Search

Oculopharyngodistal myopathy (OPDM) is an adult-onset neuromuscular disease characterized by progressive ptosis, dysarthria, ophthalmoplegia, and distal muscle weakness. Recent studies revealed that GGC repeat expansions in 5'-UTR of LRP12, GIPC1, and NOTCH2NLC are associated with OPDM. Despite these advances, approximately 30% of OPDM patients remain genetically undiagnosed. Herein, we aim to investigate the genetic basis for undiagnosed OPDM patients in two unrelated Chinese Han families.Parametric linkage analysis was performed. Long-read sequencing followed by repeat-primed polymerase chain reaction and amplicon length polymerase chain reaction were used to determine the genetic cause. Targeted methylation sequencing was implemented to detect epigenetic changes. The possible pathogenesis mechanism was investigated by quantitative polymerase chain reaction, immunoblotting, RNA fluorescence in situ hybridization, and immunofluorescence staining of muscle biopsy samples.The disease locus was mapped to 12q24.3. Subsequently, GGC repeat expansion in the promoter region of RILPL1 was identified in six OPDM patients from two families, findings consistent with a founder effect, designated as OPDM type 4. Targeted methylation sequencing revealed hypermethylation at the RILPL1 locus in unaffected individuals with ultralong expansion. Analysis of muscle samples showed no significant differences in RILPL1 mRNA or RILPL1 protein levels between patients and controls. Public CAGE-seq data indicated that alternative transcription start sites exist upstream of the RefSeq-annotated RILPL1 transcription start site. Strand-specific RNA-seq data revealed bidirectional transcription from the RILPL1 locus. Finally, fluorescence in situ hybridization/immunofluorescence staining showed that both sense and antisense transcripts formed RNA foci, and were co-localized with hnRNPA2B1 and p62 in the intranuclear inclusions of OPDM type 4 patients.Our findings implicate abnormal GGC repeat expansions in the promoter region of RILPL1 as a novel genetic cause for OPDM, and suggest a methylation mechanism and a potential RNA toxicity mechanism are involved in OPDM type 4 pathogenesis. ANN NEUROL 2022;92:512-526.

BACKGROUND AND PURPOSE: In spastic paraplegia type 5, spinal cord atrophy and white matter signal abnormalities in the brain are the main MR imaging alterations. However, the specific mechanism remains unclear. We explored the microstructural changes occurring in spastic paraplegia type 5 and assessed the relation between MR imaging and clinical data. MATERIALS AND METHODS: Seventeen patients with spastic paraplegia type 5 and 17 healthy controls were scanned with DTI and T1 mapping on a 3T MR imaging scanner. Fractional anisotropy, mean diffusivity, radial diffusivity, axial diffusivity, and T1 values were obtained using Tract-Based Spatial Statistics and the Spinal Cord Toolbox. Neurofilament light and myelin basic protein in the CSF were measured. The differences in MR imaging and biochemical data between patients with spastic paraplegia type 5 and healthy controls were compared using the Student t test. RESULTS: A widespread reduction of fractional anisotropy values and an elevation of mean diffusivity, T1, and radial diffusivity values were found in most cervical, T4, and T5 spinal cords; corona radiata; optic radiations; and internal capsules in spastic paraplegia type 5. A variation in axial diffusivity values was shown only in C2, C6, and the corona radiata but not in the gray matter. The levels of neurofilament light and myelin basic protein were higher in those with spastic paraplegia type 5 than in healthy controls (myelin basic protein, 3507 [SD, 2291] versus 127 [SD, 219] pg/mL; neurofilament light, 617 [SD, 207] versus 265 [SD, 187] pg/mL; P

Background Wilson disease is a rare, disabling, neurological genetic disease. Biomarkers of brain damage are less well developed. Objective The aim of this study was to evaluate the utility of plasma glial fibrillary acidic protein as a biomarker for neurological involvement in patients with Wilson disease. Methods This prospective cross-observational study compared plasma glial fibrillary acidic protein concentration among different subtypes of patients with Wilson disease and healthy control subjects. Plasma glial fibrillary acidic protein levels were measured in 94 patients and 25 healthy control subjects. Patients were divided into two subtypes: patients with neurological manifestations (n = 74) or hepatic manifestations (n = 20). Results Median levels of plasma glial fibrillary acidic protein were significantly elevated in patients with neurological manifestations (143.87 pg/mL) compared with those with hepatic manifestations (107.50 pg/mL) and healthy control subjects (86.85 pg/mL). Receiver operating characteristic curve revealed that a plasma glial fibrillary acidic protein cutoff value of 128.8 pg/mL provides sufficient sensitivity (80.0%) and specificity (63.5%) to differentiate patients with neurological manifestations from those with hepatic manifestations. Conclusions Plasma glial fibrillary acidic protein may serve as a biomarker for distinguishing different subtypes of Wilson disease. © 2021 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

Objective Recessive mutations in the CAPN1 gene have recently been identified in spastic paraplegia 76 (SPG76), a complex hereditary spastic paraplegia (HSP) that is combined with cerebellar ataxia, resulting in an ataxia‐spasticity disease spectrum. This study aims to assess the influence of CAPN1 variants on the occurrence of SPG76 and identify factors potentially contributing to phenotypic heterogeneity. Methods We screened a cohort of 240 unrelated HSP families for variants in CAPN1 using high‐throughput sequencing analysis. We described in detail the clinical and genetic features of the SPG76 patients in our cohort and summarized all reported cases. Results Six unreported CAPN1‐associated families containing eight patients with or without cerebellar ataxia were found in our cohort of HSP cases. These patients carried three previously reported homozygous truncating mutations (p.V64Gfs*103, c.759+1G>A, and p.R285*), and three additional novel compound heterozygous missense mutations (p.R481Q, p.P498L, and p.R618W). Lower limbs spasticity, hyperreflexia, and Babinski signs developed in about 94% of patients, with ataxia developing in 63% of cases. In total, 33 pathogenic mutations were distributed along the three reported functional domains of calpain‐1 protein, encoded by CAPN1, with no hotspot region. A comparison of gender distribution between the two groups indicated that female SPG76 patients were significantly more likely to present with complicated HSP than male patients (P = 0.015). Interpretation Our study supports the clinically heterogeneous inter‐ and intra‐family variability of SPG76 patients, and demonstrates that gender and calpain‐1 linker structure may contribute to clinical heterogeneity in SPG76 cases.

