Search

Rationale: Radiation enteritis (RE) is one of the serious complications caused by the radiotherapy and it can occur in any segment of the intestine, including small intestine, colon, and rectum. It can cause a number of serious problems of the intestine, such as chronic ulcers, bleeding, intestinal stenosis, intestinal fistula, and perforation. At present, there is no standard treatment guideline for the RE. Patient Concerns: A 54-year-old male patient received surgery and chemotherapy for rectal cancer and radiofrequency ablation (RFA) for a single metastatic carcinoma of the liver. Three years later, he was diagnosed with recurrent lesion in the rectal anastomotic stoma and was treated with radiotherapy with a total dose of 70 Gy. Following this, he had persistent abdominal pain and diarrhea for 1 year. Diagnoses: Colonoscopy confirmed a diagnosis of RE. Interventions: Since intestinal probiotics, intestinal mucosal protectants, antidiarrheal drugs, and other treatments were not effective; the patient was treated by RFA. Outcomes: Clinical symptoms of the patient were gradually decreased after the RFA. Colonoscopy examination was performed 3 months later and intestinal mucosa was found to have healed well. Lessons: RFA is an effective treatment for patients with RE, and it is expected to be one of the standard treatments for the RE.

Background: Facioscapulohumeral muscular dystrophy (FSHD), a common autosomal dominant muscular disorder, is caused by contraction of the D4Z4 repeats on 4q35. The complicated genotype-phenotype correlation among different ethnic population remains a controversial subject. We aimed to refine this correlation in order to provide new information for genetic counseling. Methods: Here, a cohort of 136 Chinese families including 178 affected individuals and 137 unaffected members were investigated. Genetic analyses were performed using the p13E-11, 4qA and 4qB probes after pulsed field gel electrophoresis separation and southern blotting. A 10-grade FSHD clinical severity scale was adopted for clinical assessment. The genotype-phenotype correlation was established by linear regression analyses. Results: We observed a roughly inversed correlation between the short EcoRI fragment size and age-corrected clinical severity score in 154 symptomatic patients (P < 0.05). Compared to male patients, a significant higher proportion of females in both asymptomatic carriers and severe patients showed larger variation in the size of short EcoRI fragment. A high incidence (19/42, 45.2%) of asymptomatic (or minimally affected) carriers was found in familial members. Conclusions: Although the number of D4Z4 repeats is known as one of the critical influences on genotype-phenotype correlation, a majority of phenotypic spectrum was still incompatible with their heterozygous contraction of the D4Z4 repeat, especial in female cases. Our results suggest that there are multi-factors synergistically modulating the phenotypic expression.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations ( c.82G > A p.D28N , c.185T > C p.L62P , c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G > A ) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2 , which facilitates the understanding of the genotype–phenotype correlation of IBGC.

Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 ( IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711+1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.

Background Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. Methods Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. Results Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype–phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. Conclusion The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.

Paroxysmal kinesigenic dyskinesia is the most common type of paroxysmal movement disorder and is often misdiagnosed clinically as epilepsy. Using whole-exome sequencing followed by Sanger sequencing, we identified three truncating mutations within PRRT2 (NM_145239.2) in eight Han Chinese families with histories of paroxysmal kinesigenic dyskinesia: c.514_517delTCTG (p.Ser172Argfs*3) in one family, c.649dupC (p.Arg217Profs*8) in six families and c.972delA (p.Val325Serfs*12) in one family. These truncating mutations co-segregated exactly with the disease in these families and were not observed in 1,000 control subjects of matched ancestry. PRRT2 is a newly discovered gene consisting of four exons encoding the proline-rich transmembrane protein 2, which encompasses 340 amino acids and contains two predicted transmembrane domains. PRRT2 is highly expressed in the developing nervous system, and a truncating mutation alters the subcellular localization of the PRRT2 protein. The function of PRRT2 and its role in paroxysmal kinesigenic dyskinesia should be further investigated.

