a severe pneumonia mainly caused in Europe by Legionella pneumophila serogroup 1 (Lp1). Sequence-based typing methods reveal that some sequence types (ST) are overrepresented in clinical samples such as ST1 and ST47, suggesting that some strains are more fit for infection than others. In the present study, a collection of 108 Lp1 clinical isolates were used to evaluate the strain-dependent immune responses from human macrophages. Clinical Lp1 isolates induced differential TNFα secretion from macrophages. ST1 isolates induced a significantly higher TNF-α secretion than non-ST1, whereas ST47 isolates induced a significantly lower TNF-α secretion than non-ST47 isolates. ST1 isolates induced a significantly higher cell death than ST47 isolates evaluated by lactate dehydrogenase activity (cytotoxicity) and caspase-3 activity (apoptosis). Treatment of macrophages with anti-TNF-α antibodies significantly reduced the cell death in macrophages infected with ST1 or ST47 strains. The TNF-α secretion was neither explained by a differential bacterial replication nor by the number or type (bystander or infected) of TNF-α producing cells following infection but by a differential response from macrophages. The Paris ST1 reference strain elicited a significantly higher TNF-α gene transcription and a higher induction of NF-κB signaling pathway than the Lorraine ST47 reference strain. Clinical Lp1 isolates induce a diverse immune response and cell death, which could be related to the genotype. The two predominant sequence-types ST1 and ST47 trigger opposite inflammatory response that could be related to the host susceptibility.

An outbreak of Legionnaires' disease affected 18 people in Montpellier, a town of the south of France, between December 2016 and July 2017. All cases were diagnosed by a positive urinary antigen test. No deaths were reported. Epidemiological, environmental and genomic investigations (nested Sequence-Based Typing (nSBT) and whole genome sequencing) were undertaken. For the cases for which we had information, four had a new isolate (ST2471), one had a different new isolate (ST2470), one had a genomic pattern compatible with the ST2471 identified by nSBT (

Legionella pneumophila, the causative agent of Legionnaires’ disease, is mostly found in man-made water systems and is one of the most closely monitored waterborne pathogens. With the aim of finding natural ways to control waterborne pathogens and thus further reduce the impact of disinfection by-products on human health, some studies have demonstrated the ability of bacteria to kill Legionella through the production of secondary metabolites or antimicrobial compounds. Here, we describe an unexpected growth inhibition of L. pneumophila when exposed to a physically separated strain of Pseudomonas fluorescens, designated as MFE01. Most of the members of the Legionellaceae family are sensitive to the volatile substances emitted by MFE01, unlike other bacteria tested. Using headspace solid-phase microextraction GC-MS strategy, a volatilome comparison revealed that emission of 1-undecene, 2-undecanone, and 2-tridecanone were mainly reduced in a Tn5-transposon mutant unable to inhibit at distance the growth of L. pneumophila strain Lens. We showed that 1-undecene was mainly responsible for the inhibition at distance in vitro, and led to cell lysis in small amounts, as determined by gas chromatography-mass spectrometry (GC-MS). Collectively, our results provide new insights into the mode of action of bacterial volatiles and highlight them as potent anti-Legionella agents to focus research on novel strategies to fight legionellosis. IMPORTANCE Microbial volatile compounds are molecules whose activities are increasingly attracting the attention of researchers. Indeed, they can act as key compounds in long-distance intrakingdom and interkingdom communication, but also as antimicrobials in competition and predation. In fact, most studies to date have focused on their antifungal activities and only a few have reported on their antibacterial properties. Here, we describe that 1-undecene, naturally produced by P. fluorescens, is a volatile with potent activity against bacteria of the genus Legionella. In small amounts, it is capable of inducing cell lysis even when the producing strain is physically separated from the target. This is the first time that such activity is described. This molecule could therefore constitute an efficient compound to counter bacterial pathogens whose treatment may fail, particularly in pulmonary diseases. Indeed, inhalation of these volatiles should be considered as a possible route of therapy in addition to antibiotic treatment.

We describe 2 cases of healthcare-associated Legionnaires’ disease in patients in France hospitalized 5 months apart in the same room. Whole-genome sequencing analyses showed that clinical isolates from the patients and isolates from the room’s toilet clustered together. Toilet contamination by Legionella pneumophila could lead to a risk for exposure through flushing.

Background Rarely, Legionnaires’ disease (LD) can progress into a slowly or nonresolving form. Methods A nationwide retrospective study was conducted by the French National Reference Center for Legionella (2013–2017) including cases of slowly or nonresolving LD defined as persistent clinical symptoms, computed tomography (CT) scan abnormalities, and Legionella detection in lower respiratory tract specimens by culture and/or real-time (RT) polymerase chain reaction (PCR) >30 days after symptom onset. Results Twelve cases of community-acquired slowly or nonresolving LD were identified among 1686 cases of culture-positive LD. Median (interquartile range [IQR]) age was 63 (29–82) years. Ten (83.3%) patients had ≥1 immunosuppressive factor. Clinically, 9 patients transiently recovered before further deterioration (median [IQR] symptom-free interval, 30 [18–55] days), 3 patients had uniformly persistent symptoms (median [IQR] time, 48 [41.5–54] days). Two patients had >2 recurrences. CT scan imagery found lung abscess in 5 (41.6%) cases. Slowly or nonresolving LD was diagnosed on positive Legionella cultures (n = 10, 83.3%) at 49.5 (IQR, 33.7–79) days. Two cases were documented through positive Legionella RT PCR at 52 and 53 days (cycle threshold detection of 21.5 and 33.7, respectively). No genomic microevolution and no Legionella resistance to antibiotics were detected. The median (IQR) duration of treatment was 46.5 (21–92.5) days. Two empyema cases required thoracic surgery. At a median (IQR) follow-up of 26 (14–41.5) months, LD-attributable mortality was 16.6% (n = 2). Conclusions Slowly or nonresolving LD may occur in immunocompromised patients, possibly leading to lung abscess and empyema.

