Search

Sickle cell disease (SCD) is an inherited monogenic disorder and the most common severe hemoglobinopathy in the world. SCD is characterized by a point mutation in the β-globin gene, which results in hemoglobin (Hb) S production, leading to a variety of mechanistic and phenotypic changes within the sickle red blood cell (RBC). In SCD, the sickle RBCs are the root cause of the disease and they are a primary source of oxidative stress since sickle RBC redox state is compromised due to an imbalance between prooxidants and antioxidants. This imbalance in redox state is a result of a continuous production of reactive oxygen species (ROS) within the sickle RBC caused by the constant endogenous Hb autoxidation and NADPH oxidase activation, as well as by a deficiency in the antioxidant defense system. Accumulation of non-neutralized ROS within the sickle RBCs affects RBC membrane structure and function, leading to membrane integrity deficiency, low deformability, phosphatidylserine exposure, and release of micro-vesicles. These oxidative stress-associated RBC phenotypic modifications consequently evoke a myriad of physiological changes involved in multi-system manifestations. Thus, RBC oxidative stress in SCD can ultimately instigate major processes involved in organ damage. The critical role of the sickle RBC ROS production and its regulation in SCD pathophysiology are discussed here.

Background: In sickle cell disease (SCD), recurrent episodes of vaso-occlusive crisis (VOC) contribute to morbidity and accelerated mortality. Analysis of the RESET Phase 3 study demonstrated that administration of the pan-selectin inhibitor, rivipansel, early in the course of VOC was associated with efficacy outcomes in favor of rivipansel, suggesting that reversal of vaso-occlusion may be achieved by treatment early in VOC. While both P- and L-selectin likely contribute to the underlying inflammatory cascade leading to VOC, previous studies have shown that E-selectin expression on the vascular luminal surface appears to be crucial for adhesion of sickled (SS)-RBC and leukocytes to the endothelium. GMI-1687 is an innovative potent E-selectin specific antagonist that demonstrates high bioavailability following subcutaneous (SC) administration. In the current investigation, we report on in vitro and in vivo studies evaluating the activity of GMI-1687 in SCD mouse models of VOC. Methods: Townes transgenic mice and nude mice transfused with human SS-RBC were used as in vivo models of SCD. VOC was initiated by TNF injection in both models. Adhesion to inflamed venules and development of VOC was recorded using intravital microscopy at sites of window chamber implants. The in vivo activity of E-selectin inhibition with GMI-1687 was assessed following IV injection in the nude mouse and Townes transgenic models, and SC injection in the nude mouse model of SCD. Results: In an initial study, IV treatment with saline or GMI-1687 was initiated 30 min post infusion of SS-RBC (t30) into TNF-treated mice, a time during which sickle cells are adherent to inflamed venules and VOC has initiated, and repeated 30 minutes later (t60). As expected, mice treated with saline alone showed marked adhesion of human SS-RBC to venules (61% occlusion of the total vessels recorded at t30) with evident blood stasis. Under these conditions, GMI-1687 at 40 μg/kg significantly reversed SS-RBC adhesion and VOC at both t30 and t60 (p=0.002 and 0.0073, respectively, compared to saline treatment). This led to restoration of blood flow in 85% of the venules in GMI-1687 treated mice vs. 18% of vessels with normal blood flow in the control saline treated group. Because of reduced sickle cell adhesion and VOC, the number of circulating SS-RBC increased by approximately 6-fold in mice treated with GMI-1687. Similar anti-adhesive and anti-VOC activities of GMI-1687 treatment were obtained in the Townes transgenic model of SCD where following IV administration of the E-selectin antagonist, adhesion of sickled RBCs was significantly diminished and as a result, the percentage of the total occluded vessel segments was reduced by 80-90%. We next assessed the activity of SC administration with 40 μg/kg GMI-1687 on human SS-RBC adhesion and development of VOC in the nude mouse model. Similar to the IV experiments, GMI-1687 initiated at t30 and t60 post SS-RBC infusion significantly reduced SS-RBC adhesion in inflamed vessels (69% reduction at t30, and 63% at t60, p=0.0001). The reduction in SS-RBC adhesion led to a lower incidence of VOC (2% compared to 30% of vessels in mice injected with saline), and a 5.1-fold improvement (p=0.0315) in the number of circulating human SS-RBC. It is noteworthy that the effective dose of GMI-1687 used in these IV and SC studies resulting in the restoration of normal blood flow was approximately 500-fold less than that reported for rivipansel. Conclusions: These data demonstrate that the administration of the potent and E-selectin specific compound GMI-1687 was effective in restoring blood flow in two mouse models of SCD, and support the development of GMI-1687 formulated for SC use and self-administration with the potential for early intervention of VOC. Disclosures Thamilarasan: GlycoMimetics: Research Funding. Fogler:GlycoMimetics: Current Employment, Current equity holder in publicly-traded company, Patents & Royalties. Magnani:GlycoMimetics, Inc.: Current Employment, Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees, Patents & Royalties. Zennadi:GlycoMimetics: Research Funding.

Sickle cell disease (SCD) is caused by a point mutation in the β-globin gene that leads to devastating downstream consequences including chronic hemolytic anemia, episodic vascular occlusion, and cumulative oxidative organ damage resulting in death. Targeting the mechanisms leading to organ injury could bring out therapeutic approaches. Sickle red blood cell (RBC) oxidative damage, which leads to hemolysis, could participate in endothelial activation and organ damage. Recently, we show that NADPH oxidases (NOXs) are a major player in generating reactive oxygen species (ROS) within sickle RBCs to mediate adhesion and vaso-occlusion. We have now evaluated the effects of reducing ROS in sickle RBCs on hemolysis, and its consequences on endothelial activation and organ damage in sickle mice in vivo. To inactive RBC NOXs, thus reduce ROS levels, we used the redox-active manganese (Mn) porphyrins, MnTnBuOE-2-PyP5+ (MnBuOE) and MnTE-2-PyP5+ (MnE), commonly known as superoxide dismutase (SOD) mimics. Treatments of sickle mice for 4 weeks with 0.1 mg/kg MnBuOE and 1 mg/kg MnE significantly reduced sickle RBC ROS production profile compared to sickle RBC ROS levels in the control vehicle group (p Disclosures No relevant conflicts of interest to declare.

Sickle red blood cells (SSRBCs) adhere to both endothelial cells (ECs) and the extracellular matrix. Epinephrine elevates cyclic adenosine monophosphate in SSRBCs and increases adhesion of SSRBCs to ECs in a β‐adrenergic receptor and protein kinase A‐dependent manner. Studies in vitro as well as in vivo have suggested that adrenergic stimuli like epinephrine may contribute to vaso‐occlusion associated with physiologic stress. We conducted both animal studies and a Phase I dose‐escalation study in sickle cell disease (SCD) patients to investigate whether systemically administered propranolol inhibits SSRBC adhesion and to document the safety of propranolol in SCD. Systemically administered propranolol prevented SSRBC adhesion and associated vaso‐occlusion in a mouse model. In patients receiving a single oral dose of 10, 20, or 40 mg propranolol, SSRBC adhesion to ECs was studied before and after propranolol, with and without stimulation with epinephrine. Propranolol administration significantly reduced epinephrine‐stimulated SSRBC adhesion in a dose dependent manner (p = 0.03), with maximum inhibition achieved at 40 mg. Adverse events were not severe, did not show dose dependence, and were likely unrelated to drug. No significant heart rate changes occurred. These results imply that β‐blockers may have a role as antiadhesive therapy for SCD. Clin Trans Sci 2012; Volume 5: 437–444

The core pathology of sickle cell disease (SCD) starts with the erythrocyte (RBC). Aberration in MAPK/ERK1/2 signaling, which can regulate cell adhesion, occurs in diverse pathologies. Because RBCs contain abundant ERK1/2, we predicted that ERK1/2 is functional in sickle (SS) RBCs and promotes adherence, a hallmark of SCD. ERK1/2 remained active in SS but not normal RBCs. β2-adrenergic receptor stimulation by epinephrine can enhance ERK1/2 activity only in SS RBCs via PKA- and tyrosine kinase p72syk-dependent pathways. ERK signaling is implicated in RBC ICAM-4 phosphorylation, promoting SS RBC adhesion to the endothelium. SS RBC adhesion and phosphorylation of both ERK and ICAM-4 all decreased with continued cell exposure to epinephrine, implying that activation of ICAM-4–mediated SS RBC adhesion is temporally associated with ERK1/2 activation. Furthermore, recombinant ERK2 phosphorylated α- and β-adducins and dematin at the ERK consensus motif. Cytoskeletal protein 4.1 also showed dynamic phosphorylation but not at the ERK consensus motif. These results demonstrate that ERK activation induces phosphorylation of cytoskeletal proteins and the adhesion molecule ICAM-4, promoting SS RBC adhesion to the endothelium. Thus, blocking RBC ERK1/2 activation, such as that promoted by catecholamine stress hormones, could ameliorate SCD pathophysiology.