Objective Spinocerebellar ataxia type 3 (SCA3) is one of the most common hereditary neurodegenerative diseases, with balance instability as main symptom. Balance quantification is crucial for evaluating the efficacy of therapeutic interventions. However, balance evaluation in SCA3 is often subject to bias. Here, we aimed to quantitatively evaluate postural instability and investigate the relationship between postural instability and clinical characteristics in SCA3 patients. Methods Sixty‐two SCA3 patients and 62 normal controls were recruited, and their postural balance was measured using a posturographic platform. Principal component analysis was performed as data reduction to identify postural instability factors. Multivariable linear regression was used to investigate potential risk factors for postural instability and to explore whether postural instability predicts the severity and progression of ataxia in SCA3 patients. Results We found SCA3 patients experience postural instability characterized by significant impairment in static and dynamic stability. The condition without visual feedback was the most sensitive measure in differentiating SCA3 from controls. Regression analyses revealed that ataxia severity predicted both static (P = 0.014) and dynamic stability (P = 0.001). Likewise, along with expanded CAG repeats (P

T-cell reduction is an important characteristic of coronavirus disease 2019 (COVID-19), and its immunopathology is a subject of debate. It may be due to the direct effect of the virus on T-cell exhaustion or indirectly due to T cells redistributing to the lungs. HIV/AIDS naturally served as a T-cell exhaustion disease model for recognizing how the immune system works in the course of COVID-19. In this study, we collected the clinical charts, T-lymphocyte analysis, and chest CT of HIV patients with laboratory-confirmed COVID-19 infection who were admitted to Jin Yin-tan Hospital (Wuhan, China). The median age of the 21 patients was 47 years [interquartile range (IQR) = 40–50 years] and the median CD4 T-cell count was 183 cells/μl (IQR = 96–289 cells/μl). Eleven HIV patients were in the non-AIDS stage and 10 were in the AIDS stage. Nine patients received antiretroviral treatment (ART) and 12 patients did not receive any treatment. Compared to the reported mortality rate (nearly 4%–10%) and severity rate (up to 20%–40%) among COVID-19 patients in hospital, a benign duration with 0% severity and mortality rates was shown by 21 HIV/AIDS patients. The severity rates of COVID-19 were comparable between non-AIDS (median CD4 = 287 cells/μl) and AIDS (median CD4 = 97 cells/μl) patients, despite some of the AIDS patients having baseline lung injury stimulated by HIV: 7 patients (33%) were mild (five in the non-AIDS group and two in the AIDS group) and 14 patients (67%) were moderate (six in the non-AIDS group and eight in the AIDS group). More importantly, we found that a reduction in T-cell number positively correlates with the serum levels of interleukin 6 (IL-6) and C-reactive protein (CRP), which is contrary to the reported findings on the immune response of COVID-19 patients (lower CD4 T-cell counts with higher levels of IL-6 and CRP). In HIV/AIDS, a compromised immune system with lower CD4 T-cell counts might waive the clinical symptoms and inflammatory responses, which suggests lymphocyte redistribution as an immunopathology leading to lymphopenia in COVID-19.

Background Aim to identify potential biomarkers to assess therapeutic efficacy for hereditary spastic paraplegias type 5 (SPG5) by investigating the clinical, cerebrospinal fluid (CSF) and magnetic resonance imaging (MRI) features. Methods We performed a cross-sectional study to compare SPG5 patients with age- and sex-matched healthy controls who underwent conventional and quantitative MRI techniques of spinal cord (C1-T9) and brain. SPG5 patients also underwent assessment for clinical status and CSF biomarkers (27-hydroxycholesterol, neurofilament light). We identified a set of markers with standardized effect sizes (|t|> 0.5) to estimate sample sizes for disease progression (disease duration > 14 years vs. ≤ 14 years). Results Seventeen genetically confirmed SPG5 patients (11 men, 6 women; age range, 13–49 years; median disease duration, 14 years) were enrolled. Compared to healthy controls, the total spinal cord area (SCA) of SPG5 patients was reduced particularly at the thoracic levels (cervical levels: 12–27%; thoracic levels 41–60%). Patients did not show significant alterations of brain signal abnormalities or atrophy relative to controls. A total of 10 surrogate markers were selected and a minimum sample size was achieved with the measurement of SCA on T9 (n = 22) much less that what would be required if using clinical disability assessment (n = 124). Conclusions SPG5 patients showed distinct MRI features of spinal cord atrophy without significant brain alterations. Our finding supports the measurements of spinal cord on T9 level as potential endpoint for SPG5 clinical trials. Trial registration ClinicalTrials.gov, NCT04006418. Registered 05 July 2019, https://clinicaltrials.gov/ct2/show/NCT04006418?term=NCT04006418&draw=2&rank=1.

Neurogenetic diseases are neurological conditions with a genetic cause (s). There are thousands of neurogenetic diseases, and most of them are incurable. The development of bioinformatics and elucidation of the mechanism of pathogenesis have allowed the development of gene therapy approaches, which show great potential in treating neurogenetic diseases. Viral vectors delivery, antisense oligonucleotides, gene editing, RNA interference, and burgeoning viroid delivery technique are promising gene therapy strategies, and commendable therapeutic effects in the treatment of neurogenetic diseases have been achieved (Fig. 1). This review highlights a sampling of advances in gene therapies for neurogenetic disorders. Fig. 1 Examples of gene therapy strategies used in the treatment of neurogenetic diseases. The schematic diagram shows different gene therapy approaches used for treating a sampling of neurogenetic disorders, such as ASO therapy, gene editing, gene augmentation, and RNA interference.

Hereditary spastic paraplegia (HSP) refers to a group of neurodegenerative disorders characterized by bilateral weakness, spasticity, and hyperreflexia in the lower limbs. The autosomal dominant HSP (ADHSP) predominantly presents as the pure form, but the clinical profiles and causal genetic variants underlying ADHSP are complex, and many remain unknown. A cohort of 15 Chinese HSP pedigrees (including 35 patients and their 22 relatives) were screened by multiplex ligation-dependent probe amplification (MLPA) or whole-exome sequencing (WES). Neurological assessments were also conducted. The main subtypes of HSP above detected in our cohort were SPG4, SPG3A, and SPG6. Fifteen HSP-inducing mutations were identified, among which six were novel mutations: SPAST c.1277T>C, c.1292G>C, c.1562T>C, and c.1693A>T, NIPA1 c.748A>C, and KIDINS220 c.4448C>G. As expected, the most common presentation of the ADHSP cases was the pure form, manifesting spasticity of lower limbs and hyperreflexia, as well as pyramidal signs. Differing substantially from previous reports for KIDINS220 variants, our study family exhibited autosomal dominant inheritance, and only presented with spastic paraplegia, with no signs of intellectual disability, nystagmus, or obesity. Our work reveals a non-classical spastic paraplegia, intellectual disability, nystagmus, and obesity phenotype for a KIDINS220 mutation, which broadens both the clinical and genetic spectrum for ADHSP. Beyond underscoring the utility of using both MLPA and WES in studies of HSP, our work deepens the scientific understanding of phenotypes for ADHSP and defines new genetic variants to facilitate future diagnoses.