Mycobacterium tuberculosis (Mtb) genetic micro-diversity in clinical isolates may underline mycobacterial adaptation to tuberculosis (TB) infection and provide insights to anti-TB treatment response and emergence of resistance. Herein we followed within-host evolution of Mtb clinical isolates in two cohorts of TB patients, either with delayed Mtb culture conversion (> 2 months), or with fast culture conversion (< 2 months). We captured the genetic diversity of Mtb isolates obtained in each patient, by focusing on minor variants detected as unfixed single nucleotide polymorphisms (SNPs). To unmask antibiotic tolerant sub-populations, we exposed these isolates to rifampicin (RIF) prior to whole genome sequencing (WGS) analysis. Thanks to WGS, we detected at least 1 unfixed SNP within the Mtb isolates for 9/15 patients with delayed culture conversion, and non-synonymous (ns) SNPs for 8/15 patients. Furthermore, RIF exposure revealed 9 additional unfixed nsSNP from 6/15 isolates unlinked to drug resistance. By contrast, in the fast culture conversion cohort, RIF exposure only revealed 2 unfixed nsSNP from 2/20 patients. To better understand the dynamics of Mtb micro-diversity, we investigated the variant composition of a persistent Mtb clinical isolate before and after controlled stress experiments mimicking the course of TB disease. A minor variant, featuring a particular mycocerosates profile, became enriched during both RIF exposure and macrophage infection. The variant was associated with drug tolerance and intracellular persistence, consistent with the pharmacological modeling predicting increased risk of treatment failure. A thorough study of such variants not necessarily linked to canonical drug-resistance, but which are prone to promote anti-TB drug tolerance, may be crucial to prevent the subsequent emergence of resistance. Taken together, the present findings support the further exploration of Mtb micro-diversity as a promising tool to detect patients at risk of poorly responding to anti-TB treatment, ultimately allowing improved and personalized TB management., Author summary Tuberculosis (TB) is caused by Mycobacterium tuberculosis (Mtb), bacteria that are able to persist inside the patient for many months or years, thus requiring long antibiotic treatments. Here we focused on TB patients with delayed response to treatment and we performed genetic characterization of Mtb isolates to search for sub-populations that may tolerate anti-TB drugs. We found that Mtb cultured from 9/15 patients contained different sub-populations, and in vitro drug exposure revealed Mtb sub-populations in 6/15 isolates, none related to known drug-resistance mechanisms. By contrast, drug exposure revealed Mtb sup-populations in 2/20 isolates in the control cohort of patients with fast culture conversion. Furthermore, we characterized a Mtb variant isolated from a sub-population growing in the presence of rifampicin (RIF), a major anti-TB drug. We found that this variant featured a modified lipidic envelope, and that it was able to develop in the presence of RIF and inside human macrophage cells. We performed pharmacological modelling and found that this kind of variant may be related to a poor response to treatment. In conclusion, searching for particular Mtb sub-populations may help to detect patients at risk of treatment failure and provide additional guidance for TB management.

The composition and dynamics of the lung microbiome during pneumonia are not known, although the lung microbiome might influence the severity and outcome of this infectious disease, similar to what was shown for the microbiome at other body sites. Here we report the findings of a comprehensive analysis of the lung microbiome composition of three patients with long-term pneumonia due to L. pneumophila and its evolution during antibiotic treatment. This work adds to our understanding of how the microbiome changes during disease and antibiotic treatment and points to microorganisms and their interactions that might be beneficial. In addition to bacteria and fungi, our analyses included archaea and eukaryotes (protozoa), showing that both are present in the pulmonary microbiota and that they might also play a role in the response to the microbiome disturbance., Despite the importance of pneumonia to public health, little is known about the composition of the lung microbiome during infectious diseases, such as pneumonia, and how it evolves during antibiotic therapy. To study the possible relation of the pulmonary microbiome to the severity and outcome of this respiratory disease, we analyzed the dynamics of the pathogen and the human lung microbiome during persistent infections caused by the bacterium Legionella pneumophila and their evolution during antimicrobial treatment. We collected 10 bronchoalveolar lavage fluid samples from three patients during long-term hospitalization due to pneumonia and performed a unique longitudinal study of the interkingdom microbiome, analyzing the samples for presence of bacteria, archaea, fungi, and protozoa by high-throughput Illumina sequencing of marker genes. The lung microbiome of the patients was characterized by a strong predominance of the pathogen, a low diversity of the bacterial fraction, and an increased presence of opportunistic microorganisms. The fungal fraction was more stable than the bacterial fraction. During long-term treatment, no genomic changes or antibiotic resistance-associated mutations that could explain the persistent infection occurred, according to whole-genome sequencing analyses of the pathogen. After antibiotic treatment, the microbiome did not recover rapidly but was mainly constituted of antibiotic-resistant species and enriched in bacteria, archaea, fungi, or protozoa associated with pathogenicity. The lung microbiome seems to contribute to nonresolving Legionella pneumonia, as it is strongly disturbed during infection and enriched in opportunistic and/or antibiotic-resistant bacteria and microorganisms, including fungi, archaea, and protozoa that are often associated with infections.