Transfusion of red blood cells has been linked to disappointing clinical outcomes in the critically ill, but specific mechanisms of organ dysfunction after transfusion remain poorly understood. We tested the hypothesis that red blood cell storage impairs the ability of red blood cells to release adenosine-5'-triphosphate and that impaired adenosine-5'-triphosphate release was injurious in vivo, in part through increased red blood cell adhesion.Prospective, controlled, mechanistic study.University research laboratory.Human and mouse blood donors; nude mouse transfusion recipients.Manipulation of adenosine-5'-triphosphate release, supplemental adenosine-5'-triphosphate, and antibodies to red blood cell and endothelial adhesion receptors were used in vitro and in vivo to probe the roles of released adenosine-5'-triphosphate and adhesion in responses to (transfused) red blood cells.The ability of stored red blood cells to release adenosine-5'-triphosphate declined markedly within 14 days after collection despite relatively stable levels of adenosine-5'-triphosphate within the red blood cells. Inhibiting adenosine-5'-triphosphate release promoted the adhesion of stored red blood cells to endothelial cells in vitro and red blood cell sequestration in the lungs of transfused mice in vivo. Unlike transfusion of fresh human red blood cells, stored red blood cell transfusion in mice decreased blood oxygenation and increased extravasation of red blood cells into the lung's alveolar air spaces. Similar findings were seen with transfusion of fresh red blood cells treated with the adenosine-5'-triphosphate release inhibitors glibenclamide and carbenoxolone. These findings were prevented by either coinfusion of an adenosine-5'-triphosphate analog or pretransfusion incubation of the red blood cells with an antibody against the erythrocyte adhesion receptor Landsteiner-Wiener (intercellular adhesion molecule-4).The normal flow of red blood cells in pulmonary microvessels depends in part on the release of antiadhesive adenosine-5'-triphosphate from red blood cells, and storage-induced deficiency in adenosine-5'-triphosphate release from transfused red blood cells may promote or exacerbate microvascular pathophysiology in the lung, in part through increased red blood cell adhesion.

Erythrocytes containing primarily hemoglobin S (SS RBCs) are abnormally adherent. We now know that SS RBCs express numerous adhesion molecules, and that many of these can undergo activation. SS RBCs exposed briefly to epinephrine show markedly increased adhesion to both laminin and endothelial cells. In vivo, infusion of epinephrine-activated but not unstimulated SS RBCs causes RBC adhesion, vaso-occlusion, organ trapping, and shortened RBC survival in the circulation. Epinephrine treatment of SS RBCs before infusion also induces adhesion of murine leukocytes to vascular walls. Indeed, in vitro, SS RBCs can activate leukocyte adhesion and cytokine production. We now have demonstrated both in vitro and in vivo evidence for the importance of RBC signaling and have also shown that SS RBC adhesion is determined by genetic polymorphisms in the signaling pathway that activates adhesion. These advances will hopefully lead to new therapeutic modalities for sickle cell disease.

Contains fulltext : 171492.pdf (Publisher’s version ) (Open Access) Sevuparin is a novel drug candidate in phase II development as a treatment for vaso-occlusive crises (VOC) in patients with sickle cell disease (SCD). As a heparin-derived polysaccharide, sevuparin has been designed to retain anti-adhesive properties, while the antithrombin-binding domains have been eliminated, substantially diminishing its anticoagulant activity. Here, we demonstrate that sevuparin inhibits the adhesion of human sickle red blood cells (SS-RBCs) to stimulated cultured endothelial cells in vitro. Importantly, sevuparin prevents vaso-occlusion and normalizes blood flow in an in vivo mouse model of SCD vaso-occlusion. Analyses by surface plasmon resonance (SPR) and fluorescence correlation spectroscopy (FCS) demonstrate that sevuparin binds to P- and L-selectins, thrombospondin, fibronectin and von Willebrand factor, all of which are thought to contribute to vaso-occlusion in SCD. Despite low anticoagulation activity, sevuparin has anti-adhesive efficacy similar to the low molecular weight heparin tinzaparin both in vitro and in vivo. These results suggest that the anti-adhesive properties rather than the anticoagulant effects of heparinoids are critical for the treatment of vaso-occlusion in SCD. Therefore, sevuparin is now being evaluated in SCD patients hospitalized for treatment of VOC.

Sickle red cell (SS RBC) adhesion is believed to contribute to the process of vaso-occlusion in sickle cell disease (SCD). We previously found that the LW RBC adhesion receptor can be activated by epinephrine to mediate SS RBC adhesion to endothelial αvβ3 integrin. To determine the contribution of LW activation to vaso-occlusive events in vivo, we investigated whether in vitro treatment of SS RBCs by epinephrine resulted in vaso-occlusion in intact microvasculature after RBC infusion into nude mice. Epinephrine enhanced human SS but not normal RBC adhesion to murine endothelial cells in vitro and to endothelium in vivo, promoting vaso-occlusion and RBC organ sequestration. Murine sickle RBCs also responded to epinephrine with increased adhesion to postcapillary endothelium in nude mice. Epinephrine-induced SS RBC adhesion, vaso-occlusion, and RBC organ trapping could be prevented by the β-adrenergic receptor (β-AR) antagonist, propranolol. Infusion of soluble recombinant LW also significantly reduced adhesion and vaso-occlusion. In addition, epinephrine-treated SS RBCs induced activation of murine leukocyte adhesion to endothelium as well. We conclude that LW activation by epinephrine via β-AR stimulation can promote both SS RBC and leukocyte adhesion as well as vaso-occlusion, suggesting that both epinephrine and LW play potentially pathophysiological roles in SCD.

In sickle cell disease (SCD), treatment of recurrent vasoocclusive episodes, leading to pain crises and organ damage, is still a therapeutic challenge. Vasoocclusion is caused primarily by adherence of homozygous for hemoglobin S (SS) red blood cells (SSRBCs) and leukocytes to the endothelium. We tested the therapeutic benefits of MEK1/2 inhibitors in reversing vasoocclusion in nude and humanized SCD mouse models of acute vasoocclusive episodes using intravital microscopy. Administration of 0.2, 0.3, 1, or 2 mg/kg MEK1/2 inhibitor to TNF-α-pretreated nude mice before human SSRBC infusion inhibited SSRBC adhesion in inflamed vessels, prevented the progression of vasoocclusion, and reduced SSRBC organ sequestration. By use of a more clinically relevant protocol, 0.3 or 1 mg/kg MEK1/2 inhibitor given to TNF-α-pretreated nude mice after human SSRBC infusion and onset of vasoocclusion reversed SSRBC adhesion and vasoocclusion and restored blood flow. In SCD mice, 0.025, 0.05, or 0.1 mg/kg MEK1/2 inhibitor also reversed leukocyte and erythrocyte adhesion after the inflammatory trigger of vasoocclusion and improved microcirculatory blood flow. Cell adhesion was reversed by shedding of endothelial E-selectin, P-selectin, and αvβ3 integrin, and leukocyte CD44 and β2 integrin. Thus, MEK1/2 inhibitors, by targeting the adhesive function of SSRBCs and leukocytes, could represent a valuable therapeutic intervention for acute sickle cell vasoocclusive crises.

NK and LAK cells which are able to lyse tumor target cells in an MHC-unrestricted manner are not equally effective against targets of the same nature. In the case of colorectal tumors, some cells are highly sensitive, whereas others are resistant to NK and can even be quite resistant to LAK-mediated lysis. In the present paper, we tried to correlate the stage of differentiation of 17 human colorectal tumor cell lines with their NK- or LAK-cell susceptibility. It was observed that NK cells killed colorectal target cells independently from their stage of differentiation defined according to histopathological criteria from xenografting in nude mice. NK susceptibility was not correlated either with in vitro-defined criteria of differentiation, such as cell polarity and morphology, brush-border enzyme expression and CEA production. A LAK-resistant HT-29 sub-line (HT-29 LAK) was selected which could not be distinguished from HT-29 in terms of features of differentiation. It was further observed that HT-29 Glc-/+ cell line, a highly differentiated enterocytic-like variant of HT-29, obtained after glucose starvation, was killed by LAK cells as efficiently as the moderately differentiated parental HT-29, and that Caco-2 cells, which differentiate spontaneously after confluence in standard culture conditions, were equally sensitive to NK-mediated lysis whatever their stage of differentiation. In contrast, HT29 MTX10(-5), a highly differentiated mucus-secreting variant of HT29 obtained by methotrexate selection, was much more resistant to LAK cells than parental HT29 cells.