Hereditary spastic paraplegias refer to a heterogeneous group of neurodegenerative disorders resulting from degeneration of the corticospinal tract. Clinical characterization of patients with hereditary spastic paraplegias represents progressive spasticity, exaggerated reflexes and muscular weakness. Here, to expand on the increasingly broad pools of previously unknown hereditary spastic paraplegia causative genes and subtypes, we performed whole exome sequencing for six affected and two unaffected individuals from two unrelated Chinese families with an autosomal dominant hereditary spastic paraplegia and lacking mutations in known hereditary spastic paraplegia implicated genes. The exome sequencing revealed two stop-gain mutations, c.247_248insGTGAATTC (p.I83Sfs*11) and c.526G>T (p.E176*), in the ubiquitin-associated protein 1 (UBAP1) gene, which co-segregated with the spastic paraplegia. We also identified two UBAP1 frameshift mutations, c.324_325delCA (p.H108Qfs*10) and c.425_426delAG (p.K143Sfs*15), in two unrelated families from an additional 38 Chinese pedigrees with autosomal dominant hereditary spastic paraplegias and lacking mutations in known causative genes. The primary disease presentation was a pure lower limb predominant spastic paraplegia. In vivo downregulation of Ubap1 in zebrafish causes abnormal organismal morphology, inhibited motor neuron outgrowth, decreased mobility, and shorter lifespan. UBAP1 is incorporated into endosomal sorting complexes required for transport complex I and binds ubiquitin to function in endosome sorting. Patient-derived truncated form(s) of UBAP1 cause aberrant endosome clustering, pronounced endosome enlargement, and cytoplasmic accumulation of ubiquitinated proteins in HeLa cells and wild-type mouse cortical neuron cultures. Biochemical and immunocytochemical experiments in cultured cortical neurons derived from transgenic Ubap1flox mice confirmed that disruption of UBAP1 leads to dysregulation of both early endosome processing and ubiquitinated protein sorting. Strikingly, deletion of Ubap1 promotes neurodegeneration, potentially mediated by apoptosis. Our study provides genetic and biochemical evidence that mutations in UBAP1 can cause pure autosomal dominant spastic paraplegia.

Primary familial brain calcification (PFBC) is a rare neurodegenerative disorder with four causative genes (SLC20A2, PDGFRB, PDGFB, and XPR1) that have been identified. Here, we aim to describe the mutational spectrum of four causative genes in a series of 226 unrelated Chinese PFBC patients. Mutations in four causative genes were detected in 16.8% (38/226) of PFBC patients. SLC20A2 mutations accounted for 14.2% (32/226) of all patients. Mutations in the other three genes were relatively rare, accounting for 0.9% (2/226) of all patients, respectively. Clinically, 44.8% of genetically confirmed patients (probands and relatives) were considered symptomatic. The most frequent symptoms were chronic headache, followed by movement disorders and vertigo. Moreover, the total calcification score was significantly higher in the symptomatic group compared to the asymptomatic group. Functionally, we observed impaired phosphate transport induced by seven novel missense mutations in SLC20A2 and two novel mutations in XPR1. The mutation p.D164Y in XPR1 might result in low protein expression through an enhanced proteasome pathway. In conclusion, our study further confirms that mutations in SLC20A2 are the major cause of PFBC and provides additional evidence for the crucial roles of phosphate transport impairment in the pathogenies of PFBC.

IntroductionHereditary spastic paraplegias (HSPs) are uncommon but not rare neurodegenerative diseases. More than 100 pathogenic genes and loci related to spastic paraplegia symptoms have been reported. HSPs have the same core clinical features, including progressive spasticity in the lower limbs, though HSPs are heterogeneous (eg, clinical signs, MRI features, gene mutation). The age of onset varies greatly, from infant to adulthood. In addition, the slow and variable rates of disease progression in patients with HSP represent a substantial challenge for informative assessment of therapeutic efficacy. To address this, we are undertaking a prospective cohort study to investigate genetic–clinical characteristics, find surrogates for monitoring disease progress and identify clinical readouts for treatment.Methods and analysisIn this case-control cohort study, we will enrol 200 patients with HSP and 200 healthy individuals in parallel. Participants will be continuously assessed for 3 years at 12-month intervals. Six aspects, including clinical signs, genetic spectrum, cognitive competence, MRI features, potential biochemical indicators and nerve electrophysiological factors, will be assessed in detail. This study will observe clinical manifestations and disease severity based on different molecular mechanisms, including oxidative stress, cholesterol metabolism and microtubule dynamics, all of which have been proposed as potential treatment targets or modalities. The analysis will also assess disease progression in different types of HSPs and cellular pathways with a longitudinal study using t tests and χ2 tests.Ethics and disseminationThe study was granted ethics committee approval by the first affiliated hospital of Fujian Medical University (MRCTA, ECFAH of FMU (2019)194) in 2019. Findings will be disseminated via presentations and peer-reviewed publications. Dissemination will target different audiences, including national stakeholders, researchers from different disciplines and the general public.Trial registration numberNCT04006418.

Background Hereditary spastic paraplegias (HSP) is a heterogeneous group of rare neurodegenerative disorders affecting the corticospinal tracts. To date, more than 78 HSP loci have been mapped to cause HSP. However, both the clinical and mutational spectrum of Chinese patients with HSP remained unclear. In this study, we aim to perform a comprehensive analysis of clinical phenotypes and genetic distributions in a large cohort of Chinese HSP patients, and to elucidate the primary pathogenesis in this population. Methods We firstly performed next-generation sequencing targeting 149 genes correlated with HSP in 99 index cases of our cohort. Multiplex ligation-dependent probe amplification testing was further carried out among those patients without known disease-causing gene mutations. We simultaneously performed a retrospective study on the reported patients exhibiting HSP in other Chinese cohorts. All clinical and molecular characterization from above two groups of Chinese HSP patients were analyzed and summarized. Eventually, we further validated the cellular changes in fibroblasts of two major spastic paraplegia (SPG) patients (SPG4 and SPG11) in vitro. Results Most patients of ADHSP (94%) are pure forms, whereas most patients of ARHSP (78%) tend to be complicated forms. In ADHSP, we found that SPG4 (79%) was the most prevalent, followed by SPG3A (11%), SPG6 (4%) and SPG33 (2%). Subtle mutations were the common genetic cause for SPG4 patients and most of them located in AAA cassette domain of spastin protein. In ARHSP, the most common subtype was SPG11 (53%), followed by SPG5 (32%), SPG35 (6%) and SPG46 (3%). Moreover, haplotype analysis showed a unique haplotype was shared in 14 families carrying c.334C > T (p.R112*) mutation in CYP7B1 gene, suggesting the founder effect. Functionally, we observed significantly different patterns of mitochondrial dynamics and network, decreased mitochondrial membrane potential (Δψm), increased reactive oxygen species and reduced ATP content in SPG4 fibroblasts. Moreover, we also found the enlargement of LAMP1-positive organelles and abnormal accumulation of autolysosomes in SPG11 fibroblasts. Conclusions Our study present a comprehensive clinical spectrum and genetic landscape for HSP in China. We have also provided additional evidences for mitochondrial and autolysosomal-mediated pathways in the pathogenesis of HSP. Electronic supplementary material The online version of this article (10.1186/s13024-018-0269-1) contains supplementary material, which is available to authorized users.