Summary Whole-genome sequencing can be used to support or refute suspected links between hospital water systems and Legionnaires’ disease cases. However, caveats regarding the interpretation of genomic data from Legionella pneumophila are described that should be considered in future investigations., Background. Legionnaires’ disease is an important cause of hospital-acquired pneumonia and is caused by infection with the bacterium Legionella. Because current typing methods often fail to resolve the infection source in possible nosocomial cases, we aimed to determine whether whole-genome sequencing (WGS) could be used to support or refute suspected links between cases and hospitals. We focused on cases involving a major nosocomial-associated strain, L. pneumophila sequence type (ST) 1. Methods. WGS data from 229 L. pneumophila ST1 isolates were analyzed, including 99 isolates from the water systems of 17 hospitals and 42 clinical isolates from patients with confirmed or suspected hospital-acquired infections, as well as isolates obtained from or associated with community-acquired sources of Legionnaires’ disease. Results. Phylogenetic analysis demonstrated that all hospitals from which multiple isolates were obtained have been colonized by 1 or more distinct ST1 populations. However, deep sampling of 1 hospital also revealed the existence of substantial diversity and ward-specific microevolution within the population. Across all hospitals, suspected links with cases were supported with WGS, although the degree of support was dependent on the depth of environmental sampling and available contextual information. Finally, phylogeographic analysis revealed that hospitals have been seeded with L. pneumophila via both local and international spread of ST1. Conclusions. WGS can be used to support or refute suspected links between hospitals and Legionnaires’ disease cases. However, deep hospital sampling is frequently required due to the potential coexistence of multiple populations, existence of substantial diversity, and similarity of hospital isolates to local populations.

Mycobacterium tuberculosis (Mtb) whole genome sequencing (WGS) plays an increasingly important role in tuberculosis diagnosis and research. WGS is typically performed on biobanked isolates obtained by subculture during diagnosis. Genetic variation upon culturing is known to occur in other bacterial species. However, little is understood regarding the impact of different subculture media on genome-wide diversity and variant selection in Mtb. Here we compared WGS derived from direct sequencing of sputa samples to WGS sequences from isolates subcultured on 3 different media. Based on analysis of single nucleotide polymorphisms (SNPs), there was no evidence of variant selection caused by the different culture media used, indicating that subcultured clinical strains can be reliably used to explore genetic determinants of Mtb pathogenesis and epidemiological features.

Rapid and correct determination of Mycobacterium tuberculosis (MTB) drug susceptibility is a challenge for tuberculosis (TB) management. Phenotypic drug susceptibility testing (DST) remains the reference method but is time consuming. In this study, genotypic prediction of the first-line drug susceptibility profile obtained by whole-genome sequencing (WGS) was compared with that obtained by phenotypic DST and the line probe assay (LPA). All MTB strains isolated from patients during routine practice at the mycobacteria laboratory of Lyon University Hospital, France, between November 2016 and July 2019 were included (n = 274). Isolates were tested for the first-line drugs using phenotypic DST (Mycobacteria Growth Indicator Tube) and for genotypic prediction of the susceptibility profile with LPA and WGS. Considering phenotypic DST as the reference, WGS predicted resistance to rifampicin, isoniazid, ethambutol and pyrazinamide with sensitivities of 100%, 100%, 100% and 93.8%, respectively, and susceptibility to these drugs with specificities of 99.6%, 100%, 98.5% and 100%, respectively. Performance of the LPA was poorer, with sensitivity of 83.3% for rifampicin and 85.7% for isoniazid resistance. Five isolates were classified as susceptible according to phenotypic DST (1 for rifampicin, 4 for ethambutol) while WGS detected resistance mutations in rpoB and embB genes. WGS, used under appropriate quality-control conditions, has good performance to predict the resistance profile for the four first-line drugs and can correct phenotypic DST results. This study highlights the need for future guidelines recommending WGS as the initial tool in routine practice in areas where the prevalences of TB and drug-resistant MTB are low.

International audience; Legionnaires' disease is a severe pneumonia mainly caused by Legionella pneumophila that is treated by antibiotics. The purpose of this study was to describe the susceptibility of clinical strains of L. pneumophila to eight antibiotics used for treatment of legionellosis. The minimum inhibitory concentrations (MICs) of 109 well-characterised clinical strains of L. pneumophila serogroup 1 were determined by the broth microdilution method without charcoal and were compared with antibiotic-resistant strains selected in vitro. All strains were inhibited by low concentrations of fluoroquinolones, macrolides and rifampicin. The epidemiological cut-off values (ECOFFs) were 0.064 mg/L for ciprofloxacin, 0.064 mg/L for moxifloxacin, 0.032 mg/L for levofloxacin, 1 mg/L for erythromycin, 2 mg/L for azithromycin, 0.064 mg/L for clarithromycin, 2 mg/L for doxycycline and 0.001 mg/L for rifampicin. However, MIC distributions revealed a subpopulation of strains displaying reduced susceptibility to some macrolides (especially azithromycin), which correlated with the presence of the lpeAB genes encoding a macrolide efflux pump found specifically in sequence type (ST) ST1, ST701 and closely related STs. Thus, all isolates could be considered susceptible to the tested antibiotics, although macrolides were less active against some strains harbouring a specific efflux system.

International audience; Three urinary antigen tests were compared using purified Legionella pneumophila (Lp) LPS. For Lp serogroup1, Sofia®FIA and Binax®EIA limits of detection (LOD) were similar; that of BinaxNOW® lower. For all tests the LOD was higher with LPS from non-Pontiac compared to Pontiac-strains. The LOD was variable for other Lp serogroups.