We analyzed several factors which could influence the immunogenicity of colon tumor cells, using a series of clones derived from a single chemically induced rat adenocarcinoma cell line. These clones display variable tumorigenic potential in syngeneic immunocompetent animals, and it has been established that in this model the tumorigenicity of the cells depends on their ability to escape immune surveillance. The results show an absence of relationship between tumorigenicity and expression of MHC-class-I antigens, cell adhesion to rat fibroblasts or fibroblast extracellular matrix. The secretion of latent and active TGFβ I appeared to be quite variable from one clone to the other, but was unrelated to tumorigenicity. Unexpectedly, some regressive clones produced elevated levels of this cytokine, suggesting that in this model, spontaneous secretion of TGFβ I is not sufficient to impair the immune system of the host. In contrast, the more tumorigenic clones were more resistant than less tumorigenic ones to cytotoxicity mediated by NK or LAK cells. They also showed arrest of cell proliferation after reaching confluence, something not observed in the less tumorigenic clones. Finally, the strongest relationship with tumorigenicity was found for expression of blood-group carbohydrate antigens. Increased expression of blood-group-H antigen and, conversely, decreased expression of β-galactoside precursors of this antigen correlated with increased tumorigenicity. © 1992 Wiley-Liss, Inc.

The sensitivity of colorectal tumors to NK-cell-mediated cytotoxicity and their expression of major histocompatibility complex (MHC) class-I antigens were studied in an attempt to determine whether such antigens play a role in the susceptibility of colorectal tumors to NK-cell lysis. In a rat colon-carcinoma model, 2 clones differing in their sensitivity to NK-cell-mediated cytotoxicity were tested for class-I expression; it was seen that the more sensitive cells (REGb) expressed less class-I products than did the resistant cells (PROb). However, when MHC class-I antigen expression was increased by IFN-gamma treatment, no change in NK-cell lysis was found with the PROb cells, while an increase in cytotoxicity was obtained with the REGb cells. After in vivo or in vitro selection of NK-resistant REGb cells, we observed in the selected cells an important decrease in RT-I class-I antigen expression. Fifteen different human colorectal cell lines were also studied for HLA class-I expression and NK-cell susceptibility, and no quantitative correlation between these 2 features was seen. However, cell lines which were deficient in HLA class-I antigens were more sensitive than class-I-positive cells.

Infusion of epinephrine-activated human sickle erythrocytes (SS RBCs) into nude mice promotes both SS RBC and murine leukocyte adhesion to vascular endothelium in vivo. We hypothesized that interaction of epinephrine-stimulated SS RBCs with leukocytes leads to activation of leukocytes, which then adhere to endothelial cells (ECs). In exploring the underlying molecular mechanisms, we have found that coincubation in vitro of epinephrine-treated SS RBCs with human peripheral blood mononuclear cells (PBMCs) results in robust adhesion of PBMCs to ECs. Sham-treated SS RBCs had a similar but less pronounced effect, whereas neither sham- nor epinephrine-treated normal RBCs activated PBMC adhesion. PBMC activation was induced via at least 2 RBC adhesion receptors, LW and CD44. In response to SS RBCs, leukocyte CD44 and β2 integrins mediated PBMC adhesion to ECs, a process that involved endothelial E-selectin and fibronectin. SS RBCs activated adhesion of both PBMC populations, lymphocytes and monocytes. Thus, our findings reveal a novel mechanism that may contribute to the pathogenesis of vaso-occlusion in sickle cell disease, in which SS RBCs act via LW and CD44 to stimulate leukocyte adhesion to endothelium, and suggest that RBC LW and CD44 may serve as potential targets for antiadhesive therapy designed to prevent vaso-occlusion.

The possible role of physiologic stress hormones in enhancing adhesion of sickle erythrocytes (SS RBCs) to endothelial cells (ECs) in sickle cell disease (SCD) has not been previously explored. We have now found that up-regulation of intracellular cyclic adenosine monophosphate (cAMP)–dependent protein kinase A (PKA) by epinephrine significantly increased sickle but not normal erythrocyte adhesion to both primary and immortalized ECs. Inhibition of serine/threonine phosphatases also enhanced sickle erythrocyte adhesion at least partially through a PKA-dependent mechanism. Adhesion was mediated through LW (intercellular adhesion molecule-4 [ICAM-4], CD242) blood group glycoprotein, and immunoprecipitation studies showed that LW on sickle but not on normal erythrocytes undergoes increased PKA-dependent serine phosphorylation as a result of activation. The major counter receptor for LW was identified as the αvβ3 integrin on ECs. These data suggest that adrenergic hormones such as epinephrine may initiate or exacerbate vaso-occlusion and thus contribute to the association of vaso-occlusive events with physiologic stress.

Vascular occlusion is the hallmark of sickle cell disease (SCD) and is mediated largely through sickle red blood cell (SSRBC) adherence to the endothelium and SSRBC-induced activation of leukocyte adhesion. While normal RBCs release bioactive derivatives of nitric oxide (NO) in response to hypoxia, leading to vasodilation, SSRBCs are deficient in NO adducts and have reduced ability to induce vasodilation. We show that loading SSRBCs in vitro with NO under hypoxic conditions, followed by reoxygenation, significantly decreased epinephrine-dependent SSRBC adhesion in vitro (p = 0.032). NO-loading of SSRBCs also reduced adhesion to vessel walls and vaso-obstruction observed in vivo through dorsal-skin window chambers in nude mice. Additionally, NO-loading markedly decreased the ability of SSRBCs to activate leukocyte adhesion to endothelial cells in vitro (p = 0.027). Increasing SSRBC bioactive NO content by incubating with the low-mass S-nitrosothiol (SNO) S-nitroso- l -cysteine (SNO-Cys) attenuated the exaggerated pulmonary hypertension seen basally and during hypoxia in SSRBC-perfused lungs, suggesting that SSRBC NO/SNO deficiency may also contribute to SCD lung disease, such as pulmonary hypertension. Furthermore, since transfusion is frequently used in SCD, we studied the effects of stored normal RBCs (SNO-depleted) on SSRBC interactions in vivo. Infusion of stored (32 days) normal, human RBCs failed to prevent SSRBC adhesion and vaso-occlusion. In contrast, NO-loaded stored normal RBCs or fresh normal RBCs reduced SSRBC adhesion to endothelium and abolished frank vaso-occlusion. Our results suggest that abnormal SSRBC NO content and NO/SNO-dependent vasoactivity contribute to the vaso-occlusive pathophysiology of SCD and are potentially amenable to correction by RBC transfusion.

Recognition of melanoma antigens by HLA class-II-restricted CD4(+) T lymphocytes has been investigated. Two cytotoxic CD4(+) T cell lines were established by stimulating PBLs from a melanoma patient with either parental or IFN-gamma-transduced autologous tumor cells. These T cells secreted IL-4, but not IL-2, IFN-gamma, or TNF-beta, in response to the autologous melanoma cells, suggesting that they belong to the Th2 subtype. Their cytotoxicity was directed against the IFN-gamma-transduced melanoma cells and was HLA-DR-restricted. The autologous and two allogeneic IFN-gamma-modified melanoma cell lines shared melanoma antigen(s) presented in the context of HLA-DR15. HLA-DR15(+) nonmelanoma cells were resistant targets indicating that the shared antigen(s) is melanoma associated. Parental autologous and HLA-DR-matched allogeneic melanoma cell lines, displaying low levels of HLA-DR antigens, induced Th2 proliferation and cytokine release, but were insensitive to lysis prior to upregulation of HLA-DR and Fas antigens by IFN-gamma. Cytolysis was inhibited by anti-HLA-DR and by anti-Fas antibodies, suggesting that the cytolysis is mediated via the Fas pathway. While small amounts of HLA-DR15 molecules on melanoma cells are sufficient for Th2 proliferation and cytokine release, higher amounts of HLA-DR15 and the expression of Fas are required for CD4(+)-mediated lysis.