The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Here we wish to address this issue. A total of 476 subjects from Chinese Han ethnic population were investigated, including 152 control individuals and 324 patients with cerebral infarction. Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Data were analyzed using a statistical package. The R219K genotype frequency distributions were significantly different between patients with atherothrombotic cerebral infarction (ACI) and control individuals, with fewer KK genotypes and more RR genotypes in ACI patients (chi(2)=9.89, P

This study aimed to evaluate the effects of cysteamine supplementation on the expression of jejunal amino acid and peptide transporters and intestinal health in finishing pigs. Sixty barrows were allocated into two experimental diets consisting of a basal control diet supplemented with 0 or 142 mg/kg cysteamine. After 41 days, 10 pigs per treatment were slaughtered. The results showed that cysteamine supplementation increased the apparent digestibility of crude protein (CP) (P 0.05) and the trypsin activity in jejunal digesta (P 0.01). Cysteamine supplementation also increased the messenger RNA abundance of SLC7A7, SLC7A9 and SLC15A1, occludin, claudin-1 and zonula occludens protein-1 (P 0.001) in the jejunum mucosa. Increased glutathione content (P 0.01) and glutathione peroxidase activity (P 0.05) and decreased malondialdehyde content (P 0.01) were observed in pigs receiving cysteamine. Additionally, cysteamine supplementation increased the concentrations of secretory immunoglobulin A (IgA) (P 0.05), IgM (P 0.001) and IgG (P 0.001) in the jejunal mucosa. It is concluded that cysteamine supplementation could influence protein digestion and absorption via increasing trypsin activity, enhancing the digestibility of CP, and promoting the expression of jejunal amino acid and peptide transporters. Moreover, cysteamine improved intestinal integrity, antioxidant capacity and immune function in the jejunum, which were beneficial for intestinal health.

The aim of this study was to investigate the effects of alanyl-glutamine (Ala-Gln) on skeletal muscle protein synthetic and degradative signaling in piglets challenged with Escherichia coli lipopolysaccharide (LPS).Piglets were arranged in a 2 × 2 factorial design and the main effects were LPS challenge (0 or 100 units) and diets (0.62% Ala or 0.5% Ala-Gln). After treatment with either Ala or Ala-Gln for 10 d, piglets were injected twice with either saline or LPS on days 11 and 15.During days 11 to 15 (postchallenge), LPS challenge affected the growth performance of piglets. Ala-Gln supplementation tended to alleviate the reduction of the average daily weight gain (P = 0.071) and the average daily feed intake (P = 0.087) of the LPS-challenged piglets. LPS challenge increased the concentrations of cytokines in plasma (P 0.05), however, Ala-Gln supplementation prevented the elevation of cortisol induced by LPS challenge (P 0.05). Moreover, Ala-Gln supplementation increased the mRNA expressions of insulin-like growth factor-1 signaling and Akt (P 0.05). Ala-Gln supplementation also increased the phosphorylation abundance of the mammalian target of rapamycin, eIF-4 E binding protein 1 and ribosomal protein S6 kinase 1 (P 0.05). Additionally, Ala-Gln supplementation down-regulated the mRNA abundances of toll-like receptor 4 (TLR4), muscle atrophy F-box, and muscle RING finger 1, which are associated with protein degradation induced by LPS challenge.Ala-Gln supplementation had beneficial effects in improving protein synthesis signaling of skeletal muscle, and reversed the deleterious changes of signaling molecules in muscle atrophy mainly through down-regulation of Akt/FOXO and TLR4 signaling pathways induced by LPS challenge.