International audience; OBJECTIVES: Legionella pneumophila serogroup 1 (Lp1) sequence type 47 is the leading cause of legionellosis in north-western Europe, but, surprisingly, it is rarely isolated from environmental samples. Comparative genomics was applied to develop a PCR assay and to better understand the evolution of this strain. METHODS: Comparative analysis of 36 genomes representative of the Lp species was used to identify specific PCR targets, which were then evaluated in silico on 545 sequenced genomes and in~vitro on 436 Legionella strains, 106 respiratory samples, and three environmental samples from proven ST47 sources. Phylogenetic analyses were performed to understand the evolution of ST47. RESULTS: The gene LPO\₁073 was characterized as being 100% conserved in all 129 ST47 genomes analysed. A real-time PCR designed to detect LPO\₁073 was positive for all 110 ST47 strains tested and agreed with culture and typing results previously obtained for 106 respiratory samples. The three environmental samples were also positive. Surprisingly, 26 of the 44 ST109 strains tested among 342 non-ST47 strains scored positive for LPO\₁073. SNP-based phylogenetic analysis was undertaken to understand this result: the PCR-positive ST109 genomes were almost identical to ST47 genomes, with the exception of a recombined region probably acquired by ST47 from a ST62(-like) strain. CONCLUSION: The genomic analysis allowed the design of a highly specific PCR assay for rapid detection of ST47 strains. Furthermore, it allowed us to uncover the evolution of ST47 strains from ST109 by homologous recombination with ST62. We hypothesize that this recombination generated the leading cause of legionellosis in north-western Europe.

International audience; Legionella are opportunistic pathogens that develop in aquatic environments where they multiply in protozoa. When infected aerosols reach the human respiratory tract they may accidentally infect the alveolar macrophages leading to a severe pneumonia called Legionnaires' disease (LD). The ability of Legionella to survive within host-cells is strictly dependent on the Dot/Icm Type 4 Secretion System that translocates a large repertoire of effectors into the host cell cytosol. Although Legionella is a large genus comprising nearly 60 species that are worldwide distributed, only about half of them have been involved in LD cases. Strikingly, the species Legionella pneumophila alone is responsible for 90% of all LD cases. The present review summarizes the molecular approaches that are used for L. pneumophila genotyping with a major focus on the contribution of whole genome sequencing (WGS) to the investigation of local L. pneumophila outbreaks and global epidemiology studies. We report the newest knowledge regarding the phylogeny and the evolution of Legionella and then focus on virulence evolution of those Legionella species that are known to have the capacity to infect humans. Finally, we discuss the evolutionary forces and adaptation mechanisms acting on the Dot/Icm system itself as well as the role of mobile genetic elements (MGE) encoding T4ASSs and of gene duplications in the evolution of Legionella and its adaptation to different hosts and lifestyles.

Legionella pneumophila is an environmental bacterium and the leading cause of Legionnaires’ disease. Just five sequence types (ST), from more than 2000 currently described, cause nearly half of disease cases in northwest Europe. Here, we report the sequence and analyses of 364 L. pneumophila genomes, including 337 from the five disease-associated STs and 27 representative of the species diversity. Phylogenetic analyses revealed that the five STs have independent origins within a highly diverse species. The number of de novo mutations is extremely low with maximum pairwise single-nucleotide polymorphisms (SNPs) ranging from 19 (ST47) to 127 (ST1), which suggests emergences within the last century. Isolates sampled geographically far apart differ by only a few SNPs, demonstrating rapid dissemination. These five STs have been recombining recently, leading to a shared pool of allelic variants potentially contributing to their increased disease propensity. The oldest clone, ST1, has spread globally; between 1940 and 2000, four new clones have emerged in Europe, which show long-distance, rapid dispersal. That a large proportion of clinical cases is caused by recently emerged and internationally dispersed clones, linked by convergent evolution, is surprising for an environmental bacterium traditionally considered to be an opportunistic pathogen. To simultaneously explain recent emergence, rapid spread and increased disease association, we hypothesize that these STs have adapted to new man-made environmental niches, which may be linked by human infection and transmission.

Endemic strains of Legionella pneumophila sequence type 1 (ST1), in particular the ST1/Paris pulsotype, are dispersed worldwide and represent about 10% of culture-proven clinical cases of Legionnaires' disease in France. The high rate of isolation of this strain from both clinical and environmental samples makes identification of the source of infection difficult during epidemiological investigations. The full-length genome sequence of this strain was recently determined, and it revealed the presence of a CRISPR/ cas complex. The aim of this study was to develop and evaluate a spoligotyping tool based on the diversity of this CRISPR locus that would allow the accurate subtyping of the L. pneumophila serogroup 1 ST1/Paris pulsotype. The CRISPR loci of 28 L. pneumophila ST1/Paris pulsotype isolates were sequenced, and 42 different spacers regions were characterized. A membrane-based spoligotyping method was developed and used to determine the subtypes of 406 L. pneumophila isolates, including 233 with the ST1/Paris pulsotype profile that were collected in France from 2000 to 2011. A total of 46 different spoligotypes were detected, and 41 of these were specifically identified in the ST1/Paris pulsotype isolates. In 27 of 33 epidemiological investigations, the environmental source of contamination was confirmed by comparing spoligotypes of clinical isolates with those of environmental isolates. With an index of discrimination of 79.72% (95% confidence interval, 75.82 to 83.63), spoligotyping of the L. pneumophila ST1/Paris pulsotype has the potential to be a useful complementary genotyping tool for discriminating isolates with undistinguishable pulsed-field gel electrophoresis (PFGE) and ST genotypes, which could help to identify environmental sources of infection.

