Search

During the neoplastic process tumour cells frequently acquire resistance to the antiproliferative signals of transforming growth factor-beta (TGF-beta). Here we examined a human hepatocellular carcinoma cell line (Hep3B-TS) sensitive to TGF-beta signalling, and a derivative line (Hep3B-TR) rendered resistant to TGF-beta by stepwise exposure to TGF-beta(1). Comprehensive molecular cytogenetic analysis revealed that the acquisition of TGF-beta-resistance by Hep3B-TR cells was due to loss of TGF-beta receptor 2 (TGFbetaRII) gene. As demonstrated by spectral karyotyping and array-based comparative genomic hybridization, and in difference to Hep3B-TS cells, which have three rearranged and two normal copies of chromosome 3 that harbour the TGFbetaRII gene, Hep3B-TR cells have four rearranged and one apparently normal chromosome 3, which nonetheless underwent a critical microdeletion at the site of TGFbetaRII gene. Gene expression analysis using an oligonucleotide microarray of 21,397 genes showed that Hep3B-TR differentially expressed 307 genes, out of which 197 and 110 were up- and down-regulated, respectively, compared to Hep3B-TS. Six of differentially expressed genes were identified as downstream targets of the tumour necrosis factor (TNF) gene, suggesting that loss of TGFbetaRII triggered activation of the TNF pathway known to be regulated by TGF-beta(1) network. On the functional level, the TGF-beta-resistant Hep3B-TR cells displayed significantly enhanced capacity for anchorage independent growth and cell migration in vitro, and also increased tumorigenicity in vivo and in vitro and in vivo tumorigenicity compared with parental sensitive cells.

To identify new antigens that are targets for the immunotherapy of prostate and breast cancer, we used expressed sequence tag and genomic databases and discovered POTE, a new primate-specific gene family. Each POTE gene encodes a protein that contains three domains, although the proteins vary greatly in size. The NH2-terminal domain is novel and has properties of an extracellular domain but does not contain a signal sequence. The second and third domains are rich in ankyrin repeats and spectrin-like helices, respectively. The protein encoded by POTE-21, the first family member discovered, is localized on the plasma membrane of the cell. In humans, 13 highly homologous paralogs are dispersed among eight chromosomes. The expression of POTE genes in normal tissues is restricted to prostate, ovary, testis, and placenta. A survey of several cancer samples showed that POTE was expressed in 6 of 6 prostate, 12 of 13 breast, 5 of 5 colon, 5 of 6 lung, and 4 of 5 ovarian cancers. To determine the relative expression of each POTE paralog in cancer and normal samples, we employed a PCR-based cloning and analysis method. We found that POTE-2α, POTE-2β, POTE-2γ, and POTE-22 are predominantly expressed in cancers whereas POTE expression in normal tissues is somewhat more diverse. Because POTE is primate specific and is expressed in testis and many cancers but only in a few normal tissues, we conclude POTE is a new primate-specific member of the cancer-testis antigen family. It is likely that POTE has a unique role in primate biology. (Cancer Res 2006; 66(1): 52-6)

We previously showed that the human AKNA gene encodes an AT-hook transcription factor that regulates the expression of costimulatory cell surface molecules on lymphocytes. However, AKNA cDNA probes hybridize with multiple transcripts, suggesting either the existence of other homologous genes or a complex regulation operating on a single gene. Here we report evidence for the latter, as we find that AKNA is encoded by a single gene that spans a 61-kb locus of 24 exons on the fragile FRA9E region of human chromosome 9q32. This gene gives rise to at least nine distinct transcripts, most of which are expressed in a tissue-specific manner in lymphoid organs. Many of the AKNA transcripts originate from alternative splicing; others appear to derive from differential polyadenylation and promoter usage. The alternative AKNA transcripts are predicted to encode overlapping protein isoforms, some of which (p70 and p100) are readily detectable using a polyclonal anti-AKNA antisera that we generated. We also find that AKNA PEST-dependent cleavage into p50 polypeptides is targeted to mature B cells and appears to be required for CD40 upregulation. The unusual capacity of the AKNA gene to generate multiple transcripts and proteins may reflect its functional diversity, and it may also provide a fail-safe mechanism that preserves AKNA expression.