Introduction Sevuparin is a new chemically modified heparin with low anticoagulant activity currently being studied as an adjuvant therapy for severe malaria. Heparins generally have multiple biological properties, including antithrombin III-dependent inhibition of thrombin as well as blockade of P-selectin-mediated adhesion. Selectins have been shown to contribute to both sickle red cell (SS RBC) and neutrophil (PMN) adhesion in vitro and in mice with sickle cell disease (SCD). Sickle mice lacking both P- and E-selectins are relatively resistant to tumor necrosis factor-α (TNFα)-induced vaso-occlusion. We therefore theorized that sevuparin would show activity in inhibiting the selectin-dependent adhesion of red cells and leukocytes seen in the context of SCD, with the potential to decrease vaso-occlusion at a low level of anti-coagulation. Methods We studied both RBC and PMN adhesion to human umbilical vein endothelial cells (ECs) in an in vitro flow chamber. For studies of SS RBC adhesion, we exposed confluent cultures of ECs on gelatin-coated glass slides to interleukin (IL)-13 (50 ng/ml) for 48 h, followed by histamine (100 μM) for 10 min at 37°C immediately prior to performance of adhesion assays. Upregulation of P-selectin expression was confirmed by FACS of mechanically dislodged ECs. RBC adhesion was quantified during continuous flow. For assays of neutrophil adhesion, ECs were treated with human TNFα (10 μg/ml) overnight, followed by incubation for 10 min at 37°C with 100 µM histamine. All slides bearing ECs were washed after incubation with histamine and immediately mounted in the flow chamber for adhesion assays. Inhibition by sevuparin was tested by pre-incubating ECs with different concentrations of sevuparin for 20 min at 37°C prior to adhesion assays. PMNs from SCD patients were tested for adhesion to treated ECs with and without preceding exposure of ECs to sevuparin. In addition, PMNs from normal donors were first exposed to SS RBCs, as previously described, and then tested for adhesion to ECs with and without pre-exposure to sevuparin. PMN adhesion was quantitated after 10 min of no flow, followed by wash out at various shear stresses. The ability of sevuparin to prevent vaso-occlusion in vivo was studied by infusing red fluorescent SS RBCs into nude mice to effect in vivo adhesion and vaso-occlusion visible in implanted window chambers (Zennadi et al. 2007); 500 ng of murine TNFα in 100 μl was injected intraperitoneally (IP) 4 h before infusion of SS RBCs to increase endothelial expression of selectins. Sevuparin or saline control solution was injected SQ at various dose levels prior to infusion of SS RBCs into nude mice. Results SS RBC adhesion to ECs stimulated with IL13 and histamine was greater than adhesion to similarly stimulated ECs pretreated with sevuparin at 100, 200, 400 and 600 µg/ml prior to exposure to flowing SS RBCs (p = 0.047, 0.031, 0.094, 0.065, respectively, using a paired t test, in which each patient sample was only compared to itself), with a robust dose-response (p < 0.001) (Fig 1A). In a similar analysis, 7.5 µg/ml of function blocking monoclonal antibody to CD62P (9E10) also significantly reduced RBC adhesion (p = 0.038). Sevuparin significantly inhibited adhesion of SCD PMNs to ECs treated with TNFα and histamine, and this inhibition exhibited a modest dose-response relationship (Fig 1B). When normal PMNs stimulated by SS RBCs were studied, the differences between adhesion in the absence of sevuparin and in the presence of either 600 or 800 µg/mL sevuparin were also highly significant at both 1 and 2 dyne/cm2 (p = 0.019 and p = 0.011 at 1 dyne/cm2 and p = 0.013 and p = 0.008 at 2 dynes/cm2, respectively) (Fig 1C). In vivo, injection of sevuparin prior to infusion of SS RBCs significantly decreased SS RBC adhesion to vessel walls, as measured by the percent of vessel lengths occupied by adherent cells (Fig 2A). Sevuparin treatment also significantly increased the percent of venules that maintained normal blood flow (Fig 2B). Conclusions Sevuparin is an effective inhibitor of SS RBC adhesion and both SCD and normal PMN adhesion to endothelial cells in vitro. In vivo, sevuparin effectively decreased vaso-occlusion and improved blood flow after TNFα treatment. Therefore, we consider sevuparin a promising anti-adhesion agent with potential to reduce vaso-occlusion in SCD, via reducing RBC adhesion and leukocyte adhesion, possibly through its effect on selectins. Disclosures: Batchvarova: Dilaforette, AB: Research Funding. Shan:Dilaforette, AB: Research Funding. Zennadi:Dilaforette, AB: Research Funding. Lindgren:Dilaforette, AB: Employment. Leitgeb:Dilaforette, AB: Employment. Sulila Tamsen:Dilaforette, AB: Employment. Telen:GlycoMimetics, Inc.: Research Funding; Dilaforette, NA: Research Funding; Pfizer, Inc.: Consultancy.

Abstract 2120 In sickle cell disease (SCD), the mitogen-activated protein kinase (MAPK) ERK1/2 is constitutively active and can be inducible by agonist-stimulation only in sickle but not in normal human erythrocytes. ERK1/2 is involved in activation of ICAM-4-mediated sickle red blood cell (SSRBC) adhesion to the endothelium. However, other effects of the ERK1/2 activation in SSRBCs leading to the complex SCD pathophysiology, such as alteration of RBC hemorheology are still unknown. To further characterize global ERK1/2-induced changes in membrane protein phosphorylation within human RBCs, a label-free quantitative phosphoproteomic analysis was applied to sickle and normal RBC membrane ghosts pre-treated with U0126, a specific inhibitor of MEK1/2, the upstream kinase of ERK1/2 activation, in the presence or absence of recombinant active ERK2. Across eight unique treatment groups, 375 phosphopeptides from 155 phosphoproteins were quantified with an average technical coefficient of variation in peak intensity of 19.8%. Consistent with other RBC membrane phosphorylation studies, the phosphoproteins of SSRBC membrane ghosts with the highest number of uniquely phosphorylated peptides (>10), were ankyrin-1 of the ankyrin complex (n=33), spectrin β chain of the cytoskeleton network (n=15), and proteins of the junctional complex involved in binding integral membrane proteins to cytoskeletal proteins, including α- and β-adducins (n=22 and n=18, respectively), dematin (n=16) and protein 4.1 (n=17). In addition, several other phosphoproteins with >5 unique phosphorylated peptides, affecting RBC shape, flexibility, anion transport and protein trafficking, and adhesion, all of which contribute to the pathophysiology of SCD, were also observed. However, the MEK1/2 inhibitor U0126 was able to significantly down-regulate 37 unique RBC membrane phosphopeptides (from 21 unique phosphoproteins) in SSRBCs. We found that MEK1/2-dependent ERK1/2 activation in SSRBCs affected membrane-bound proteomes of both the junctional and ankyrin complexes, including dematin, α-adducin, β-adducin with phosphorylation of residues within the ERK1/2 consensus motif, and glycophorin A. MEK1/2/ERK1/2 signaling in SSRBCs induced changes within the actins/spectrins network as well by affecting phosphorylation of β-spectrins. Furthermore, the peptide metabotropic glutamate receptor 7 (mGlu7) also underwent serine phosphorylation at the ERK consensus motif. This could explain the rate of active glutamate transport in these cells. Significant changes only in membrane ghosts prepared from SSRBCs treated with U0126 or after addition of exogenous active ERK2 to these membrane ghosts, were also observed in the status of leucine-rich repeats and immunoglobulin-like domains protein 2, leucine-zipper-like transcriptional regulator 1, glucose transporter 1, and adenylyl cyclase-associated protein 1 (CAP1), which may potentially disturb degradation of misfolded glycoproteins and receptor ubiquitination, protein transcription, glucose transport and cAMP production, respectively. These data also suggest that a negative regulatory mechanism might exist in normal cells to prevent activation of ERK1/2-dependent phosphorylation of these membrane proteins. Among all these phosphorylated proteomes, glycophorin A was the most affected protein in SSRBCs by this ERK1/2 pathway, which contained 12 unique phosphorylated peptides, suggesting that in addition to its effect on sickle RBC adhesion, increased glycophorin A phosphorylation via the ERK1/2 pathway may also affect glycophorin A interactions with band 3, which could result in decreased in both anion transport by band 3 and band 3 trafficking. The abundance of thirteen of the thirty-seven phosphopeptides was subsequently increased in normal RBCs co-incubated with recombinant ERK2, and therefore represent specific MEK1/2 phospho-inhibitory targets mediated via ERK2. These findings expand upon the current model for the involvement of ERK1/2 signaling in RBCs. These findings also identify additional protein targets of this pathway other than the RBC adhesion molecule ICAM-4 and enhance the understanding of the mechanism of small molecule inhibitors of MEK/1/2/ERK1/2, which could be effective in ameliorating RBC hemorheology and adhesion, the hallmarks of SCD. Disclosures: No relevant conflicts of interest to declare.