The causative agent of legionellosis, Legionella pneumophila , colonizes all natural and human-made water networks, thus constituting the source of contaminated aerosols responsible for airborne human infections. Efficient control of infections, especially during epidemics, necessitates the fastest and most resolutive identification possible of the bacterial source for subsequent disinfection of reservoirs. We thus compared recognized typing approaches for Legionella with a method based on characterization of insertion sequence (IS) content. A total of 86 clinical or environmental isolates of L. pneumophila , including 84 Paris isolates, sampled from 25 clinical investigations in France between 2001 and 2007, were obtained from the Legionella National Reference Center. All strains were typed by monoclonal antibody subgrouping, sequence-based typing, pulsed-field gel electrophoresis, and restriction fragment length polymorphism based on the presence or absence of IS elements. We identified six different types of IS elements in L. pneumophila Paris and used them as genomic markers in hybridization experiments. One IS type, IS Lpn11 , revealed a high discriminatory power. Simpson's index of discrimination, calculated from the distribution of IS elements, was higher than that obtained with the other typing methods used for L. pneumophila Paris. Moreover, specific IS Lpn11 copies were found only in strains isolated from particular cities. In more than half of the cases, each clinical isolate had an IS Lpn11 profile that was recovered in at least one environmental isolate from the same geographical location, suggesting that our method could identify the infection source. Phylogenetic analysis suggests a clonal expansion for the L. pneumophila Paris strain.

Culture media performance is a critical factor in the isolation of Legionellae from respiratory samples. We showed that BMPA and MWY media yielded significantly higher isolation rates than GVPC and BCYE media in regard to performance with samples that harbored low Legionella inocula and high contamination levels.

Legionella pneumophila, the bacterium responsible for Legionnaires' disease and Pontiac fever, is ubiquitous in natural and man-made aqueous environments and requires free-living amoebae for its intracellular replication (1, 15, 31). Under appropriate conditions, L. pneumophila can also survive for long periods as a free organism in low-nutrient environments (4, 30). Regular monitoring of potentially contaminated water sources is essential to prevent legionellosis outbreaks (21, 27). Culture with selective media is the standard method for the detection, isolation, and identification of L. pneumophila in clinical and environmental samples (18, 19), but it can take more than 7 days. Cost-effective and reliable real-time quantitative PCR methods have been developed for rapid detection/quantification of Legionella DNA in water samples and are often used as a routine monitoring tool (14, 36). The results are expressed as the number of genome units (GU) per liter, but the precise equivalence with the number of CFU has not been established. Culture and PCR agree well on samples from hot water systems but not from cooling towers. Culture is always less sensitive than PCR (2, 23, 36). Discrepancies between PCR and culture results can be explained by several factors. Legionella growth can be inhibited or masked by overgrowth of contaminating microorganisms (18). Furthermore, L. pneumophila can enter a viable but noncultivable (VBNC) state, from which it can recover after passage in amoebae (12, 30). These VBNC legionellae may be detected by PCR, along with dead bacteria, possibly explaining, at least in part, why PCR values are usually higher than those obtained by culture. In order to understand the significance of positive L. pneumophila PCR results for water samples, we prepared L. pneumophila-containing water samples, with and without chlorination, and tested them comparatively by (i) conventional culture, (ii) a real-time PCR assay for total L. pneumophila DNA, (iii) a fluorescence assay for viable bacteria (VBNC and cultivable bacteria), and (iv) immunodetection of all living and dead intact L. pneumophila cells. Potential VBNC bacteria detected by the fluorescence assay were tested for infectivity and recultivability in a coculture technique with amoebae.

Microbial adherence to host cells is an early key step in the establishment of infection. During the course of Legionnaire's disease, Legionella interactions with host cells are best documented for resident macrophages. However, L. pneumophila can also replicate within type I and type II pneumocytes, which cover almost the entire alveolar surface. In the presence of zinc, we observed a significant and concentration-dependent increase in L. pneumophila adherence to and invasion of type II pneumocytes. The zinc-dependent adherence mechanism seemed to be host-cell-independent, as a similar increase in cytoadherence was observed with macrophages. We also found that zinc-dependent adherence of L. pneumophila appears to involve recognition of zinc-binding pneumocyte receptors by a bacterial adhesin, and heparan-sulfated host cell receptors, but not type IV pili.

Background Various pathogens have been suspected to play a role in the initiation or amplification of the atherosclerotic lesions. Both experimental and epidemiological arguments plead for a possible role of enterovirus in this process. Objective To determine the prevalence of enterovirus genome in atherosclerotic plaques, in comparison with Chlamydia pneumoniae, human cytomegalovirus (hCMV) and herpes simplex virus. Study design Pilot study on 18 patients who underwent artery resection. Five artery samples were tested for each patient and each pathogen by using PCR techniques whose sensitivity was evaluated for this kind of specimen. The quality of the extraction step was assessed by amplification of a fragment of the human aldolase A gene. Results The genome of at least one infectious agent was detected in artery samples from 7 of the 18 patients (38.9%). In all cases, only one of the five aliquots was found positive; a confirmation was done by sequencing the PCR product. With regards to enterovirus, four patients (22.2%) were detected positive (one of them being also positive for hCMV). Conclusions These results suggest that small amounts of enterovirus genome are commonly found in lesions of patients with advanced arteriosclerosis. Further studies are needed to evaluate the clinical significance of this association.