We have identified an 85 kb BAC clone, 346J21, that carries a cell senescence gene (SEN16), previously mapped to 16q24.3. Transfer and retention of 346J21 in breast cancer cell lines leads to growth arrest after 8-10 cell doublings, accompanied by the appearance of characteristic senescent cell morphology and senescence-associated acid beta-galactosidase activity. Loss of transferred BAC results in reversion to the immortal growth phenotype of the parental cancer cell lines. BAC 346J21 restores senescence in the human breast cancer cell lines, MCF.7 and MDA-MB468, and the rat mammary tumor cell line LA7, but not in the human glioblastoma cell line T98G. We postulate that inactivation of both copies of SEN16 is required for the immortalization of breast epithelial cells at an early stage of tumorigenesis. Positional mapping of 346J21 shows that SEN16 is distinct from other candidate tumor suppressor genes reported at 16q24.

DNA topoisomerases contribute to various cellular activities that involve DNA. We previously identified a human nuclear gene that encodes a mitochondrial DNA topoisomerase. Here we show that genes for mitochondrial DNA topoisomerases (type IB) exist only in vertebrates. A 13-exon topoisomerase motif was identified as a characteristic of genes for both nuclear and mitochondrial type IB topoisomerases. The presence of this signature motif is thus an indicator of the coexistence of nuclear and mitochondrial type IB DNA topoisomerases. We hypothesize that the prototype topoisomerase IB with the 13-exon structure formed first, and then duplicated. One topoisomerase specialized for nuclear DNA and the other for mitochondrial DNA.

GC-binding factor 2 (GCF2) is a transcriptional repressor that decreases activity of the epidermal growth factor receptor (EGFR) and other genes. We have mapped the gene for GCF2 by fluorescence in situ hybridization (FISH) to chromosome 2q37. Sequence analysis of the GCF2 gene and cDNA showed that the gene consists of eight exons and introns and spans 73 kbp of DNA. Northern blot analysis showed that GCF2 mRNA was differentially expressed in many human tissues and cell lines. GCF2 mRNA was expressed as a 4.2 kb mRNA in most human tissues with the highest expression level in peripheral blood leukocytes and lowest expression in brain and testis. Additional transcripts of 6.6, 2.9 and 2.4 kb were found in some tissues but the only transcript detected in cancer cell lines was 4.2 kb with high levels found in seven Burkitts' lymphoma cell lines. Western blot analysis showed that GCF2 protein is present at high levels in Burkitts' lymphoma and several other cancer cell lines. GCF2 was found in both nuclear and cytoplasmic compartments in cells. Deletion mutants of GCF2 revealed that amino acids 429–528 are required for both DNA binding and repression of the EGFR promoter. Furthermore, GCF2 was able to substantially decrease activator protein 2 (AP2) enhancement of the EGFR promoter. Thus, GCF2 is a transcriptional repressor overexpressed in cancer cell lines with a role in regulating expression of the EGFR.

Signaling by the transforming growth factor (TGF)-family members is transduced from the cell surface to the nucleus by the Smad group of intracellular proteins. Because we detected alterations on the long arm of chromosome 5, we examined the status of the SMAD5 gene in human hepatocellular carcinoma (HCC) cell lines and primary HCC. In 16 cell lines, chromosome alterations of chromosome 5 were observed in nine cell lines by fluorescence in situ hybridization (FISH), and an increase in SMAD5 gene copy number relative to the ploidy level was found in eight lines. The breakpoints in unbalanced translocations and deletions frequently occurred near the SMAD5 locus, but apparently did not cause loss of SMAD5. In one cell line, where comparative genomic hybridization showed DNA copy number gain confined to the region 5q31, we detected by FISH high-level amplification of the SMAD5 gene located within the fragile site FRA5C. Semiquantitative polymerase chain reaction did not reveal changes in SMAD5 DNA levels in 15 of 17 primary HCC specimens. In 17 HCC cell lines, SMAD5 mRNA levels were either maintained or upregulated by an increase in gene dosage or another mechanism. Collectively, our results show that SMAD5 undergoes copy number gain and increased expression, rather than loss of expression, and therefore suggest that this gene does not act as a tumor-suppressor gene in HCC. The Hep-40 HCC cell line with high-level amplification and significant overexpression of SMAD5 may be useful in studying the interaction of SMAD5 with other genes.