Background Amyotrophic lateral sclerosis (ALS) is a devastating motor neuron disease characterized by substantial clinical and genetic heterogeneity. Thus far, only a few TARDBP-ALS families have been reported in China, and no mutation analysis has been reported in south-eastern China. Methods Seven index cases from ALS families negative for SOD1 and FUS mutations were screened by Sanger sequencing for TARDBP gene exons 2-6. TARDBP exon 6 was analysed in 215 sporadic ALS patients. Results Two TARDBP mutations in exon 6 (p.M337 V and p.G348C) were identified in 5 unrelated families. Four of these 5 families carried the same p.M337 V mutation (family 1II3, family 2II6, family 3II4, and family 4II4), and the p.G348C mutation was identified in family 5 (II5). Among the 215 sporadic patients, only a single nucleotide polymorphism (p.A366A) was detected in 5 patients, and no responsible mutation was identified. Among the TARDBP-linked familial ALS patients, the average age of onset was 57.0 ± 4.7 years, and a trend towards higher rates of bulbar (50.0%, 6/12) onset and upper limb (41.7%, 5/12) onset than lower rates of limb onset (8.3%, 1/12) was observed. Furthermore, ALS patients with TARDBP mutations showed a benign disease course, and the average survival was 106.5 ± 41.8 months (n = 8). Conclusions We found a high frequency of the TARDBP p.M337 V mutation in familial ALS in south-eastern China. The TARDBP-linked ALS patients showed a benign disease course and prolonged survival. Electronic supplementary material The online version of this article (10.1186/s12883-018-1028-1) contains supplementary material, which is available to authorized users.

Background: Progressive myoclonus epilepsies (PMEs) comprise a group of rare genetic disorders characterized by action myoclonus, epileptic seizures, and ataxia with progressive neurologic decline. Due to clinical and genetic heterogeneity of PMEs, it is difficult to decide which genes are affected. The aim of this study was to report an action myoclonus with or without renal failure syndrome (EPM4) family and summarize the clinical and genetic characteristics of all reported EPM4 patients. Methods: In the present study, targeted next-generation sequencing (NGS) was applied to screen causative genes in a Chinese PME family. The candidate variant was further confirmed by cosegregation analysis and further functional analysis, including the reverse transcription polymerase chain reaction and Western blot of the proband’s muscle. Moreover, literature data on the clinical and mutational features of all reported EPM4 patients were reviewed. Results: The gene analysis revealed a novel homozygous splicing mutation (c.995-1G>A) of the SCARB2 gene in two brothers. Further functional analysis revealed that this mutation led to loss function of the SCARB2 protein. The classification of the candidate variant, according to the American College of Medical Genetics and Genomics standards and guidelines and functional analysis, was pathogenic. Therefore, these two brothers were finally diagnostically confirmed as EPM4. Conclusions: These present results suggest the potential for targeted NGS to conduct a more rapid and precise diagnosis for PME patients. A literature review revealed that mutations in the different functional domains of SCARB2 appear to be associated with the phenotype of EPM4. Key words: Progressive Myoclonus Epilepsies; Progressive Myoclonus Epilepsy with or without Renal Failure; SCARB2 Gene; Targeted Next-Generation Sequencing

Primary familial brain calcification (PFBC) is a neuropsychiatric disorder characterized by bilateral cerebral calcification with diverse neurologic or psychiatric symptoms. Recently, XPR1 variation has accounted for PFBC as another new causative gene. However, little is known about the distribution and basic function of XPR1 and its interaction with the other three pathogenic genes for PFBC (SLC20A2, PDGFRB and PDGFB). The aim of this study was to further clarify the role of XPR1 in PFBC brain pathology. As a result, gene expression profiles showed that XPR1 mRNA was widely expressed throughout the mouse brain. Cerebellum and striatum, most commonly affected in PFBC, contained a higher level of XPR1 protein than other brain regions. Additionally, XPR1 deficiency seriously affected Pi efflux and XPR1 mutations seemed to have an effect through haploinsufficiency mechanism. The immunoprecipitation and immunohistochemical studies demonstrated that XPR1 could interact with PDGFRB and might form a complex on the cell membrane. These results suggested that XPR1 played a fundamental role in the maintenance of cellular phosphate balance in the brain. This provided us with a novel perspective on understanding the pathophysiology of PFBC. The expression networks and interaction with the known pathogenic genes could shed new light on additional candidate genes for PFBC.

The development of clinical trials for Duchenne muscular dystrophy (DMD) in China faces many challenges due to limited information about epidemiological data, natural history and clinical management. To provide these detailed data, we developed a comprehensive database based on registered DMD patients from South China and analysed their clinical and mutational characteristics. The database included DMD registrants confirmed by clinical presentation, family history, genetic detection, prognostic outcome, and/or muscle biopsy. Clinical data were collected by a registry form. Mutations of dystrophin were detected by multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing. Currently, 132 DMD patients from 128 families in South China have been registered, and 91.7% of them were below 10 years old. In mutational detection, large deletions were the most frequent type (57.8%), followed by small deletion/insertion mutations (14.1%), nonsense mutations (13.3%), large duplications (10.9%), and splice site mutations (3.1%). Clinical analysis revealed that most patients reported initial symptoms between 1 and 3 years of age, but the diagnostic age was more frequently between 6 and 8 years. 81.4% of patients were ambulatory. Baseline cardiac assessments at diagnosis were conducted in 39.4% and 29.5% of patients by echocardiograms and electrocardiograms, respectively. Only 22.7% of registrants performed baseline respiratory assessments. A small numbers of patients (20.5%) were treated with glucocorticoids. 13.3% of patients were eligible for stop codon read-through therapy, and 48.4% of patients would potentially benefit from exon skipping. The top five exon skips applicable to the largest group of registrants were skipping of exons 51 (14.8% of total mutations), 53 (12.5%), 45 (7.0%), 55 (4.7%), and 44 (3.9%). In conclusion, our database provided information on the natural history, diagnosis and management status of DMD in South China, as well as potential molecular therapies suitable for these patients. This comprehensive database will promote future experimental therapies in China.

Four causative genes, including solute carrier family 20 member 2 (SLC20A2), platelet-derived growth factor receptor b (PDGFRB), platelet-derived growth factor b (PDGFB)and xenotropic and polytropic retrovirus receptor 1 (XPR1), have been identified to cause primary familial brain calcification (PFBC). However, PDGFRB mutations seem to be quite rare and no PDGFRB mutations have been reported in Chinese PFBC patients. A total of 146 PFBC patients including 12 families and 134 sporadic patients were recruited in this study. All of them were previously tested negative for the SLC20A2. Mutational analyses of the entire exons and exon-intron boundaries of PDGFRB were carried out by direct gene sequencing. In silico analyses of the identified variants were conducted using Mutation Taster, PolyPhen-2 and Sorts Intolerant From Tolerant. Two heterozygous variants, c.3G>A and c.2209G>A, of the PDGFRB gene were revealed in two PFBC families, respectively. These two variants were not observed in 200 healthy controls. The variant c.3G>A was located in exon 2 and affected the initiation codon of the PDGFRB gene. The variant c.2209G>A resulted in amino-acid substitutions of aspartic acid to asparagine at position 737. Both of these two variants co-segregated with the disease phenotype (variant carriers in Family 1: I1, II2 and II3; variant carriers in Family 2: I2 and II8), suggesting a pathogenic impact of these variants. The prevalence of PDGFRB mutations in Chinese PFBC patients seems to be quite low, indicating that PDGFRB is not a major causative gene of PFBC in Chinese population.