A 42-plex clustered regularly interspaced short palindromic repeat (CRISPR)-based typing technique (spoligotyping) was recently developed at the French National Reference Center for Legionella . It allows the subtyping of the Legionella pneumophila sequence type 1/Paris pulsotype. In this report, we present the transfer of the membrane-based spoligotyping technique to a microbead-based multiplexed format. This microbead-based high-throughput assay uses devices such as Luminex 200 or the recently launched Magpix system (Luminex Corp., Austin, TX). We designated this new technique LP-SPOL (for L. p neumophila spol igotyping). We used two sets of samples previously subtyped by the membrane-based spoligotyping method to set up and validate the transfer on the two microbead-based systems. The first set of isolates ( n = 56) represented the whole diversity of the CRISPR patterns known to date. These isolates were used for transfer setup (determination of spacer cutoffs for both devices). The second set of isolates ( n = 245) was used to validate the transfer to the two microbead-based systems. The results obtained by the Luminex 200 system were 100% concordant with those obtained by the Magpix system for the 2 sets of isolates. In total, 10 discrepant results were observed when comparing the membrane-based method to the microbead-based method. These discrepancies were further resolved by repeating either the membrane-based or the microbead-based assay. This new assay is expected to play an emerging role for surveillance of L. pneumophila , starting with one of the most frequent genotypes, the sequence type 1/Paris pulsotype. However, the generalization of this typing method to all L. pneumophila strains is not feasible, since not all L. pneumophila strains contain CRISPRs.

To the Editor: Legionellosis is a pneumonia caused by inhalation of Legionella spp. in aerosol water particles. Legionella pneumophila is responsible for ≈90% of cases; serogroup 1 alone accounts for ≈85% of cases (1). Epidemiologic analyses based on pulsed-field gel electrophoresis (PFGE) and sequence-based typing of clinical isolates of L. pneumophila serogroup 1 have detected sporadic, epidemic, and endemic strains (2). Most cases are sporadic and are associated with strains that have not been identified. A strain is considered endemic to an area when several isolates that have identical PFGE patterns and that cause several epidemiologically unrelated cases of legionellosis are detected in that area. Since 1998, the most prevalent strain endemic to France has been the Paris strain (3), which was responsible for 12.2% of culture-confirmed cases of legionellosis from 1998 through 2002 (3). The Paris strain has also been detected in clinical samples from several other European countries (Switzerland, Italy, Spain, and Sweden) and in environmental samples (3,4). We identified a new endemic clone of L. pneumophila serogroup 1, the Lorraine strain, and report its spread throughout France. The French national reference center for Legionella collects all clinical isolates of Legionella spp. as part of an epidemiologic surveillance system. All L. pneumophila serogroup 1 isolates are typed by PFGE methods as described (4). When necessary, sequence-based typing (5,6) and monoclonal antibody–based (MAb) subgrouping are also used (7). From 1995 through 2006, the reference center typed 1,768 clinical Legionella isolates by means of PFGE. Most PFGE patterns were unique and thus corresponded to sporadic cases. Another 145 (8.2%) patterns were identical and corresponded to the endemic Paris strain. An identical PGFE pattern was also found for 80 (4.5%) isolates from epidemiologically unrelated patients; these isolates were further characterized by sequence-based typing and MAb subgrouping. Sequence type was deduced for the following genes: flaA, pilE, asd, mip, mompS, proA, and neuA (6). The sequence type was obtained for 78 of the 80 isolates and was 5, 10, 22, 15, 6, 2, 6. The sequence type of the remaining 2 isolates differed from that of the other 78 by 2 alleles (pilE and proA) and was 5, 1, 22, 15, 6, 10, 6 (boldface indicates differences). All but another 2 isolates (which belonged to the Benidorm subgroup) belonged to the Allentown MAb subgroup. Hence, the new endemic strain, Lorraine, was represented by 76 isolates that had an identical PFGE pattern, sequence type, and MAb subgroup. Isolation of the Lorraine strain was reported anecdotally before 2002. Since 2002, the prevalence of this strain in France has increased considerably, accounting for 10.5% clinical isolates in 2005 and 9.0% in 2006 (Figure). In contrast, prevalence of the Paris strain was ≈10% from 1998 through 2002 and peaked in 2000 (16.9%) in association with a hospital outbreak in Paris. From 2003 through 2006, prevalence of the Paris strain fell to ≈6.5%. Figure Prevalence of the Legionella pneumophila Paris (black bars) and Lorraine (grey bars) endemic strains, France, 1995–2006. White bar sections represent the proportion of strains isolated during outbreaks. For example, in 2000 the Paris strain accounted ... The Lorraine strain has caused 2 outbreaks. In the first, 3 isolates were recovered from respiratory samples of 34 patients for whom legionellosis was diagnosed by urinary antigen testing in Lyon in 2005. The second outbreak occurred in a western suburb of Paris in 2006, when 1 isolate was cultured from respiratory samples of 12 patients whose diagnoses were also made by urinary antigen testing. From 1995 through 2006, >4,000 environmental Legionella isolates in France were typed by PFGE, and >700 types were identified. The Paris strain type was identified >500 times, but the Lorraine type was identified in only 3 water samples, including 1 from the cooling tower responsible for the outbreak in the Paris suburb. The Lorraine strain is thus rarely found in water samples, which hinders environmental investigations of its sources in outbreaks of legionellosis. A similar disparity between the clinical and environmental distribution of Legionella strains has been reported (8). In a collection of 284 unrelated clinical isolates and 117 unrelated environmental isolates, Harrison et al. found that 3 types, identified by restriction fragment length polymorphism, accounted for 40% of clinical isolates but only 18% of environmental isolates (8). The high prevalence of the Lorraine strain in clinical samples and its extremely rare detection in water samples have several possible explanations: 1) this strain could be related to specific host factors; 2) it could be highly virulent even in low amounts, below the culture detection limit; and 3) it could be more susceptible than other strains to different stressors (e.g., biocide treatment, selective preplating techniques, environmental medium specific components). In conclusion, prevalence of a new L. pneumophila serogroup 1 strain, Lorraine, endemic to France, is increasing in clinical samples although rarely detected in water samples. The type strain, Lorraine (CIP108 729), is available from the strain collection of the Pasteur Institute (Paris, France).