DNA amplification in cancer cells frequently involves oncogenes whose increased expression confers a selective advantage on tumor cell growth. In an attempt to identify novel oncogenes involved in hepatocarcinogenesis, representational difference analysis (RDA) was performed using DNA from a primary human hepatocellular carcinoma (HCC) that showed high-level DNA amplifications on chromosomes 1p32 and 11q13 by comparative genomic hybridization. Ten amplification fragments were isolated by RDA, and when used to probe Southern blots of tumor DNA, there was a 5- to 50-fold increase in hybridization intensity relative to normal DNA. The sequence of one amplification product matched that of the EMS1 oncogene, which is located on chromosome 11q13 and is amplified in other cancers. We detected EMS1 amplification in 3 of 17 primary HCC. Overexpression of EMS1 mRNA was observed in 12 of 14 HCC cell lines in the absence of gene amplification or an increased copy-number of the gene. The EMS1 gene encodes cortactin, a cortical actin-associated protein that is a substrate for Src kinase and is involved in cytoskeleton organization. Alterations of the EMS1 gene that lead to overexpression of cortactin may be associated with tumor development in HCC. EMS1 amplification and overexpresion is indicative of unfavorable prognosis in several cancers and may have similar prognostic implications in liver cancer.

To search for recurrent and specific genomic alterations in human hepatocellular carcinoma (HCC), we examined 18 cell lines by comparative genomic hybridization (CGH), a molecular cytogenetic approach that allows positional identification of gains and losses of DNA sequences of the entire tumor genome. We report here a distinct pattern of multiple recurrent DNA copy-number gains and losses that include alterations frequently seen in other neoplasias as well as changes potentially specific for HCC. The most frequent gains were localized on 1p34.3-35, 1p33-34.1, 1q21-23, 1q31-32, 6p11-12, 7p21, 7q11.2, 8q24.1-24.2, 11q11-13, 12q11-13, 12q23, 17q11. 2-21, 17q23-24, and 20p11.1-q13.2. Recurrent losses were mapped on 3p12-14, 3q25, 4p12-14, 4q13-34, 5q21, 6q25-26, 8p11.2-23, 9p12-24, 11q23-24, 13q12-33, 14q12-13, 15q25-26, 18q11.2-22.2, and 21q21-22. Seventeen genomic imbalances are novel in HCC, thus extending significantly the map of genetic changes and providing a starting point for the isolation of new genes relevant in pathogenesis of liver neoplasia, as well as providing molecular probes for both diagnosis and monitoring treatment of the disease.

Neurturin is a potent neurotrophic factor closely related to glial cell line-derived neurotrophic factor (GDNF, 40% amino acid sequence identity) and, like GDNF, can promote the survival of numerous neuronal populations including sympathetic, nodose, and dorsal root ganglion sensory neurons. Both neurturin and GDNF signal through the Ret tyrosine kinase and require a glycosylphosphatidylinositol-linked coreceptor. Mutations in Ret and GDNF cause intestinal aganglionosis and renal dysplasia. Activating Ret mutations also cause multiple endocrine neoplasia syndromes (MEN2A and MEN2B). We have isolated mouse and human genomic neurturin clones. The sequence for preproneurturin is encoded by two exons. Mouse and human clones have common intron/exon boundaries. We have used interspecific backcross analysis to localize neurturin to mouse chromosome 17 near the Vav locus and fluorescence in situ hybridization analysis to localize human neurturin to the syntenic region of human chromosome 19p13.3.