Under global cerebral ischemia, the effect of different brain temperature on cerebral ischemic injury was studied. Male Sprague-Dawley rats were divided into normothermic (37-38°C) ischemia, mild hypothermic (31-32°C) ischemia, hyperthermic (41-42°C) ischemia and sham-operated groups. Global cerebral ischemia was established using the Pulsinelli four-vessel occlusion model and brain temperature was maintained at defined level for 60 min after 20-min ischemia. The expression of c-fos protein and the levels of malondialdehyde (MDA) and lactate in brain regions were detected by immunochemistry and spectrophotometrical methods, respectively. C-fos positive neurons were found in the hippocampus and cerebral cortex after cerebral ischemia reperfusion. Mild hypothermia increased the expression of c-fos protein in both areas, whereas hyperthermia decreased the expression of c-fos protein in the hippocampus at 24 h reperfusion, and the cerebral cortex at 48 h reperfusion when compared to normothermic conditions. In normothermic, mild hypothermic and hyperthermic ischemia groups, the levels of MDA and lactate in brain tissue were increased at 24, 48 and 72 h reperfusion following 20-min ischemia as compared with the sham-operated group (P

Current studies of facioscapulohumeral muscular dystrophy (FSHD) are confined to the white population. The authors surveyed 110 healthy individuals and 27 families with FSHD including 55 patients and 74 relatives by pulsed-field gel electrophoresis. The authors report the characteristics of translocation and genotype-phenotype correlation, and their results indicate 4q to 10q translocation contributes to the occurrence of de novo mutation. This leads to a more severe phenotype in the Chinese population comparing to EcoRI allele sizes and the intersexual difference.

Background As a lethal autosomal recessive hereditary disorder, childhood spinal muscular atrophy (SMA) is caused by mutations of the survival motor neuron 1 (SMN1) gene. Most of the patients died at early stage or were seriously disabled, which accounts partly for the scarcity of two continuous generations with SMA. Increasing evidence indicated that SMN2 copy number was a modifier of SMA, but in majority of sporadic patients, the bias of phenotype judgments may largely reduce the accuracy of genotype–phenotype analysis. Methods We presented two families with SMN1-deleted individuals in two continuous generations, the father and daughter of family 1 and the mother and daughter of family 2 were determined to be homozygous for the deletion of the SMN1 gene. Quantitative analysis of SMN1 and SMN2 was carried out by real-time fluorescence quantitative PCR and multiplex ligation-dependent probe amplification. Results Quantitative analysis showed that the father of family 1 possessed three copies of SMN2, and his daughter had only two SMN2 copies; the slightly affected mother of family 2 had three copies of SMN2, but her sick daughter had only two copies of SMN2; we also performed prenatal prediction for family 1 and a healthy boy was born under our suggestion. Conclusion For the phenotypes of patients from different generations within the same family are obviously different, the results of a genotype–phenotype analysis may be more convincing, which strongly support the hypothesis that SMN2 is an important modifier for SMA, and SMN2 copy number should be considered in the prenatal diagnosis situation.

Multiple acyl-CoA dehydrogenation deficiency (MADD) is an autosomal recessive disease affecting amino acid, fatty acid, and choline metabolisms and is a common genetic defect responsible for lipid storage myopathy. Most forms of MADD are caused by a deficiency of electron transfer flavoprotein (ETF) or ETF dehydrogenase (ETFDH). However, its molecular feature has not been found uniformly in previous reports of Chinese patients. A large cohort of 56 late-onset MADD patients from 51 unrelated pedigrees in southern China was recruited to investigate a clear correlation between clinical phenotype and molecular genetic basis. All exons of ETFA, ETFB, and ETFDH, including the intron–exon boundaries, and 5′ and 3′ untranslated regions were directly sequenced. ETFDH deficiencies affected 94.1% (48/51) of the pedigrees. ETFDH-c.250G>A is the most common mutation, representing a high allelic frequency of 83.3% (80/96). Carrier frequency of c.250G>A is estimated to be 1.35% (7/520) in the normal population. A significant reduced expression of ETFDH was identified in the muscle of ETFDH-deficient patients. ETFDH deficiency is a major cause of riboflavin-responsive MADD in southern China, and c.250G>A is an important mutation that could be employed as a fast and reliable screening method.