Abstract 376 In sickle cell disease (SCD), vaso-occlusive crises are caused largely by the sickle erythrocyte (SSRBC), which plays a critical and active role in vascular occlusion. The current major limitation in developing therapeutics for vaso-occlusive crises is our poor understanding of the specific signaling mechanisms that lead to increased sickle cell adhesion to endothelium and their ability to activate leukocyte adhesion. We have previously shown that the mitogen-activated protein kinase ERK1/2 is constitutively active in SSRBCs, and can be inducible by agonist-stimulation. ERK1/2 signaling is involved in activation of ICAM-4, which mediates SSRBC adhesion to endothelial cells (ECs). To determine if inhibition of SSRBC ERK activation has therapeutic potential, we tested four different inhibitors of MEK (the upstream kinase of ERK)/ERK activation in a model of non-stimulated human SSRBC adhesion to TNFα activated ECs. The MEK/ERK inhibitor U0126 is used in animal models, while RDEA119, AZD6244 and GSK1120212 were selected based on their demonstrated safety in long-term human therapeutic studies. Less than 30% of untreated SSRBCs adhered to non-activated ECs in vitro. However, adherence of non-treated SSRBCs to TNFα activated ECs increased by 2.6±0.17-fold over basal adhesion of untreated SSRBCs to non-activated ECs. Treatment of SSRBCs with the U0126, RDEA119, AZD6244 and GSK1120212 decreased SSRBC adhesion to activated ECs to levels below baseline SSRBC adhesion to non-activated ECs, demonstrating that MEK-dependent ERK signaling in non-stimulated SSRBCs is required for RBC adhesive interaction with activated ECs. Our data also indicated that co-incubation of epinephrine-activated SSRBCs with naive polymorphonuclear cells (PMNs), resulted in significant increased PMN adhesion compared to adhesion of naïve PMN alone. However, blocking ERK activity with U0126, RDEA119, AZD6244 and GSK1120212 decreased the ability of SSRBCs to promote PMN adhesion, indicating that SSRBCs activate leukocyte adhesion via the ERK pathway activation. We then determined the effect of the ERK signaling activation on adherence of unstimulated human SSRBCs in the presence of inflammation and vaso-occlusion in nude mice in vivo. Sham-treated human SSRBCs showed strong adhesion to TNFα activated endothelium, with frequent postcapillary obstruction. However, RDEA119-treatement of SSRBCs reduced RBC adhesion to TNFα activated endothelium and vaso-obstruction and resulted in improved RBC circulatory behavior. When RBC adhesion was quantified as % venular length occupied by SSRBCs, the percent venular length occupied by RDEA119-treated SSRBCs was significantly decreased by 75±5.5% (p25 μm) vessels, respectively. Similar results were obtained with U0126-treated SSRBCs. Our findings suggest that ERK is a key mediator of RBC adhesion and vaso-occlusion that does not require prior activation, and therapeutic strategies targeting ERK can be viable in reducing vaso-occlusion. Furthermore, we also determined if MEK/ERK inhibitors can be used therapeutically to reduce vaso-occlusion in nude mice injected with TNFα, followed by infusion of 0.2 or 2 mg/kg U0126 (or placebo control), and then human SSRBCs. Placebo treated mice display marked SSRBC adhesion to inflamed vessels and vaso-occlusion with evident blood stasis. However, infusion of U0126 at either 0.2 or 2 mg/kg dramatically reduced SSRBC adhesion and vessel obstruction. Quantitation of SSRBC adhesion indicates that U0126 at 2 mg/kg and 0.2 mg/kg significantly reduced by 76±5.5% and 59±4%, respectively, the % venular length occupied by SSRBCs for vessels ≤ 25 μm in diameter (p 25 μm, U0126 at only 2 mg/kg completely inhibited the % venular length occupied by SSRBCs. Our data suggest that in the presence of preexisting inflammation, MEK/ERK inhibitors can reduce vaso-occlusion, and their inhibitory effect could affect at least in part SSRBC adhesive function. Thus, this is the first report implicating atypical ERK activation in SSRBCs with the vaso-occlusive pathophysiology of SCD, and suggesting that small molecule inhibitors of MEK/ERK could be effective in ameliorating RBC adhesion and vaso-occlusion, the hallmarks of SCD. Disclosures: No relevant conflicts of interest to declare.

Abstract 3223 The vaso-occlusive process in patients with sickle cell disease is complex and involves interactions between hemoglobin S red blood cells (SSRBCs) and vascular endothelial cells (ECs). However, the pathophysiologic triggers inducing SSRBC adhesion and vaso-occlusion are poorly understood. Elucidation of these mechanisms at the molecular level would allow development of new preventive and treatment strategies to abrogate vaso-occlusive events. Because non-receptor tyrosine kinases in non-erythroid cells are known to mediate cell-cell interactions, we have now investigated the role of non-receptor tyrosine kinases in modulating SSRBC adherence to cultured ECs, identified the kinases involved, and defined both the receptors on activated SSRBCs and the ligands on ECs involved in these interactions. Less than 20% of non-treated SSRBCs were able to adhere to non-stimulated ECs in vitro in intermittent flow conditions at a shear stress of 2 dynes/cm2. However, treatment of SSRBCs with sodium orthovanadate (Na3VO4), a potent broad spectrum inhibitor of protein tyrosine phosphatases, was able to significantly up-regulate RBC adhesion to cultured ECs by 4.6±1-fold over baseline adhesion in vitro. Na3VO4 in contrast, completely failed to increase adhesion of normal RBCs to cultured ECs. The increased SSRBC adhesion induced by Na3VO4 was significantly inhibited with piceatannol (p Disclosures: No relevant conflicts of interest to declare.

Abstract 3251 Sickle erythrocytes (SSRBCs) are adherent to the endothelium, activate leukocyte adhesion, are deficient in nitric oxide (NO) content, and are inefficient in inducing vasodilation in response to hypoxia, all of which promote vascular occlusion, the hallmark of sickle cell disease (SCD). Furthermore, normal RBCs stored for transfusion are frequently used in SCD but are also NO-deficient. We therefore tested the hypothesis that repletion of intracellular SS or normal RBC NO could improve the abnormal circulatory characteristics of SSRBCs, using previously described in vitro (Zennadi et al. 2004 & 2008) and in vivo systems (Zennadi et al. 2007, Zhu et al. 2011). While exposure of SSRBCs to epinephrine (epi) up-regulated SSRBC adhesion to cultured HUVECs by 2.7±0.2-fold over baseline (p=0.0019), as previously described, loading SSRBCs with NO under hypoxic conditions (favoring SNO-Hb formation and bioactive NO availability), followed by reoxygenation prior to epi treatment, significantly decreased epi-induced SSRBC adhesion by 89±6.4% (p Disclosures: Telen: GlycoMimetics: Research Funding.

266 Abnormal adhesion of erythrocytes homozygous for hemoglobin S (SS RBCs) and vaso-occlusion are hallmarks of sickle cell disease (SCD). SS RBC adhesion can be activated via stimulation of the cAMP/PKA pathway by the stress hormone epinephrine. We have found that the extracellular signal-regulated kinase-1 and 2 (ERK1/2) is abundantly expressed in mature RBCs and is bound to the isolated plasma membrane. Because aberrations in ERK1/2 signaling are associated with various pathologies, we predicted that this prototypical molecular regulator of cell division and differentiation remained functional in terminally differentiated SS RBCs and plays a role in regulating RBC adherence. Western blot analysis of RBC ghosts showed that ERK1/2 was phosphorylated to some degree in SS but not normal RBCs. Although this basal ERK1/2 phosphorylation was not detected in all SS RBC samples tested, ERK1/2 underwent increased phosphorylation (p Disclosures: Telen: GlycoMimetics: Consultancy.

The susceptibility to natural-killer-cell lysis and expression of histo-blood-group antigens of 2 clones from a rat colon adeno-carcinoma, of variants derived from them and of 17 human colon carcinoma cell lines were assessed in an attempt to determine if the major glycosidic tissue antigens of epithelial cells could influence the NK susceptibility of tumor target cells of epithelial origin. The rat REGb clone, which is relatively NK-sensitive, expressed higher levels of precursor structures T and Tn and lower levels of H antigenic determinants than the PROb clone, which displays higher resistance to NK-cell lysis. Cell variants were obtained from these 2 clones; it appeared that whether the cell variants were selected on the basis of expression of a blood-group antigenic determinant or on the basis of altered susceptibility to NK-cell lysis, there was a link between increased resistance and higher expression of cell-surface A and H histo-blood-group antigens, or conversely, between increased sensitivity and higher expression of precursor structures. Similar conclusions were obtained upon study of the human cell lines, since a significant correlation was found between the level of expression of T or Tn antigens and sensitivity to NK-cell lysis. A significant relationship was found between the expression of Lewis antigens and increased resistance to NK-cell-mediated cytotoxicity. © 1992 Wiley-Liss, Inc.

Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBCs) to vascular endothelium is crucial to the generation of vaso-occlusion. SS-RBCs express many adhesion molecules. Adhesive SS-RBCs bind to endothelial cell P-selectin and other adhesion molecules, as well as extracellular matrix proteins. Thrombin causes endothelial retraction with exposure of proadhesive extracellular matrix components as well as upregulation of endothelial expression of P-selectin. Other investigators have shown that SS-RBCs can bind to P-selectin, thus suggesting that P-selectin is a suitable target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human P-selectin, inhibit P-selectin binding to its ligand sialyl Lewis X, and inhibit neutrophil-platelet adhesion have previously been identified (Antisense Nucleic Acid Drug Dev , 8:265, 1998). We have now tested one of these high-affinity P-selectin aptamers (clone PF377: ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC) for its ability to prevent cellular adhesion of SS-RBCs to endothelial cells. Aptamer clone PF377 bound P-selectin with a Kd of 6nM and a Bmax of 87%. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. The anti-adhesion activity of aptamer clone PF377 was confirmed using primary human umbilical vein endothelial cells (HUVECs) treated with IL-13 (50ng/mL) for 48hrs, followed by stimulation with histamine (25μM for 12mins at RT) immediately prior to a flow chamber assay. Aptamer clone PF377 at 60nM had anti-adhesion activity similar to heparin (a previously identified inhibitor of SS-RBC adhesion to P-selectin) and 9E1 (an inhibitory antibody to P-selectin), whereas Bi 9.3t (a non-functional aptamer to thrombin, used as a negative control, 60nM) and AC1.2 (a non-inhibitory antibody to P-selectin), did not prevent adhesion (Figure). Normalized % inhibition by aptamer clone (PF377) at 60nM at 1 dynes/cm2 was 99% (Figure). In conclusion, we observed significant anti-adhesion activity of P-selectin aptamer clone PF377, and this aptamer is now suitable for modification to enhance stability and bioavailability. Since we previously reported strong anti-adhesion activity of integrin αvβ3 aptamer clone 17.16 (Blood , 108:206a, 2006), in vivo experiments in mice are currently employing intravital microscopy to measure anti-adhesion activity of aptamer clone 17.16, PF377, and both in combination. The development of combinatorial blocking aptamers against various adhesion molecules, including αvβ3 and P-selectin, represents a novel potential therapeutic option for patients with SCD. Download : Download high-res image (92KB) Download : Download full-size image Figure

Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBC) to vascular endothelium is crucial to the generation of vaso-occlusion. The αvβ3 integrin is a major endothelial ligand for SS-RBC. Soluble thrombospondin has been thought to serve as a bridging molecule between erythrocyte CD36 and endothelial αvβ3, and high-molecular-weight multimers of von Willebrand factor also promote SS-RBC adhesion to endothelial αvβ3. Our group recently identified SS-RBC adhesion to endothelium via ICAM-4 (LW, CD242)-αvβ3 interactions (Blood, 104, 3774, 2004), suggesting that αvβ3 is a critical target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human integrin αIIbβ3/αvβ3 and inhibit integrin binding to the ligands vitronectin and fibrinogen have previously been identified (Biochem Biophys Res Commun, 338, 956, 2005). We have now tested one of these high-affinity αvβ3 aptamers (clone 17.16: UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC) for its ability to prevent adhesion of SS-RBC to endothelial cells. Aptamer clone 17.16 bound αIIbβ3 with a Kd of 7–10nM, and the binding was blocked by both Abciximab, a monoclonal antibody against human integrin αIIbβ3/αvβ3 via a common binding motif RGD (arginine-glycine-aspardic acid), and Eptifibatide, a small molecule that binds to the RGD moiety, suggesting the sharing of the binding site at the RGD moiety. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. We first induced enhanced expression of αvβ3 on the immortalized HUVEC cell line EC-RF24, using each of the following: TNF-α (10ng/mL for 18.5 hrs at 37°C), thrombin (1nM for 5 min at 37°C), or histamine (25mM for 12 min at RT), and αvβ3 expression by treated and nontreated cells was measured by flow cytometry. The anti-adhesion activity of aptamer clone 17.16 was then confirmed using HUVECs treated with thrombin (1nM for 5mins at 37°C) using a flow chamber assay. Aptamer clone 17.16 (30nM) had anti-adhesion activity similar to LM609, an inhibitory antibody to αvβ3, whereas human complement 8 aptamer (Blood, 106, 57a, 2005, negative control, 30nM) did not have anti-adhesion activity. The anti-adhesion activity of aptamer clone 17.16 (30nM) was enhanced by a dose escalation to 60nM and 120nM. At 2 dynes/cm2, maximal inhibition of adhesion was 57%. In conclusion, we observed significant anti-adhesion activity of αvβ3 aptamer clone 17.16, and it has currently reached a stage suitable for modification to enhance stability and bioavailability. In addition, in vivo experiments in mice will employ intravital microscopy to measure anti-adhesion activity in vivo. Figure Figure

Clinical observations have suggested a role for leukocytes in the pathophysiology of sickle cell disease (SCD). We have previously shown that epinephrine (epi), a stress hormone, activates LW-mediated sickle red cell (SS RBC) adhesion to non-activated endothelial cells (ECs). LW also recognizes leukocyte integrins. Moreover, SS RBCs can activate ECs. Therefore, we hypothesized that interaction of epi-activated LW on SS RBCs with leukocytes may also induce activation of leukocytes and stimulate their adhesion to ECs. To evaluate our hypothesis, SS RBCs were sham-treated or treated with 20 nM epi for 1 min, and after three washes, were incubated for 30 min with normal mononuclear leukocytes at 37°C. SS RBCs in leukocyte-RBC mixtures were lysed before measurement of leukocyte adhesion to non-activated ECs. Leukocytes not pre-incubated with SS RBCs and leukocytes treated with RBC lysis buffer alone did not adhere to ECs at a shear stress of 1 dyne/cm2. Incubation of sham-treated SS RBCs or sham- or epi-treated normal RBCs with leukocytes induced a non-significant adherence of 10±3%, 0% and 2% of the leukocyte population, respectively. Epi-treated SS RBCs, however, induced adhesion of 42±4.8% of leukocytes to ECs (p < 0.001). When sham- or epi-treated SS RBCs in RBC-leukocyte mixtures were not lysed, leukocyte adhesion to ECs did not further increase when compared to adhesion of leukocytes washed free of lysed sham-treated or epi-treated SS RBCs. The possible effect of residual epi on leukocytes was also tested. Exposure of leukocytes to the supernatant of the last wash of SS RBC treatment with epi had no effect on leukocyte adhesion to ECs, compared to adhesion of non-treated leukocytes to ECs. We next determined whether activated SS RBCs interact with leukocytes via the RBC LW glycoprotein. Pre-incubation of SS RBCs with antibody to LW (25 μg/ml) reduced adhesion of leukocytes induced by epi-treated SS RBCs by 78±7.9 % (p < 0.001), while pre-incubation of SS RBCs with antibody to the CD47 thrombospondin receptor (25 μg/ml) failed to inhibit the ability of epi-treated SS RBCs to stimulate leukocyte adhesion to ECs. We also identified the molecule on leukocytes mediating adhesion to ECs and its counterreceptor on ECs. Antibody to the CD44 adhesion receptor (50 μg/ml) on leukocytes blocked adhesion to ECs of leukocytes activated by epi-treated SS RBCs by 71±6.35% (p < 0.05), while antibody to CD47 failed to inhibit adhesion of activated leukocytes to ECs. Similarly, addition of recombinant soluble (rs) CD44 protein (50 μg/ml) to ECs also blocked adhesion of activated leukocytes to ECs by 74±5.8 % (p < 0.01). In contrast, incubation of rsLW (50 μg/ml) with ECs failed to inhibit adhesion of activated leukocytes. To define the endothelial counterreceptor for CD44, we incubated ECs with antibodies to adhesion molecules αVβ3 integrin, fibronectin, thrombospondin, CD44, E-selectin or P-selectin before adhesion assays. Only antibody to endothelial E-selectin completely blocked adhesion of activated leukocytes to ECs. Flow cytometric analysis showed that 36% of cultured ECs highly expressed E-selectin. These data suggest that leukocyte CD44 can be activated by cell-cell interactions mediated by RBC LW to stimulate adhesion of leukocytes to endothelial E-selectin. These studies thus provide a previously unsuspected mechanism whereby activated SS RBCs may play a role as potent stimulatory cells capable of activating leukocyte adhesion to endothelium in SCD.