// Xiang Lin 1, * , Jin-Jing Li 1, * , Wen-Jing Qian 2, * , Qi-Jie Zhang 1 , Zhong-Feng Wang 2 , Ying-Qian Lu 1 , En-Lin Dong 1 , Jin He 1 , Ning Wang 1 , Li-Xiang Ma 3 and Wan-Jin Chen 1, 4 1 Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou 350005, China 2 Institutes of Brain Science, Institute of Neurobiology, State Key Laboratory of Medical Neurobiology, Collaborative Innovation Center for Brain Science, Fudan University, Shanghai 200032, China 3 Department of Anatomy, Histology & Embryology, Shanghai Medical College, Fudan University, Shanghai 200032, China 4 Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou 350005, China * These authors have contributed equally to this work Correspondence to: Wan-Jin Chen, email: wanjinchen75@fjmu.edu.cn Li-Xiang Ma, email: lxma@fudan.edu.cn Keywords: spinal muscular atrophy (SMA), induced pluripotent stem cells (iPSCs) derived enriched motor neurons (MNs), survival motor neuron (SMN) protein, neurite outgrowth, neuronal activity Received: August 20, 2016 Accepted: December 27, 2016 Published: January 31, 2017 ABSTRACT Spinal muscular atrophy (SMA) is a devastating motor neuron disease caused by mutations of the survival motor neuron 1 ( SMN1 ) gene. SMN2 , a paralogous gene to SMN1 , can partially compensate for the loss of SMN1 . On the basis of age at onset, highest motor function and SMN2 copy numbers, childhood-onset SMA can be divided into three types (SMA I-III). An inverse correlation was observed between SMN2 copies and the differential phenotypes of SMA. Interestingly, this correlation is not always absolute. Using SMA induced pluripotent stem cells (iPSCs), we found that the SMN was significantly decreased in both SMA III and SMA I iPSCs derived postmitotic motor neurons (pMNs) and γ-aminobutyric acid (GABA) neurons. Moreover, the significant differences of SMN expression level between SMA III (3 copies of SMN2 ) and SMA I (2 copies of SMN2 ) were observed only in pMNs culture, but not in GABA neurons or iPSCs. From these findings, we further discovered that the neurite outgrowth was suppressed in both SMA III and SMA I derived MNs. Meanwhile, the significant difference of neurite outgrowth between SMA III and SMA I group was also found in long-term cultures. However, significant hyperexcitability was showed only in SMA I derived mature MNs, but not in SMA III group. Above all, we propose that SMN protein is a major factor of phenotypic modifier. Our data may provide a new insight into recognition for differential phenotypes of SMA disease.

Charcot-Marie-Tooth disease type 2 (CMT2) is a clinically and genetically heterogeneous inherited neuropathy. Although new causative and disease-associated genes have been identified for CMT2 in recent years, molecular diagnoses are still lacking for a majority of patients. We here studied a cohort of 35 CMT2 patients of Chinese descent, using whole exome sequencing to investigate gene mutations and then explored relationships among genotypes, clinical features, and mitochondrial DNA levels in blood as assessed by droplet digital PCR. We identified pathogenic variants in 57% of CMT2 patients. The most common genetic causes in the cohort were MFN2 mutations. Two patients with typical CMT phenotype and neuromyotonia were detected to harbor compound heterozygous variations in the HINT1 gene. In conclusion, our work supports that the molecular diagnostic rate of CMT2 patients can be increased via whole exome sequencing, and our data suggest that assessment of possible HINT1 mutations should be undertaken for CMT2 patients with neuromyotonia.

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease with a wide range of survival times. We aimed to explore prognostic factors related to short survival based on clinical features and plasma metabolic signatures using surface-enhanced Raman spectroscopy (SERS). One hundred and thirty-eight sporadic ALS cases were enrolled serially, including 62 for the short-duration group (≤3 years) and 76 for the long-duration group (3 years). Multivariate analysis showed that an older age of onset (60 years; odds ratio [OR] = 3.98, 95% CI: 1.09-14.53), lower body mass index (BMI) (18.5; OR = 6.80, 95% CI: 1.36-33.92), and lower ALSFRS-R score (35; OR = 6.03, 95% CI: 1.42-25.63) were associated with higher odds of tracheotomy or death, while a higher uric acid (UA) level showed a protective effect (356.36 μmol/L; OR = 0.19, 95% CI: 0.05-0.73). SERS analysis showed significant differences between the two groups, and pathway analysis highlighted five main metabolic pathways, including metabolisms of glutathione, pyrimidine, phenylalanine, galactose, and phenylalanine-tyrosine-tryptophan biosynthesis. In conclusion, age of onset, BMI, ALSFRS-R score and UA, together with dysregulation of glucose, amino acid, nucleic acid, and antioxidant metabolism contributed to disease progression, and are therefore potential therapeutic targets for ALS.

Introduction X-linked adrenoleukodystrophy (ALD) and Zellweger spectrum disorder (ZSD) are peroxisomal diseases characterized by accumulation of very long chain fatty acids (VLCFA) in plasma and tissues. Considering the wide variability of manifestation, patients of ALD and atypical ZSD are easily misdiagnosed as hereditary spastic paraplegia (HSP) on their clinical grounds. Here, we aimed to determine the frequency of peroxisome diseases and compare their phenotypic spectra with HSP. Methods We first applied targeted sequencing in 120 pedigrees with spastic paraplegia, and subsequently confirmed 74 HSP families. We then performed whole exome sequencing for the probands of the 46 remaining pedigrees lacking known HSP-causal genes. Detailed clinical, radiological features, and VLCFA analyses are presented. Results Seven ALD pedigrees with ABCD1 mutations and one ZSD family harboring bi-allelic mutations of PEX16 were identified. Clinically, in addition to spastic paraplegia, four ALD probands presented adrenocortical insufficiency, and the ZSD proband and her affected sister both developed thyroid problems. VLCFA analysis showed that ratios of C24/C22 and C26/C22 were specifically increased in ALD probands. Moreover, three ALD probands and the ZSD proband had abnormalities in brain or spinal imaging. Conclusions Our study reports the first ZSD case in China that manifested spastic paraplegia, and emphasized the finding that peroxisomal diseases comprise a significant proportion (8/120) of spastic paraplegia entities. These findings extend our current understanding of the ALD and ZSD diseases.

Purpose Tuberous sclerosis complex (TSC) is characterized by the development of hamartomas in multiple organ systems. This study attempted to screen mutations and to investigate the mutation distribution and related phenotypes including epilepsy of Chinese TSC patients. Methods We performed the genotypic analysis of TSC1 and TSC2 genes in 77 unrelated Chinese TSC patients using direct Sanger sequencing and Multiplex ligation-dependent probe amplification (MLPA). Results Mutations were identified in a total of 63 (81.8%) cases, including 18 TSC1 mutations (8 nonsense mutations, 6 frameshift, 1 in-frame shift, 1 missense and 2 splice-site) and 45 TSC2 mutations (13 missense, 3 nonsense, 6 splicing, 6 in-frame shift,12 frameshift mutations and 5 large deletions). Large deletions were presented exclusively in TSC2 gene, accounting for 7.9% of all mutations in this study. Fourteen novel mutations were identified in this study. Conclusions Epilepsy occurs in approximately 75.3% (58/77) of patients. Hypomelanotic macules occurred significantly more often in patients with TSC2 mutations and cases with TSC1/TSC2 mutations had a significantly higher frequency of cortical nodule than patients with no mutations identified. Overall, our data expands the spectrum of mutations associated with the TSC loci and will be of value to the genetic counseling in patients with the disease.