Currently, several methods are used for the detection of Legionella in clinical samples, and these methods constitute part of the criteria for defining legionellosis cases. Urinary antigen detection is the first-line diagnostic test, although this test is limited to L. pneumophila serogroup 1 (Lp1) (Helbig et al., J Clin Microbiol 41:838-840, 2003). The use of molecular techniques can improve Legionaire's disease (LD) diagnosis by detecting other serogroups and species (Diederen et al., J Clin Microbiol 46:671-677, 2008). The isolation of Legionella strains from pulmonary samples by axenic culture is still required to perform further epidemiological investigations (Blyth et al., N S W Public Health Bull 20:157-161, 2009; Fields et al., Clin Microbiol Rev 15:506-526, 2002) but demonstrates various sensitivities. Amoebic coculture has been described as a method to recover Legionella from clinical culture-negative specimens (La Scola et al., J Clin Microbiol 39:365-366, 2001; Rowbotham, J Clin Pathol 36:978-986, 1983) and can be proposed for optimizing Legionella strain isolation from samples contaminated by oropharyngeal flora. Identification of Legionella isolates is based on serological characterization, genotypic methods (with sequencing of the mip gene as the standard method) and, more recently, the Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) method.This chapter is limited to the identification of Legionella in clinical samples; antibody detection in human serum will not be discussed.

We evaluated the contribution of amoebic coculture to the recovery of Legionella spp. from 379 respiratory samples. The sensitivity of axenic culture was 42.1%. The combination of axenic culture with amoebic coculture increased the Legionella isolation rate to 47.1%. Amoebic coculture was particularly efficient in isolating Legionella spp. from respiratory samples contaminated with oropharyngeal flora.

Legionella species are facultative, intracellular bacteria that infect macrophages and protozoa, with the latter acting as transmission vectors to humans. These fastidious bacteria mostly cause pulmonary tract infections and are routinely identified by various molecular methods, mainly PCR targeting the mip gene and sequencing, which are expensive and time-consuming. Recently, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) has emerged as a rapid and inexpensive method for identification of bacterial species. This study evaluated the use of MALDI-TOF-MS for rapid species and serogroup identification of 21 Legionella species recognized as human pathogens. To this end, a reference MS database was developed including 59 Legionella type strains, and a blind test was performed using 237 strains from various species. Two hundred and twenty-three of the 237 strains (94.1 %) were correctly identified at the species level, although ten (4.2 %) were identified with a score lower than 2.0. Fourteen strains (5.9 %) from eight species were misidentified at the species level, including seven (3.0 %) with a significant score, suggesting an intraspecific variability of protein profiles within some species. MALDI-TOF-MS was reproducible but could not identify Legionella strains at the serogroup level. When compared with mip gene sequencing, MALDI-TOF-MS exhibited a sensitivity of 99.2 and 89.9 % for the identification of Legionella strains at the genus and species level, respectively. This study demonstrated that MALDI-TOF-MS is a reliable tool for the rapid identification of Legionella strains at the species level.

Sequence-based typing (SBT) is a powerful method based on the sequencing of seven genes of Legionella pneumophila isolates. SBT performed directly on clinical samples has been used only in a limited number of cases. In our study, its efficiency was tested with 63 legionellosis respiratory samples. Sixty-three clinical samples, which included 23 samples from sporadic cases and 40 collected during four French outbreaks, confirmed by culture or urinary antigen testing and all positive by L. pneumophila quantitative PCR were subtyped by SBT according to the European Working Group for Legionella Infections standard scheme. Only 28.6% of the samples provided nucleotide sequences by SBT. Nested-PCR-based SBT (NPSBT) applied to the same respiratory samples was thus evaluated with new PCR primers surrounding the first set of primers used for the SBT. Sequencing results were obtained with 90.5% of the samples. Complete allelic profiles (seven genes sequenced) were obtained for 3.2% versus 53.9% of the samples by SBT and NPSBT, respectively. More importantly, of the 28 culture-negative samples, only 4 did not give any sequencing results. Taken together, NPSBT applied directly to clinical specimens significantly improved epidemiological typing compared to the initial SBT, in particular when no isolates are available.