Sickle red cell (SS RBC) adhesion is believed to be a major factor in vaso-occlusion. SS RBCs adhere especially avidly to the extracellular matrix protein laminin (LAM), which is found in the subendothelial basement membrane as well as soluble in plasma. We asked (1) Whether the level of soluble LAM in plasma is related to chronic complications of SCD; and (2) Whether soluble LAM enhances the ability of SS RBCs to adhere to endothelial cells (ECs). We first established an ELISA assay to quantitate plasma LAM and found that plasma from all normal subjects tested had LAM levels ≤0.5 μg/mL, which was comparable to the lower limit of detection for our assay. However, plasma from HbSS patients in steady state had levels ranging from ≤0.5 to >8.1 μg/mL. Of 52 HbSS patients studied while in steady state, 5 had plasma LAM levels ≤0.5 μg/mL, 22 had levels >0.5 and 3.0 μg/mL) did not have a higher frequency of stroke, acute chest syndrome, priapism, leg ulcers, or aseptic necrosis than patients with levels 8.5 g/dL had LAM levels of 1.72±0.41 μg/mL (n=18, p=0.008). To evaluate whether soluble LAM contributed to SS RBC adhesion, we assayed adhesion using TNF-activated human umbilical vein endothelial cells in a graduated height flow chamber. When SS RBCs were first preincubated with physiologic amounts of LAM, we saw a marked increase in SS RBC adhesion to ECs, and this effect was related to the amount of LAM added. With addition of 5 μg/mL LAM, adhesion to ECs at 2 and 5 dynes/cm2 was increased by 20% and 46% over baseline, respectively. Addition of 10 μg/mL LAM enhanced adhesion at these shear stresses by a mean of 154% and 249%, respectively (n=4). Furthermore, SS RBCs from patients with lower plasma LAM levels had lower baseline adhesion in the absence of added LAM. We then incubated SS RBCs with ABO-compatible SCD plasmas with either high or low LAM levels, washed these cells, and tested them for their ability to adhere to ECs. Plasmas with high LAM (n=3, LAM 4.5–8.1 μg/mL) strongly enhanced adhesion by a mean of 71.9% over baseline at 2 dynes/cm2, while those with low LAM levels (0.4–0.6 μg/mL) enhanced adhesion by only 21.1%. Finally, in order to show that it was the LAM in these plasmas that enhanced SS RBC adhesion, rather than another factor elevated in parallel with LAM, we precleared high LAM plasma with monoclonal antibody reactive with LAMs-10,-11 and anti-murine Ig-Sepharose beads and then compared the activity of this plasma to the same plasma sham precleared with only Sepharose beads. Plasma LAM levels were also assayed to confirm removal of LAM by this procedure. Plasmas from which LAMs-10,-11 had been removed failed to enhance SS RBC adhesion, while the same plasmas subjected to sham preclears increased SS RBC adhesion to ECs by 76.9% at 2 dyne/cm2 (n=2). Thus, we conclude that plasma LAM can enhance SS RBC adhesion to ECs, and elevated levels of plasma LAM may contribute to vaso-occlusion. In addition, the inverse correlation of plasma LAM levels to Hb levels further suggests a relationship between SS RBC adhesion and the severity of anemia in SCD.

Hemoglobin (Hb)-S containing red blood cells (RBCs) adhere abnormally to the vascular wall; this phenomenon is postulated to contribute to vaso-occlusive crisis and serious tissue damage. Patients homozygous for Hb S experience the most severe form of SCD, whereas heterozygous patients carrying Hb S and another hemoglobin variant, Hb C, experience somewhat milder clinical courses. Laminin is the extracellular matrix protein to which SS RBCs bind most avidly and is the ligand for the BCAM/Lu receptor. αvβ3 integrin is one of the major integrins on endothelial cells (ECs) and is the counter-receptor for LW on SS RBCs. Epinephrine activates both LW and BCAM/Lu on SS RBCs and thereby induces increased SS RBC adhesion to both ECs and laminin via a cAMP-dependent pathway. We have now compared the adhesive properties of Hb SC RBCs to SS RBCs. We measured the expression of RBC adhesion receptors, BCAM/Lu and LW, and assayed adhesion of SC RBCs to laminin and ECs (with and without prior stimulation of RBCs by epinephrine). Blood samples from Hb SC and SS patients in steady state and from normal controls (Hb AA) were collected into citrate tubes and were washed to remove plasma and buffy coat before use. The levels of BCAM/Lu and LW expression on RBCs were measured by flow cytometry using monoclonal antibodies to BCAM/Lu and anti-LW. SC RBCs expressed higher levels of BCAM/Lu (MFI 476.2, n=13) than did SS RBCs (MFI 332.3, n=33) and AA RBCs (MFI=225.5, n=16), but none of these differences were statistically significant (all p values >0.05). The levels of LW expression were also similar on AA, SC, and SS RBCs. Adhesion to laminin and ECs was measured as previously described, in a graduated height flow chamber. Non-treated, sham-treated, and epinephrine-treated RBCs were each infused into a flow chamber fitted with a slide coated with laminin or ECs. After washing at a constant rate, adherent RBCs were quantitated at points of different shear stresses. Adhesion of SC RBCs to laminin (mean of 53.1 cells/mm2 at 1 dyne/cm2, n=9) was lower than that of SS RBCs (mean of 69.0 cells/mm2 at 1 dyne/cm2, n=6, p=0.459) but was markedly higher than the adhesion seen with AA RBCs (mean of 0.03 cells/mm2 at 1 dyne/cm2, n=3, SC vs AA p=0.011). A positive correlation was found between BCAM/Lu expression and SC RBC adhesion to laminin (r=0.638, p=0.047). While epinephrine induced an increase in SC RBC adhesion to laminin in only 10% of all SC patient samples tested (compared to 50% of SS patients), epinephrine upregulated SC RBC adhesion to ECs approximately 10-fold in all samples tested (n=3). We conclude that SC RBCs represent an intermediate adhesive phenotype compared to AA and SS RBCs. While BCAM/Lu-mediated adhesion to laminin was lower on SC RBCs than on SS RBCs, unstimulated BCAM/Lu adhesive function was strikingly enhanced in relation to AA RBCs. Most importantly, epinephrine uniformly increased SC RBC adhesion to ECs, suggesting that in Hb SC disease, physiological stress may induce SC RBC adhesion and vaso-occlusive crises by mechanisms similar to those postulated to occur as a result of stress in Hb SS disease.

Painful vaso-occlusive episodes in SCD are commonly associated with infection and other less definable stressors. Since epinephrine activates sickle red cell (SS RBC) adhesion in vitro, we studied the physiologic effect of adrenoceptor signaling activation by epinephrine on SS RBC adhesion to endothelium in vivo. We also investigated whether β-adrenoceptor blockade by propranolol would reduce adhesion and vaso-occlusion. Boluses of washed fluorescently labeled human SS RBCs, treated with epinephrine or vehicle in vitro, were infused into anesthetized athymic nude mice with window chambers implanted into their dorsal skin. Intravital microscopy of contralateral subdermal microvasculature was then performed to observe the dynamic interactions between flowing human SS RBCs and non-activated endothelium. Epinephrine induced human SS RBC adhesion, with frequent postcapillary obstruction. In contrast, neither sham-treated SS RBCs nor epinephrine-treated normal RBCs adhered appreciably to endothelium. Blood flow rates in venules of mice infused with epinephrine-treated SS RBCs was dramatically decreased, with fluxes of 19667±9048 and 6622±1494 circulating RBC/min/μm2 for sham-treated and epinephrine-treated cells, respectively (p=0.0074). SS RBC trapping in lung, spleen and kidney was assessed by fluorescence microscopy of frozen tissue sections collected 30 minutes post injection. Sham-treated SS RBCs were trapped to some degree in the lungs and spleen but only minimally in the kidney. However, epinephrine treatment markedly increased SS RBC trapping in all organs. To quantitate cell survival, sham-treated and epinephrine-treated SS RBCs labeled with different fluorescent dyes were co-infused into the same mouse. Blood samples were collected at intervals after infusion and analyzed by flow cytometry. Ten minutes after infusion, the percentage of circulating sham-treated SS RBCs was 3-fold higher than for epinephrine-treated cells, thus showing an inverse relationship between the percentage of circulating SS RBCs and the degree to which these cells were trapped in the organs studied. Finally, to determine whether propranolol can block epinephrine-induced SS RBC adhesion, SS RBCs were pretreated with propranolol, followed by treatment with epinephrine, then washed before infusion. Propranolol significantly inhibited the effect of epinephrine on SS RBC adhesion, resulting in markedly decreased obstruction of postcapillary vessels. Propranolol improved epinephrine-treated SS RBC circulation, with fluxes of 18809±7868, 3560±1443 and 16722±4985 circulating RBCs/min/μm2 for propranolol-treated, epinephrine-treated, and propranolol+epinephrine-treated cells, respectively (p