Ninjurin is a novel protein that is up-regulated after nerve injury both in dorsal root ganglion (DRG) neurons and in Schwann cells. We previously reported that ninjurin demonstrates properties of a homophilic adhesion molecule and promotes neurite outgrowth from primary cultured DRG neurons. We have now found that ninjurin is widely expressed in both adult and embryonic tissues, primarily in those of epithelial origin. Aggregation assays were used to demonstrate that ninjurin-mediated adhesion requires divalent cations and is an energy-dependent process. The critical domain for ninjurin-mediated homophilic adhesion was localized to an 11-residue region (between Pro26 and Asn37) by mutagenesis and by employing synthetic oligopeptides as competitive inhibitors of ninjurin-mediated adhesion. Of particular importance are the Trp residue at position 29 and the 3 arginines in the region. Furthermore, we show that the peptide which inhibits aggregation of Jurkat cells expressing ninjurin is also capable of blocking the ability of ninjurin to promote neurite extension from DRG neurons. Using FISH analysis, the ninjurin gene was localized to human chromosome 9q22. Several genetic diseases of unknown etiology have been mapped to this region, including hereditary sensory neuropathy type 1, self-healing squamous epithelioma, split-hand/foot deformity type 1, and familial dilated cardiomyopathy.

Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) comprise a family of TGF-beta-related neurotrophic factors (TRNs), which have trophic influences on a variety of neuronal populations. A receptor complex comprised of TrnR1 (GDNFR alpha) and Ret was recently identified and found to be capable of mediating both GDNF and NTN signaling. We have identified a novel receptor based on homology to TrnR1, called TrnR2, that is 48% identical to TrnR1, and is located on the short arm of chromosome 8. TrnR2 is attached to the cell surface via a GPI-linkage, and can mediate both NTN and GDNF signaling through Ret in vitro. Fibroblasts expressing TrnR2 and Ret are approximately 30-fold more sensitive to NTN than to GDNF treatment, whereas those expressing TrnR1 and Ret respond equivalently to both factors, suggesting the TrnR2-Ret complex acts preferentially as a receptor for NTN. TrnR2 and Ret are expressed in neurons of the superior cervical and dorsal root ganglia, and in the adult brain. Comparative analysis of TrnR1, TrnR2, and Ret expression indicates that multiple receptor complexes, capable of mediating GDNF and NTN signaling, exist in vivo.

Previous work had identified a corepressor, NAB1, which represses transcriptional activation mediated by NGFI-A (also known as Egr-1, zif268, and Krox24) and Krox20. These zinc finger transcription factors are encoded by immediate-early genes and have been implicated in a wide variety of proliferative and differentiative processes. We have isolated and characterized another corepressor, NAB2, which is highly related to NAB1 within two discrete domains. The first conserved domain of NAB2 mediates an interaction with the R1 domain of NGFI-A. NAB2 represses the activity of both NGFI-A and Krox20, and its expression is regulated by some of the same stimuli that induce NGFI-A expression, including serum stimulation of fibroblasts and nerve growth factor stimulation of PC12 cells. The human NAB2 gene has been localized to chromosome 12ql3.3-14.1, a region that is rearranged in several solid tumors, lipomas, uterine leiomyomata, and liposarcomas. Sequencing of the Caenorhabditis elegans genome has identified a gene that bears high homology to both NAB1 and NAB2, suggesting that NAB molecules fulfill an evolutionarily conserved role.

The primary structure of human sorbitol dehydrogenase (SORD) was determined by cDNA and genomic cloning. The nucleotide sequence of the mRNA covers 2471 bp including an open reading frame that yields a protein of 356 amino acid residues. The gene structure of SORD spans approximately 30 kb divided into 9 exons and 8 introns. The gene was localized to chromosome 15q21.1 by in situ hybridization. Two transcription initiation sites were detected. Three Sp1 sites and a repetitive sequence (CAAA)5 were observed in the 5' noncoding region; no classical TATAA or CCAAT elements were found. The related alcohol dehydrogenases and zeta-crystallin have the same gene organization split by 8 introns, but no splice points coincide between SORD and these gene types. The deduced amino acid sequence of the SORD structure differs at a few positions from the directly determined protein sequence, suggesting allelic forms of the enzyme. High levels of SORD transcripts were observed in lens and kidney, as judged from Northern blot analysis.