Intermediate Charcot-Marie-Tooth (CMT) disease is a heterogeneous group of inherited neuropathies characterized by progressive muscle weakness and atrophy of the distal extremities, distal sensory loss. There were still a large proportion of causative genes for intermediate CMT failed to be identified. Here, using whole-exome sequencing technique, we identified two novel missense mutations in ATP1A1 gene, c.620C>T (p.S207F) and c.2629G>A (p.G877S), in two Chinese CMT families. Further functional analysis revealed that these mutations led to the loss function of the ATP1A1 protein. The two mutations did not affect the levels of messenger RNA but possessed a damaging effect on ATP1A1 protein expression and they downregulated the protein levels of ATP1A1 by promoting its proteasome degradation. Taken together, we confirmed ATP1A1 as a novel causative gene for intermediate CMT.

Primary familial brain calcification (PFBC) is a rare neurological disorder. Mutations in five genes (SLC20A2, PDGFRB, PDGFB, XPR1, and MYORG) have been linked to PFBC. Here, we used SYBR green-based real-time quantitative polymerase chain reaction (PCR) assay and denaturing high-performance liquid chromatography analysis to detect copy number variants (CNVs) in 20 unrelated patients with PFBC, negatively sequenced for the five known genes. We identified three deletions in SLC20A2, including a large de novo full gene deletion and two exonic deletions confined to exon 2 and exon 6, respectively. Subsequent linked-read whole-genome sequencing of the patient with the large deletion showed a 1.7 Mb heterozygous deletion which removed the entire coding regions of SLC20A2 as well as 21 other genes. In the family with a deletion of exon 6, a missense variant of uncertain significance (SLC20A2: p.E267Q) also co-segregated with the disease. Functional assay showed the deletion could result in significantly impaired phosphate transport, whereas the p.E267Q variant did not. Our results confirm that deletion in SLC20A2 is a causal mechanism for PFBC and highlight the importance of functional study for classifying a rare missense variant as (likely) pathogenic.

The human iPS cell line, hiPS-SPG76 (FJMUi001-A), derived from skin fibroblasts from a 42-year-old male hereditary spastic paraplegia patient carrying compound heterozygous p.P498L (c.1493C > T) and p.R618W (c.1852C > T) mutations in the CAPN1 gene, was generated by non-integrative reprogramming vectors encoding OCT3/4, SOX2, KLF4, and c-MYC. The established hiPS-SPG76 was free of genomically integrated reprogramming genes, had a normal karyotype, expressed pluripotency markers, and had capacity to form three germ layers in vitro and in vivo. This generated hiPS cell line offers a useful resource to study the pathogenesis of SPG76.

Autosomal recessive optic neuropathies (IONs) are extremely rare disorders affecting retinal ganglion cells and the nervous system. RTN4IP1 has recently been identified as the third known gene associated with the autosomal recessive ION optic atrophy 10 (OPA10). Patients with RTN4IP1 mutations show early-onset optic neuropathy that can be followed by additional neurological symptoms such as seizures, ataxia, mental retardation, or even severe encephalopathy. Here, we report two siblings from a Chinese family who presented with early-onset optic neuropathy, epilepsy, and mild intellectual disability. Using whole exome sequencing combined with Sanger sequencing, we identified novel compound heterozygous RTN4IP1 mutations (c.646G > A, p.G216R and c.1162C > T, p.R388X) which both co-segregated with the disease phenotype and were predicted to be disease-causing by prediction software. An in vitro functional study in urine cells obtained from one of the patients revealed low expression of the RTN4IP1 protein. Our results identify novel compound heterozygous mutations in RTN4IP1 which are associated with OPA10, highlighting the frequency of RTN4IP1 mutations in human autosomal recessive IONs. To our knowledge, this is the first report of RTN4IP1 carriers from China.

Introduction The pathophysiologic mechanism of paroxysmal kinesigenic dyskinesia (PKD) is largely unclear. Basal ganglia-thalamo-cortical circuit involvement is thought to underlie PKD pathophysiology. However, microstructural alternations in the motor circuit of PKD require further elucidation. Methods Diffusion tensor imaging and high-resolution T1-weighted imaging were performed on 30 PKD patients (15 PRRT2 carriers, 15 PRRT2 non-carriers) and 15 matched healthy controls. Tract-based spatial statistics were conducted on diffusion indices to examine microstructural integrity of white matter. Voxel-based morphometry analysis was used to examine volumetric changes of gray matter. Multiple regression was employed to test the contribution of demography, disease duration, and PRRT2 status to pathological changes in brain structure. Results Six (including two novel) PRRT2 mutations were identified in PKD patients who exhibited significantly reduced mean diffusivity mainly along the left corticospinal tract, and reduced gray matter volume in pre-supplementary motor area (preSMA) and right opercular part of inferior frontal gyrus (IFGoperc), compared to healthy controls. Both gray matter volume reductions in preSMA and diffusion indices of abnormal white matter negatively correlated with disease duration. Genotype-phenotype analysis revealed that PRRT2 mutation carriers had earlier onset age, longer attacks, and a larger proportion of bilateral symptoms than non-carriers. Conclusions We observed that PRRT2 mutations were associated with disease severity, while neuroanatomical abnormality was associated with disease duration in patients with PKD. Aberrant microstructural changes in preSMA and IFG areas, independent of mutation status, point to dysregulated motor inhibition in patients and provide new insights into neurobiological mechanisms underlying motor symptoms of PKD.

Demyelinating Charcot-Marie-Tooth disease (CMT) is the most common subtype of CMT. It is caused mainly by 17p11.2 heterozygous duplication, but also by mutations in more than 20 genes which affect development and function of Schwann cells. To investigate the profile of genes mutated and clinical features in demyelinating CMT of Chinese descent, we collected a cohort of 44 demyelinating CMT patients and screened them using multiplex ligation-dependent probe amplification (MLPA) and targeted next-generation sequencing (NGS) technology. The MLPA technology revealed that 77.3% demyelinating CMT patients harbored 17p11.2 heterozygous duplication and 6.8% patients harbored heterozygous deletion of exon 6 of MPZ gene, that was further confirmed a novel c.674_675insA mutation in MPZ gene. In the patients with 17p12 heterozygous duplication, 3 sets of independent families were discordant for the CMT phenotype within the same family. The targeted NGS technology revealed that 6 candidate mutations including 1 previously reported mutation (GDAP1: c.571C>T) and 5 novel mutations (SBF2: c.415T>C, c.619G>T, c.1258A>G; GDAP1: c.589delC; PMP22: c.318delT) were found. In conclusion, combined MLPA technique with targeted NGS, the demyelinating CMT genetic diagnostic success rate was increased.