To investigate the characteristics of gene structure in facioscapulohumeral muscular dystrophy (FSHD)-related 4q35 subtelomere, to analyze the distribution of 2 alleles (4qA and 4qB) distal to D4Z4 of this locus, and to further elucidate the genotype-phenotype correlation in Chinese Han FSHD patients.Peripheral blood samples were collected from 52 unrelated families including 62 FSHD-affected and 57 unaffected members. Genomic DNA was extracted from the lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoRI or HindIII, or double digested with EcoRI and BlnI. The cleaved DNA was separated by pulsed field electrophoresis (PFGE) and Southern blotting with the probes p13E-11, 4qA, and 4qB. The size of FSHD-causing 4qA allele and its distribution was analyzed by "curve fitting". Then the characteristics of translocation and mosaicism, the frequencies of two allelic variants of chromosome 4q and their genotypes were calculated to analyze the genotype-phenotype correlation.It was found that 69 patients carried a short chromosome 4-type allele of 4qA origin with the length 10-38 kb. The mean length of these pathogenic EcoRI/4qA arrays was 20 kb+/-7 kb, without significant difference between the sporadic cases and familial cases (t=1.413, P0.05). Three different translocation types were observed with a translocation rate of 14.49%. The rate of 4q--10q translocation was 13.04%, significantly higher than that of 10q--4q translocation (1.45%, chi2=6.900, P0.05). Somatic mosaicism was detected in a male sporadic case and a female asymptomatic familial case. In 57 cases with standard configuration distribution, the frequency of 4qA/4qB heterozygote was 61.40%, significantly higher than that of 4qA/4qA homozygote (38.60%, (chi2=5.930, P0.05). There were not significant differences in the repeat size distributions and assessment of clinical severity between the sporadic and familial cases (t=-0.039, P0.05; H=0.693, P0.05).About 95% of Chinese FSHD patients carry a pathogenic 4-type allele of 4qA origin less than 30 kb long. The frequent translocations between chromosome 4q and 10q may play an essential role for FSHD mechanism. The frequency of 4qA/4qB heterozygote is significantly higher than that of 4qA/4qA homozygote, while the allelic variant genotypes do not contribute to modify FSHD manifestations.

Wilson disease (WD) is an autosomal recessive disorder of copper metabolism. To establish an efficient, accurate and fast diagnostic method for carrier detection and presymptomatic identification of WD in Chinese population, we studied haplotypes of short tandem repeat (STR) polymorphisms flanking the WD gene in 40 Chinese WD families. The results suggested that this genetic diagnosis system based on the four STR polymorphisms is of high value for the detection of potential carriers and WD homozygotes in families with at least one previously affected child. It is an efficient, accurate and fast diagnostic method that can be well suited for routine use in clinical laboratories.

Our objective was to investigate the association between senataxin mutations and sporadic amyotrophic lateral sclerosis (ALS) in Chinese patients. DNA from 45 sporadic ALS patients was screened for mutations in senataxin using polymerase chain reaction (PCR) and direct sequencing. A novel variation, Thr1118Ile, was identified in a 42-year-old individual with sporadic ALS. This variation was not detected in 200 unrelated control individuals. In conclusion, the presence of this variation in a patient with sporadic ALS, and its absence in 200 controls, supports an association between senataxin and sporadic ALS. This study has broadened the mutation spectrum of senataxin and expanded the clinical phenotypes of senataxin mutations.