Contrast-enhanced, look-up-table (LUT)-inverted digital images of DAPI-banded chromosomes after fluorescence in situ hybridization (FISH) permit direct regional chromosomal localization of the fluorescent signals of single-copy gene probes. Improved quality and resolution of chromosome banding allowed a refined localization of the erb B-3 protooncogene from chromosome band 12813 to subbands 12q13.2-13.3. This procedure can be used for direct and precise mapping of single-copy genes on both normal and cancer-cell-rearranged chromosomes.

The sphingolipid, ceramide, is a natural dietary constituent and a potent mediator of apoptosis. If left undegraded, it may induce apoptosis and cause disruption of cellular integrity. A potential mechanism to prevent ceramide-induced apoptosis in various organs may involve ceramidases that facilitate the degradation of ceramide. In this study, we first isolated and characterized the murine neutral ceramidase (N-CDase) gene, mapped its chromosomal location and determined its developmental and organ-specific expression. Then we used cultured mesangial cells as our in vitro model and mouse gastrointestinal (GI) tract as the in vivo model to determine the effects of an inhibitor of N-CDase, D-erythro-MAPP, to delineate whether N-CDase plays a role in preventing ceramide-induced apoptosis. Our results show that: (i) the structure of the murine neutral ceramidase gene is virtually identical to that of the human gene; (ii) it is localized on chromosome 19 at bands C2-C3 that is syntenic to human chromosome 10q24-26; (iii) N-CDase expression is developmentally regulated and it is expressed at high levels in cultured mesangial cells and in specific regions of the mouse small intestine; (iv) inhibition of N-CDase by D-erythro-MAPP leads to increased ceramide levels and consequent apoptosis in cultured mesangial cells; (v) mice treated with D-erythro-MAPP alone also caused apoptosis in the small intestine; and (vi) mice treated with D-erythro-MAPP prior to feeding C2 ceramide manifest markedly elevated levels of apoptosis in the GI tract raising the possibility that neutral ceramidase plays a detoxifying role against inadvertent stimulation of ceramide-induced apoptosis in organs that come in contact with this sphingolipid. We propose that N-CDase is an essential component of an innate detoxifying mechanism to prevent ceramide-induced apoptosis.

DNA amplification is associated with genomic instability, the main characteristic of cancer cells, and it frequently involves protooncogenes. Double minute chromosomes (DM) and homogeneously stained regions (HSR) are cytological manifestations of DNA amplification. Gain of chromosome 19 is a recurrent alteration in mouse hepatocellular carcinoma (HCC). In one tumor cell line established from HCC developed in myc transgenic mice, DM derived from chromosome 19 were identified by spectral karyotyping and confirmed by fluorescence in situ hybridization (FISH). A probe generated by PCR from microdissected DM was localized by FISH on normal and HCC-derived cell lines on DM and chromosome 19 at two sites separated by several medium size G-bands. This organization of DM containing amplified sequences from separate loci of the same chromosome, indicates a complex mechanism of DNA amplification, possibly involving more than one gene. DM or HSR were not previously identified in mouse HCC and adult human HCC. The recognition of these loci could lead to the cloning of new genes or identification of known genes important in development or progression of HCC.

Farber disease is an autosomal recessive disorder caused by lysosomal acid ceramidase (AC) deficiency. It commonly manifests during the first few months after birth with a unique triad of painful and progressive deformed joints, subcutaneous nodules, and progressive hoarseness. In order to understand the molecular mechanism(s) of pathogenesis of Farber disease, we isolated and characterized a full-length human AC gene, mapped its chromosomal location, determined the tissue-specific expression, and analyzed mutations in Farber disease patients. We also studied the AC-mRNA expression in gastrointestinal tumors and adjoining normal tissues. In addition, we determined the pattern of tissue-specific AC-mRNA expression in the adult mouse and during fetal development. Our results show that human AC gene consists of 14 exons and 13 introns spanning approximately 26.5 kb of genomic DNA. It is mapped to human chromosome 8p22–21.2, a region often disrupted in several cancers. The AC-mRNA is expressed in the mouse fetus from the seventh day of gestation. Interestingly, while the AC-mRNA is expressed in all segments of the normal gastrointestinal tract, none of the gastrointestinal tumor tissues had any AC-mRNA expression. We also uncovered four novel mutations in Farber disease patients that were not previously reported. Taken together, our results not only attest to the physiological importance of AC but also uncover several new mutations in Farber disease that may advance our knowledge towards establishing a genotype–phenotype correlation in this disease.