Spinocerebellar ataxia type 3 (SCA3), the most common subtype of SCA worldwide, is caused by mutation of CAG repeats expansion in ATXN3. Body mass index (BMI) is an important modulatory factor in the progression of neurodegenerative disorders such as Huntington disease and amyotrophic lateral sclerosis. However, its relevance in SCA3 is not well understood. In this study, BMI was investigated in 134 molecularly confirmed SCA3 patients and 136 healthy controls from China. The multivariable linear regression models were performed to establish the putative risk factors for BMI, and whether BMI could affect the severity of ataxia. We found that BMI was significantly lower in the case group than that in the control group. The age at onset (positive correlation) and severity of ataxia (negative correlation) were the risk factors affecting BMI. Conversely, BMI along with the disease duration, the age at onset, and the numbers of CAG repeats could also have influence on the severity of ataxia. In conclusion, SCA3 patients had lower BMI than matched controls and BMI is a predictor of disease progression in SCA3. Nutritional intervention to promote weight gain could be a promising strategy to impede SCA3 progression.

Summary Primary familial brain calcification (PFBC) is a genetically heterogeneous disorder characterized by bilateral calcifications in the basal ganglia and other brain regions. The genetic basis of this disorder remains unknown in a significant portion of familial cases. Here, we reported a recessive causal gene, MYORG , for PFBC. Compound heterozygous or homozygous mutations of MYORG co-segregated completely with PFBC in six families, with logarithm of odds (LOD) score of 4.91 at the zero recombination fraction. In mice, Myorg mRNA was expressed specifically in S100β-positive astrocytes, and knockout of Myorg induced the formation of brain calcification at 9 months of age. Our findings provide strong evidence that loss-of-function mutations of MYORG cause brain calcification in humans and mice.

Spinal muscular atrophy (SMA) is an autosomal recessive genetic disorder caused by survival motor neuron (SMN) protein deficiency leading the loss of motor neurons in the anterior horns of the spinal cord and brainstem. More than 95% of SMA patients are attributed to the homozygous deletion of survival motor neuron 1 (SMN1) gene, and approximately 5% are caused by compound heterozygous with a SMN1 deletion and a subtle mutation. Here, we identified a rare variant c.835-5T>G in intron 6 of SMN1 in a patient affected with type I SMA. We analyzed the functional consequences of this mutation on mRNA splicing in vitro. After transfecting pCI-SMN1, pCI-SMN2, and pCI-SMN1 c.835-5T>G minigenes into HEK293, Neuro-2a, and SHSY5Y cells, reverse transcription polymerase chain reaction (RT-PCR) was performed to compare the splicing effects of these minigenes. Finally, we found that this mutation resulted in the skipping of exon 7 in SMN1, which confirmed the genetic diagnosis of SMA.

Background Spinocerebellar ataxia type 3 (SCA3) is the most common subtype of SCAs worldwide. SCA3 homozygote is defined as expanded CAG repeats in both alleles that might exhibit severe phenotype due to gene dosage effect. However, a study on the systematic comparison of clinical phenotypes between homozygotes and heterozygotes to indicate these verity of phenotypes of homozygotes is still lacking. Methods A total of 14 SCA3 homozygotes (3 Chinese participants and 11 participants from various ethnicity in different published studies) and 143 Chinese heterozygotes of SCA3 were recruited for this study. The 95% confidence intervals (CIs) of age at onset and disease severity expected from heterozygous patients were analyzed to detect the phenotypic differences between homozygotes and heterozygotes. Results Almost all the homozygotes (13 of 14) were found to present a significant earlier age at onset compared with heterozygotes, because age at onset of most homozygotes was lower than the 95% CIs of age at onset of heterozygotes. Also, the clinical severity in most of the homozygotes (3 of 4) with identified clinical phenotypes was higher than the 95% CIs of severity in heterozygotes, indicating more severe clinical phenotypes in SCA3 homozygotes. Conclusions The homozygosity for SCA3 could lead to an earlier age of onset and putative severe clinical features. The findings of the present study suggested an influence of gene dosage on SCA3 phenotypes.

Background: Mitochondrial dysfunction is linked to the pathogenesis of Parkinson's disease (PD). However, the precise role of mitochondrial DNA (mtDNA) variations is obscure. On the other hand, mtDNA haplogroups have been inconsistently reported to modify the risk of PD among different population. Here, we try to explore the relationship between mtDNA haplogroups and sporadic PD in a Han Chinese population. Methods: Nine single-nucleotide polymorphisms, which define the major Asian mtDNA haplogroups (A, B, C, D, F, G), were detected via polymerase chain reaction-restriction fragment length polymorphism or denaturing polyacrylamide gel electrophoresis in 279 sporadic PD patients and 510 matched controls of Han population. Results: Overall, the distribution of mtDNA haplogroups did not show any significant differences between patients and controls. However, after stratification by age at onset, the frequency of haplogroup B was significantly lower in patients with early-onset PD (EOPD) compared to the controls (odds ratio [ OR ] =0.225, 95% confidence interval [ CI ]: 0.082-0.619, P = 0.004), while other haplogroups did not show significant differences. After stratification by age at examination, among subjects younger than 50 years of age: Haplogroup B also showed a lower frequency in PD cases ( OR = 0.146, 95% CI : 0.030-0.715, P = 0.018) while haplogroup D presented a higher risk of PD ( OR = 3.579, 95% CI : 1.112-11.523, P = 0.033), other haplogroups also did not show significant differences in the group. Conclusions: Our study indicates that haplogroup B might confer a lower risk for EOPD and people younger than 50 years in Han Chinese, while haplogroup D probably lead a higher risk of PD in people younger than 50 years of age. In brief, particular Asian mtDNA haplogroups likely play a role in the pathogenesis of PD among Han Chinese.

Background: Spinocerebellar ataxia type 3 (SCA3), which is the most common subtype of SCA worldwide, exhibits common neuropsychological symptoms such as depression. However, the contribution of depression to the severity of SCA3 has not yet been thoroughly investigated. Methods: The present study investigated the prevalence of depression using Beck depression inventory in 104 molecularly confirmed SCA3 patients from China. The putative risk factors for depression and whether the depression could affect the severity of ataxia were established by multivariable linear regression models. Results: The frequency of depression in the study subjects was 57.69% (60/104), which was higher than that in SCA3 patients from a subset of other populations. The gender (p = 0.03) and severity (p < 0.01) of ataxia were those risk factors that could affect depression. Conversely, depression (p < 0.01) together with the duration (p < 0.01) of SCA3 could also play a positive role in the severity of ataxia. Conclusions: The extremely common depression results from motor disability caused by ataxia; it also affects the disease severity of SCA3. These findings suggested that depression was a part of neurodegeneration in SCA3 and necessitated intensive focus and interventions while caring for SCA3 patients.

Background: To assess the safety and efficacy of rasagiline for the treatment of Parkinson's disease (PD) among individuals currently receiving levodopa. Methods: A systematic literature search was conducted to identify randomised controlled trials (RCT) comparing rasagiline with placebo/no treatment in individuals with PD currently receiving levodopa. Outcome measures included improvement in motor functions; symptomatic improvement; improvement in quality of life; adverse effects. Random-effect meta-analytical techniques were conducted for the outcome measure and subgroup analyses. Results: Three RCTs were included (n = 1002). The results showed significantly greater improvements in daily ‘on' time without dyskinesia in levodopa-treated participants with idiopathic PD receiving 1 mg/day rasagiline compared to placebo (n = 712, 2 RCTs, MD 0.80, CI 0.45 to 1.15; p < 0.00001), and significantly greater improvements in Unified Parkinson's Disease Rating Scale motor performance scores during ‘on' time in participants receiving 0.5-1 mg/day rasagiline (0.5 mg/day: n = 282, MD -2.91, CI -4.59 to -1.23; p = 0.0007; 1 mg/day: n = 712, 2 RCTs, MD -2.91, CI -4.02 to -1.80; p < 0.00001). There were no significant differences in adverse effects. Conclusion: 0.5 to 1 mg/day rasagiline in addition to levodopa is a safe and well-tolerated combination therapy for individuals with Parkinson's disease.