Background In France, Legionnaires disease is mainly caused by Legionella pneumophila. Here, we investigated possible host factors associated with susceptibility to community-acquired Legionnaires disease caused by the endemic Paris and Lorraine strains. Methods We conducted a double-nested exploratory case-control study with use of data from the French national surveillance network of incident Legionnaires disease cases notified from 1998 through 2007. Patients with community-acquired Legionnaires disease and an L. pneumophila serogroup 1 isolate were eligible. Case patients were patients infected by the Paris or Lorraine strain, and control patients were those infected by sporadic strains. Epidemiological and clinical factors associated with infection with the Paris and Lorraine strains were assessed by calculating adjusted odds ratios (aOR) in multivariate logistic regression models. Results We studied 1090 patients infected by sporadic strains (n = 920), the Paris strain (n = 80), or the Lorraine strain (n = 90). Infection with the Paris strain was significantly associated with female sex (aOR, 1.98; 95% confidence interval [CI], 1.19-3.28), steroid therapy (aOR, 3.16; 95% CI, 1.76-5.68), and a history of cancer or hematologic malignancies (aOR, 2.08; 95% CI, 1.15-3.76). In addition, the mortality rate was higher among patients infected with the Paris strain than in the control group (38% vs. 25.5%). The Lorraine strain was associated with smoking (aOR, 1.82; 95% CI, 1.14-2.91) and reduced mortality (9.9%). . Conclusion Several host characteristics were associated with the risk of infection by endemic strains of L. pneumophila serogroup 1. These findings may help to guide preventive measures. Factors predisposing patients to infection by specific strains need to be explored further.

Background Bacterial genomes harbour a large number of tandem repeats, yet the possible phenotypic effects of those found within the coding region of genes are only beginning to be examined. Evidence exists from other organisms that these repeats can be involved in the evolution of new genes, gene regulation, adaptation, resistance to environmental stresses, and avoidance of the immune system. Results In this study, we have investigated the presence and variability in copy number of intragenic tandemly repeated sequences in the genome of Legionella pneumophila, the etiological agent of a severe pneumonia known as Legionnaires' disease. Within the genome of the Philadelphia strain, we have identified 26 intragenic tandem repeat sequences using conservative selection criteria. Of these, seven were "polymorphic" in terms of repeat copy number between a large number of L. pneumophila serogroup 1 strains. These strains were collected from a wide variety of environments and patients in several geographical regions. Within this panel of strains, all but one of these seven genes exhibited statistically different patterns in repeat copy number between samples from different origins (environmental, clinical, and hot springs). Conclusion These results support the hypothesis that intragenic tandem repeats could play a role in virulence and adaptation to different environments. While tandem repeats are an increasingly popular focus of molecular typing studies in prokaryotes, including in L. pneumophila, this study is the first examining the difference in tandem repeat distribution as a function of clinical or environmental origin.

Quantification of the Epstein–Barr (EBV) DNA genome by quantitative real-time PCR has been useful for the management of EBV-associated diseases (1)(2)(3)(4). Nevertheless, it gives no information on the various patterns of expression of the latent genes or on the presence of a lytic infection. EBV lytic mRNAs have been detected in infectious mononucleosis and some EBV-associated malignancies, but their relevance is still debated (5)(6)(7). The quantification of late EBV transcripts may bring additional information to EBV DNA quantification for the understanding and follow-up of EBV-associated disease, as already demonstrated for other herpes viruses (8)(9)(10)(11). In this study, we developed a method for quantifying a late transcript of the highly conserved EBV envelope glycoprotein gene, gp350/220 (12)(13), that uses real-time reverse transcription-PCR (RT-PCR), the Taqman® technology, and serial dilutions of in vitro transcripts to quantify mRNA. gp350/220 mRNA was quantified in EBV-infected cell lines and was then applied to a series of clinical samples. Total RNA from cell lines (500 000 cells), clinical samples, or in vitro transcripts (5 μL) was extracted with the High-Pure-RNA-Isolation-Kit® (Roche), and residual DNA was removed by two 20-min incubations with DNase I. The RNA concentration was estimated spectrophotometrically and converted to copy number for the in vitro transcript. The RT-PCR mixture (20 μL) contained 100 ng of total RNA from cell lines or 250 ng of total RNA from clinical samples, 3.25 mM manganese acetate (LightCycler-RNA-Master-Hybridization-Probes-Kit®; Roche), 0.3 μM upstream primer [gpU2; 5′-AGAATCTGGGCTGGGACGTT-3′; position 89585 (14)], 0.3 μM downstream primer (gpL2; 5′-ACATGGAGCCCGGACAAGT-3′; position 89784), and 0.3 μM probe [EBVGPq; 5′-(6-FAM)AGCCCACCACAGATTACGGCGGT(TAMRA)(Phosphate)-3′, where 6-FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine; position 89761]. The RT-PCR program (61 °C for 30 min, 3 min at 95 °C, and 40 …

Three multiplex hemi-nested RT-PCR assays were developed to detect simultaneously 12 RNA respiratory viruses: influenza viruses A, B and C, human respiratory syncytial virus (hRSV), human metapneumovirus (hMPV), parainfluenza virus types 1-4 (PIV-1, -2, -3 and -4), human coronavirus OC43 and 229E (HCoV) and rhinovirus (hRV). An internal amplification control was included in one of the RT-PCR assays. The RT-PCR multiplex 1 and the hemi-nested multiplex 1 detected 1 and 0.1 TCID50 of RSV A, respectively, and 0.01 and 0.001 TCID50 of influenza virus A/H3N2, respectively. Two hundred and three nasal aspirates from hospitalised children were retrospectively tested in comparison with two conventional methods: direct immunofluorescence assay and viral isolation technique. Almost all samples (89/91) that were positive by immunofluorescence assay and/or viral isolation technique were detected by the multiplex assay. This method also detected an additional 85 viruses and 33 co-infections. The overall sensitivity (98%), rapidity and enhanced efficiency of these multiplex hemi-nested RT-PCR assays suggest that they would be a significant improvement over conventional methods for the detection of a broad spectrum of respiratory viruses.