In the search for specific chromosomal alterations in human hepatocellular carcinomas (HCC), we analyzed two new HCC cell lines and identified nonrandom changes by combined G-banding and fluorescence in situ hybridization (FISH). Cell line 7703 was established from an HCC deriving from a patient in the Qidong region of China, where the incidence of HCC is very high and is associated with hepatitis-B virus infection and exposure to aflatoxin. This line has a highly rearranged karyotype eliciting complex rearrangements involving the majority of chromosomes. The second line, SK-Hep-1, derived from a liver adenocarcinoma, is less heterogeneous, having few altered chromosomes. We have characterized the majority of structural and numerical alterations and identified in both lines unbalanced translocations with the breakpoints nonrandomly involving regions 1p36 and 3p14 and gain of chromosome 6p and 8q. While gain of 6p and 8q are recurrent in HCC, translocations of 1p and 3p are described for the first time. Damage and recombination at the breakpoint sites on chromosomes 1 and 3 might have resulted in activation of proto-oncogene, formation of new oncogenic chimeric genes, or loss of tumor suppressor genes. Published by Elsevier Science Inc.

Identification of specific and primary chromosomal alterations during the course of neoplastic development is an essential part of defining the genetic basis of cancer. We have developed a transgenic mouse model for liver neoplasia in which chromosomal lesions associated with both the initial stages of the neoplastic process and the acquisition of malignancy can be analyzed. Here we analyze chromosomal alterations in 11 hepatocellular carcinomas from the c-myc/TGF-α double-transgenic mice by fluorescent in situ hybridization with whole chromosome probes, single-copy genes, and 4′-6-diamidino-2-phenylindole (DAPI-) and G-banded chromosomes and report nonrandom cytogenetic alterations associated with the tumor development. All tumors were aneuploid and exhibited nonrandom structural and numerical alterations. A balanced translocation t(5:6)(G1;F2) was identified by two-color fluorescent in situ hybridization in all tumors, and, using a genomic probe, the c-myc transgene was localized near the breakpoint on derivative chromosome der 6. Partial or complete loss of chromosome 4 was observed in all tumors with nonrandom breakage in band C2. Deletions of chromosome 1 were observed in 80% of the tumors, with the most frequent deletion at the border of bands C4 and C5. An entire copy of chromosome 7 was lost in 80% of the tumors cells. Eighty-five percent of the tumor cells had lost one copy of chromosome 12, and the most common breakpoint on chromosome 12 occurred at band D3 (28%). A copy of chromosome 14 was lost in 72%, and band 14E1 was deleted in 32% of the tumor cells. The X chromosome was lost in the majority of the tumor cells. The most frequent deletion on the X chromosome involved band F1. We have previously shown that breakages of chromosomes 1, 6, 7, and 12 were observed before the appearance of morphologically distinct neoplastic liver lesions in this transgenic mouse model. Thus breakpoints on chromosome 4, 9, 14, and X appear to be later events in this model of liver neoplasia. This is the first study to demonstrate that specific sites of chromosomal breakage observed during a period of chromosomal instability in early stages of carcinogenesis are later involved in stable rearrangements in solid tumors. The identification of the 5;6 translocation in all of the tumors has a special significance, being the first balanced translocation reported in human and mouse hepatocellular carcinoma and having the breakpoint near a tumor susceptibility gene and myc transgene site of integration. Moreover, its early occurrence indicates that this is a primary and relevant alteration to the initiation of the neoplastic process. In addition, the concordance between the breakpoints observed during the early dysplastic stage of hepatocarcinogenesis and the stable deletions of chromosomes 1, 4, 6, 7, 9, and 12 in the tumors provides evidence for preferential site of genetic changes in hepatocarcinogenesis.