Paroxysmal kinesigenic dyskinesia (PKD) and myotonia congenita (MC) are independent disorders that share some clinical features. We aimed to investigate the sequences of PRRT2 and CLCN1 in a proband diagnosed with PKD and suspected MC. Clinical evaluation and auxiliary examinations were performed. Direct sequencing of the entire coding regions of the PRRT2 and CLCN1 genes was conducted. Haplotype analysis confirmed the relationships among the family members. The proband suffered choreoathetosis attacks triggered by sudden movements, and lower-limb weakness and stiffness that worsened in cold weather. Carbamazepine monotherapy completely controlled his choreoathetosis and significantly relieved his limb weakness and stiffness. His father, when young, had similar limb stiffness, while his mother and brother were asymptomatic. Genetic analysis revealed that the proband and his father harbored a PRRT2 c.649dupC mutation, and CLCN1 c.1723C>T and c.2492A>G mutations. His brother carried only the two CLCN1 mutations. None of these mutations were identified in his mother and 150 unrelated controls. This is the first report showing the coexistence of PRRT2 and CLCN1 mutations. Our results also indicate that both the PRRT2 and CLCN1 genes need to be screened if we fail to identify PRRT2 mutations in PKD patients or CLCN1 mutations in MC patients.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations ( c.82G > A p.D28N , c.185T > C p.L62P , c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G > A ) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2 , which facilitates the understanding of the genotype–phenotype correlation of IBGC.

Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 ( IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711+1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.

Background Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. Methods Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. Results Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype–phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. Conclusion The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal movement disorder and is often misdiagnosed clinically as epilepsy. Using whole-exome sequencing followed by Sanger sequencing, we identified three truncating mutations within PRRT2 (NM_145239.2) in eight Han Chinese families with histories of paroxysmal kinesigenic dyskinesia: c.514_517delTCTG (p.Ser172Argfs*3) in one family, c.649dupC (p.Arg217Profs*8) in six families and c.972delA (p.Val325Serfs*12) in one family. These truncating mutations co-segregated exactly with the disease in these families and were not observed in 1,000 control subjects of matched ancestry. PRRT2 is a newly discovered gene consisting of four exons encoding the proline-rich transmembrane protein 2, which encompasses 340 amino acids and contains two predicted transmembrane domains. PRRT2 is highly expressed in the developing nervous system, and a truncating mutation alters the subcellular localization of the PRRT2 protein. The function of PRRT2 and its role in paroxysmal kinesigenic dyskinesia should be further investigated.

The aim of this study was to determine the clinical features and frequencies of genetic subtypes in a series of patients with Charcot-Marie-Tooth (CMT) disease from Eastern China. Patients were divided into three subtypes, CMT1, CMT2 and hereditary neuropathy with liability to pressure palsy (HNPP), according to their electrophysiological manifestations. Multiplex ligation-dependent probe analysis (MLPA) was performed to detect duplications/deletions in the PMP22 gene. The coding regions and splice sites of the GJB1, MPZ, MFN2 and GDAP-1 genes were determined by direct sequencing. Among the 148 patients in the study, 37.2% of the cases had mutations in genes assessed. The mutation detection rate was higher in patients with family histories than in spontaneous cases. PMP22 duplication (13.5%) was predominant in this group of patients, followed by PMP22 deletion (11.5%), and point mutations in GJB1 (8.8%), MPZ (2.0%) and MFN2 (0.7%). Three novel mutations (c.151T>C and c.310 A>G in GJB1 and c.1516 C>G in MFN2) were detected. A small deletion in PMP22 exon 4 was detected in a patient with severe CMT1. Genetic tests have great value in CMT patients with family histories. The frequency of PMP22 duplications was lower in Asian patients than in others. We suggest that genetic testing strategies in CMT patients should be primarily based on electromyography data.

Dopa-responsive dystonia is a rare hereditary movement disorder caused by mutations in the guanosine triphosphate cyclohydrolase 1 ( GCH1) gene. This disease typically manifests in dystonia, with marked diurnal fluctuation and a dramatic response to levodopa. However, growth retardation in dopa-responsive dystonia has rarely been reported, and the etiology of short stature is not clarified. Here, we report a 14-year-old patient with extremities dystonia and short stature. Treatment with levodopa relieved his symptoms and resulted in a height increase. We also investigated the mutation in GCH1 and the etiology of short stature in this case. Sequence analysis of GCH1 revealed a novel mutation (c.695G>T). Laboratory examinations and imaging confirmed the diagnosis of growth hormone deficiency. We conclude that our case reveals a rare feature for dopa-responsive dystonia and suggests a possible pathogenic link between growth hormone deficiency and dopa-responsive dystonia. We recommend levodopa as the first choice for treating dopa-responsive dystonia in children with growth hormone deficiency.

The Bruno et al.1 criteria are commonly used to diagnose paroxysmal kinesigenic dyskinesia (PKD), listed as follows: The authors thank the participants for taking part in this study.

Many major inherited neurological disorders are characterized by early childhood onset, high lethality rate, and the absence of effective treatments. A poor understanding of the underlying mechanisms of such disorders is partly because of the scarcity of patient-specific samples. In this study, we cultured the urine sediments of such patients, aiming to explore the capacity of urine cell cultures to obtain specimens from patients suffering from rare inherited neurological diseases. We collected fresh urine from a variety of neurogenetic patients; cultured the specimens; generated different urine cell lines; and classified these cell lines through morphology, reverse transcription-PCR, and immunofluorescence. We then used these cell lines to detect the affected genes in spinal muscular atrophy and Duchenne muscular dystrophy. We successfully established cell lines from patients with spinal muscular atrophy, Duchenne muscular dystrophy, paroxysmal kinesigenic dyskinesia, and Wilson's disease. All established cell lines consisted of urinary tract epithelial cells and podocytes, and had the same gene defects as the blood specimens. Urine cell culture is thus a new, simple, and noninvasive avenue for getting patient-specific samples not only for genetic diagnosis, but also for storing the samples from patients with rare neurological inherited diseases.

To investigate chloride channel 1 (CLCN1) gene mutation and clinical features of 2 Chinese patients with myotonia congenita.Clinical data of a patient from a family affected with myotonia congenita in addition with a sporadic patient from Fujian province were analyzed. Exons of CLCN1 gene were amplified and sequenced.The proband from the affected family was found to carry a c.1024GA heterozygous missense mutation in exon 8, whilst the sporadic patient has carried a c.1292CT heterozygous missense mutation in exon 11.Detection of CLCN1 gene mutation is an effective method for the diagnosis of myotonia congenita. Exon 8 of CLCN1 gene may be a mutational hotspot in Chinese patients with myotonia congenita.