We have previously found that activation of adenylate cyclase in sickle red cells (SS RBCs) results in increased RBC adhesion to cultured endothelial cells (EC) through activation of protein kinase A (PKA). Protein tyrosine phosphorylation by src family kinases, known to be present in normal RBCs, is also involved in enhancing SS RBC adhesion to EC, as inhibition of these kinases also inhibits activation of adhesion. However, in normal RBCs neither activation of adenylate cyclase nor cAMP analogs elicits a similar increase in cell adhesion. We therefore investigated whether normal and SS RBCs differed with respect to the protein kinases downstream of cAMP, such as PKA catalytic and regulatory subunits and protein tyrosine kinases p56lck, p56lyn and p72syk. We also investigated the extracellular signal regulated kinases p44 and p42 (ERK 1 and 2 respectively), which can be activated downstream of tyrosine kinases. PKA catalytic and regulatory subunits and ERK1/2 were studied after SS and normal RBCs were sham-treated or treated for 30 min with 80 μM forskolin, which activates adenylate cyclase. For protein tyrosine kinases, both SS and normal RBCs were sham-treated or treated with 1μg/ml Pertussis toxin, which suppresses Gαi-mediated inhibition of adenylate cyclase. Equal amounts of total membrane proteins were separated by polyacrylamide gel electrophoresis before transfer to nitrocellulose membrane. Protein kinases were detected in isolated membranes by immunoblotting using specific antibodies. Immunoblots showed that the levels of membrane-associated PKAcβ subunit were similar in both SS and normal RBCs and did not change after forskolin stimulation. However, treatment of SS RBCs with forskolin induced a significant reduction in membrane-bound PKARIIβ subunit. In general, dissociation of PKAR (regulatory) subunits is associated with activation of the catalytic (c) domain. In contrast, no change in the amount of membrane-bound PKARIIβ was observed when normal RBCs were treated with forskolin. These data demonstrate that PKARIIβ dissociated from PKAcβ after adenylate cyclase activation in SS RBCs, consistent with activation of PKAcβ. Our results thus suggest that activation of PKAcβ might be one of the mechanisms contributing to increased SS RBC adhesion. The amount of membrane-bound PKARIIα in SS RBCs did not change with stimulation, suggesting that PKAcα may not undergo activation as a result of forskolin stimulation. Immunoblots also showed no change in the levels of membrane-bound p56lck, p56lyn and p72syk detected before and after normal or SS RBCs were stimulated with Pertussis toxin. However, normal RBCs contained lower levels of protein tyrosine kinases, including p56lyn, p56lck and p76syk. We also found that ERK1/2 are bound to the membrane in normal and SS RBCs. The total amount of membrane-associated ERK1 (p44) is markedly higher in SS RBCs than in normal RBCs, and membrane ERK1 levels increased only in SS RBCs after stimulation with forskolin. Taken together, our results suggest that PKAcβ is activated in SS RBCs but not in normal RBCs in response to elevation of cAMP. The higher levels of src kinases in SS RBCs may also contribute to an increased adhesive response to adenylate cyclase activation compared to normal RBCs. In addition, we have obtained the first evidence that ERK1/2 is conserved in enucleated human erythrocytes and that ERK1 is recruited to bind to SS RBC membranes as a result of adenylate cyclase activation, suggesting that it might be involved in regulating cell adhesion.

Single nucleotide polymorphisms (SNPs) of the β2 adrenergic receptor (β2AR) gene (ADRB2) on chromosome 5 have been implicated in clinical variability of several cardiopulmonary disorders. Also, Hoppe et al. [2004] have recently found evidence that polymorphisms of ADRB2 correlate with the incidence of stroke in sickle cell disease (SCD). Stimulation of sickle red cell (SS RBC) adrenergic receptors by epinephrine, as well as stimulation of adenylate cyclase by forskolin, activates the B-CAM/LU laminin receptor [Hines et al. 2003]. There is also evidence that activation of B-CAM/LU on SS RBCs occurs in vivo [Zen et al. 2004]. However, SS RBCs from different individuals show variable baseline adhesion to laminin, as well as variable responsiveness to stimulation by epinephrine. We have found that butoxamine, which specifically inhibits the β2AR, blocked epinephrine-induced SS RBC adhesion by 91%, thus implicating β2ARs in activation of adhesion. Thus, we explored whether SNPs of the genes encoding β2AR (the mediator of epinephrine effects) and adenylate cyclase (a downstream effector of β2AR) affect the degree of baseline adhesion to laminin, as well as the degree to which RBCs upregulate adhesion in response to epinephrine. All samples studied were obtained from non-transfused Hb SS patients in steady state. SS RBCs from 14 of 20 patients studied showed increased adhesion in response to epinephrine, with a mean fold increase of 1.98±0.9. These results are similar to those previously described by Hines. Four SNPs of ADRB2 were examined by direct sequencing; two of these reside in the leader sequence, while the other two encode amino acid substitutions. Four intronic SNPs in ADCY6 were studied by Taqman assays. We found that the arg16gly substitution in β2AR is associated with elevation of baseline SS RBC adhesion measured at 1 dyne/cm2: arg/arg=122, arg/gly=149, gly/gly=262 (mean adherent cells/mm2, n=3, 11, 6 respectively, p=0.03 for gly/gly vs arg/arg + arg/gly). However, the arg16gly substitution was not found to be associated with a statistically significant difference either in the maximal adhesion observed after stimulation by epinephrine: arg/arg=116, arg/gly=263, gly/gly=286 (mean adherent cells/mm2), or in the fold increase observed after stimulation. In addition, two linked SNPs (HCV1244841 and RS3730070, r2=0.8) of ADCY6, which is encoded by chromosome 12, also had a statistically significant effect on baseline but not on epinephrine-stimulated SS RBC adhesion to laminin. For HCV1244841, mean baseline adhesion to laminin at 1 dyne/cm2 was 118 and 303 cells/mm2 for AA+AG and GG, respectively (n=13 and 6, p=0.007), while for RS3730070 mean baseline adhesion was 130 and 327 cells/mm2 for CC+CG and GG, respectively (n=15 and 5, p=0.01). However, these ADCY6 SNPs also showed no statistically significant effect on epinephrine-stimulated adhesion. Overall, both the β2AR and ADCY6 polymorphisms appeared to significantly affect baseline adhesion but not epinephrine-stimulated adhesion in this study. We conclude that β2AR and adenylate cyclase polymorphisms affect red cell adhesive function. We theorize that signaling pathway polymorphisms, by affecting baseline activation of SS RBC adhesion, may influence the severity of SCD.

The influence of the epithelial mucin MUC1 on T cell-mediated lysis was analysed using lymph node lymphocytes (LNL) from patients with colorectal carcinoma. LNL were stimulated with allogeneic, MUC1-transfected B cells and the bulk cultures were cloned. Alloreactive cytotoxic T cell clones were obtained which preferentially lysed MUC1-expressing targets. The majority was CD4+ and MHC-class II-restricted, and a minor group was CD8+ and MHC-class I-restricted. All the clones expressed CD3 and TCR alpha beta, and were CD56-. The capacity to preferentially kill MUC1-expressing targets was stable in several clones for up to 6 months in culture. The enhancing effect of MUC1 on the lysis was investigated in more detail. It was only seen after inhibition of O-linked glycosylation in the targets. Furthermore, this effect was completely abrogated by the monoclonal antibody 3C9, directed against the Thomsen-Friedenreich antigen (T-antigen, Gal beta 1-3GalNAc bound alpha 1-3 to Ser/Thr) as well as by the soluble disaccharide Gal beta 1-3GalNAc, but not by other similar disaccharides. The authors conclude that in their system the preferential killing of MUC1-expressing targets is due to the recognition of an internal carbohydrate epitope accessible on under-glycosylated MUC1, possibly T-antigen, by an auxiliary receptor molecule on T cells.