International audience; Analysis of cellular DNA insert isolated from a free replicative plasmid rescued from human cells transformed with an SV40 vector plasmid revealed the presence of two arrays of repetitive DNA arranged in tandem. One sequence was homologous to the consensus sequence of the human α satellite DNA and the adjoining sequence was a satellite DNA sequence which consisted of repetitive units of 42 base pairs (bp) and was designated HR42. The degree of homology between repetitive units was about 92%. By Southern analysis the HR42 sequence was detected in HHW416, a somatic cell hybrid containing human chromosome 4, but not in HDm-5, the somatic cell hybrid which has human chromosome 14. By fluorescence in situ hybridization this repetitive DNA was assigned uniquely to the centromeric region of human chromosome 4. These results show that HR42 belongs to a subfamily of satellite I DNA specific for human chromosome 4.

In this report, we have identified, sequenced, and characterized the expression pattern of a novel human gene, mammaglobin B. Mammaglobin B (MGB2) is highly homologous to mammaglobin (MGB1), a previously characterized human gene whose expression is limited to the mammary epithelium and frequently up-regulated in human breast cancer cells. Based upon amino acid sequence similarities, both mammaglobin and mammaglobin B may be considered members of a larger, mammalian multigene family that includes rabbit uteroglobin, human Clara Cell 10-kDa protein (CC10), and the multimeric rat prostatein protein. Together with the human CC10 gene, mammaglobin and mammaglobin B are closely linked on human chromosome 11q13. However, despite their primary sequence similarity and close chromosomal proximity, the expression of mammaglobin and mammaglobin B is nonconcordant in both nonmalignant and neoplastic tissue.

BID is a proapoptotic member of the BCL-2 family of cell death regulators. BID shares sequence homology with other members of the family within a single alpha-helical domain, BH3. BH3 is required for BID to interact with BCL-2 and BAX, as well as for its function as a death agonist. We have isolated and characterized mouse Bid and human BID genomic clones. The sequence for BID is encoded within five exons. We used interspecific backcross analysis to localize Bid to the distal region of mouse chromosome 6 near the Atp6e locus. Fluorescence in situ hybridization analysis localized human BID to a syntenic human region, chromosome 22q11, close to the BCR-1 gene.

International audience

Dipeptidyl peptidase I (DPPI) is a lysosomal cysteine protease that catalyzes the sequential removal of dipeptides from the amino termini of various protein substrates. We have isolated a cDNA coding for murine DPPI from mouse thymus and spleen cDNA libraries. The deduced amino acid sequence codes for a protein of 462 amino acid residues; comparison of this deduced sequence with that of rat and human DPPI revealed 90.1% and 77.8% identity, respectively. Using DPPI cDNA, we obtained two BAC (Bacterial Artificial Chromosome) clones that contained the murine DPPI locus. The DPPI gene consists of seven exons and 6 introns, and spans approximately 20 kilobases. Using fluorescence in situ chromosome hybridization, we localized murine DPPI to chromosome 7D3-E1.1. We determined that DPPI protein is widely distributed in mouse tissues, although its relative abundance varies from tissue to tissue. In contrast to previous reports, we show here that DPPI mRNA and protein levels and enzymatic activity are unchanged during in vitro T cell activation, implying that this enzyme is not rate-limiting for granzyme processing.

Chromosomal abnormalities are the hallmark of cancer cells. Recurring and highly consistent structural and numerical alterations have been identified in a large number of leukemias, lymphomas, and solid tumors. The identification of recurrent genetic alterations and the isolation of molecular markers have clinical applications in the diagnosis and prognosis of neoplasia and in the detection of minimal residual disease that are essential for designing the most effective therapeutic approach. Polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) are powerful techniques for detection of genomic alterations. The battery of FISH methods and DNA probes that are available can resolve virtually any chromosomal alterations regardless of their complexity. Combined chromosome banding, multifluor or spectral karyotype, and comparative genomic hybridization (CGH) allow identification of structural and numerical alterations on a global basis, mapping of the DNA copy number on the entire tumor genome, complete derivation of complex rearrangements, and localization of the breakpoints of translocations and deletions. Regions of recurrent alterations can be microdissected, amplified, microclone libraries constructed and probes localized on extended chromosomes or chromatin fibers for construction of high resolution physical maps that are critical for positional cloning and gene identification. In this review we attempted to cover the current trends in cancer molecular cytogenetics, and to outline the importance of molecular chromosome analysis in the understanding of oncogenesis and its clinical applications.

Background : Two neoplastic Kaposi's sarcoma (KS) cell lines, KS Y-1 (derived from a patient with KS associated with acquired immunodeficiency syndrome) and KS SLK (derived from an immunosuppressed patient with a renal transplant and KS or iatrogenic KS), have been shown to have abnormal chromosome constitution and to require no exogenous growth factors. They produce malignant tumors in immunodeficient mice. In contrast, all other cell cultures prepared in the past from KS specimens have been shown to have normal diploid characteristics, are hyperplastic, and depend on cytokines for growth, but they do not produce malignant tumors in immunodeficient mice. Purpose : We investigated whether the chromosomal changes that occurred in these KS cell lines were random or nonrandom and if such changes contribute to the pathogenesis of KS. Methods : We used the conventional G-banding technique and fluorescence in situ hybridization to identify structural and numerical chromosomal changes in the KS cell lines. Results : We demonstrated that both cell lines are aneuploid and have some additional features in common, i.e., loss of copies of chromosomes 14 and 21 and nonrandom translocations and deletions in the short arm of chromosome 3 at region 3p14. These KS cell lines also exhibit loss of heterozygosity of loci at region 3p14-ter. Conclusion : This is the first time nonrandom chromosomal alterations have been described in KS neoplastic cells. On the basis of information available on other cancers, the chromosome 3 alterations observed here can be expected to contribute to the neoplastic process in KS. Implications : Future research should focus on the identification of cytogenetic markers, thus facilitating generation of specific molecular probes for detecting neoplastic cells early in the disease process.

Human macrophage metalloelastase (HME) is a recent addition to the matrix metalloproteinase (MMP) family that was initially found to be expressed in alveolar macrophages of cigarette smokers. To understand more about HME expression, analysis of the structure and location of the gene was performed. The gene for HME is composed of 10 exons and 9 introns, similar to the stromelysins and collagenases, and HME shares the highly conserved exon size and intron-exon borders with other MMPs. The 13-kilobase (kb) HME gene has been localized by fluorescence in situ hybridization to chromosome 11q22.2-22.3, the same location of the interstitial collagenase and stromelysin genes. We determined that HME and stromelysin 1 genes are physically linked within 62 kb utilizing pulse-field gel electrophoresis. The promoter region of the HME gene contains several features common to other MMP genes including a TATA box 29 bp upstream to the transcription initiation site, an AP-1 motif, and a PEA3 element. HME mRNA is not detectable in normal adult tissues but is induced in rapidly remodeling tissues such as the term placenta. In situ hybridization and immunohistochemistry of placental tissue demonstrated HME mRNA and protein expression in macrophages and stromal cells. Cell-specific expression and response to inflammatory stimuli such as endotoxin is conferred within 2.8 kb of the HME 5′-flanking sequence as demonstrated by HME promoter-CAT expression constructs. Knowledge of the genomic organization and chromosomal location of HME may allow us to further define mechanisms responsible for cell- and tissue-specific expression of HME.

The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21.more » Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.« less

A Polish family was identified in which multifocal clear cell renal carcinoma segregated with a balanced constitutional chromosome translocation, t(2:3)(q33;q21), similar to the renal cell cancer-associated t(2;3)(q35;q21) reported in a Dutch family. Bacterial artificial chromosome (BAC) contigs encompassing the 2q and 3q breakpoints were constructed and BACs crossing the breakpoints were partially sequenced. All known regional markers, genes, and expressed sequence tags (ESTs) were mapped relative to the contigs, as well as to the breakpoint sequences. Two single ESTs mapped within the 2q breakpoint BAC, whereas the repeat-rich 3q breakpoint region was gene poor. Physical mapping suggested that the 3q break was in 3q13, possibly near the border with 3q21. Physical mapping illustrated that the 2q break was closely telomeric to the 2q31 FRA2G site, consistent with the G-band assignment. Characterization of full-length cDNAs for the ESTs near the 2q break will determine if a gene(s) is altered by this familial translocation.