Background Neuroglobin (Ngb), one of novel members of the globin superfamily, is expressed predominantly in brain neurons, and appears to modulate hypoxic-ischemic insults. The mechanisms underlying Ngb-mediated neuronal protection are still unclear. For it is one of the candidate protective factors for ischemic stroke, we conducted a case-control study to clarify the association of Ngb polymorphisms with ischemic stroke in the Southern Chinese Han population. Methods 355 cases and 158 controls were recruited. With brain imaging, cases were subdivided into large-artery atherosclerosis (LVD) and small-vessel occlusion (SVD) stroke. PCR amplified all the four exons of Ngb and flanking intron sequence for each exon. Genotyping for Ngb was achieved by direct sequencing and mismatched PCR-RFLP. Polymorphisms were studied both individually and as haplotypes in each group and subgroup which subdivided according to gender or age. Results Two intronic polymorphisms 89+104 c>t and 322-110 (6a)>5a were identified. The allele frequency of 89+104 t was decreased in stroke cases. The protective effect seems to be more pronounced in subgroups of female patients and age > 60 years. Also, we have confirmed decreased LDL-C level and reduced hypertension and hypercholesterolemia in 89+104 t allele carriers. In contrast, the 322-110 (6a)>5a genotype distribution was similar between cases and controls. However, the haplotype 89+104 c>t/322-110 (6a)>5a was related with LVD and SVD stroke. The haplotype c-5a was more frequent in both LVD and SVD groups while t-6a was more frequent in controls. Conclusion Ngb polymorphism 89+104 t had protective effects on LVD and SVD in the Southern Chinese Han population. A "hitchhiking" effect was observed for the 89+104 t/322-110 (6a) genotype combination especially for LVD.

The symptomatic treatment of dopa-responsive dystonia (DRD) emphasizes the importance of molecular analyses of the GCH-1, TH and parkin genes. However, these analyses have not been extensively studied in Chinese DRD patients. Ten DRD families from the Han ethnic group including 14 patients and 28 clinically unaffected relatives were screened for GCH-1, TH and parkin mutations by direct sequencing, semiquantitative polymerase chain reaction (PCR), polymerase chain reaction-restriction fragment length polymorphism analysis and allele-specific PCR. Variations were verified in 200 unrelated control subjects. We have identified six novel mutations and three known mutations. The novel mutations are Leu91Val, Pro95Leu, Val204Gly and 628delC in GCH-1 gene; Gly216Ser in TH gene; and Cys253Phe in parkin gene. After molecular analyses of seven families with identified GCH-1 mutations, nine asymptomatic cases were found among 23 relatives, which confirmed the low penetrance of DRD. Unlike previous publications, male patients with GCH-1 mutations have early onset ages, while some female patients have very late onset ages in this medium-size series. Our data show that it is difficult to establish an evident genotype-phenotype correlation for DRD. However, it is necessary to know the genetic defects of DRD patients in clinics, which will help elucidate the mode of inheritance, facilitate causal therapy with levodopa and evaluate the prognosis.

To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes.Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls.Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P0.05).Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.

To analyze two alleles (4qA and 4qB) distal to D4Z4 of the 4q subtelomere in Chinese population, and to elucidate the interrelationship between these variants of 4qter and facioscapulohumeral muscular dystrophy (FSHD).Eighty unrelated healthy individuals from a random Chinese Han population were investigated. The genomic DNA was extracted from peripheral blood lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoRI, HindIII or double digested with EcoRI and BlnI. The cleaved DNA was separated by pulsed field gel electrophoresis (PFGE) and Southern blotting with the probes p13E-11, 4qA and 4qB. The sizes of 4q35 EcoRI/4qA and EcoRI/4qB arrays were obtained by "curve fitting", and the frequencies of alleles and genotypes were calculated. Data were analyzed using a commercially available statistical package (Version 13.0 SPSS).In normal individuals, frequencies of 4qA and 4qB alleles (46.9% and 53.1%) were observed of no significant difference (chi(2) = 1.250, P0.05). The frequency of 4qA/4qB heterozygote was much higher than that of homozygote (P0.05). The means of EcoRI/4qA and EcoRI/ 4qB arrays (115.8+/-11.9 kb and 98.3+/-8.6 kb) were of significant difference (t=23.04, P0.001). 8.8% (7/80) of the individuals displayed a translocation repeat array configuration. 4qB-type EcoRI arrays smaller than 35 kb were found in two individuals.The structural polymorphism of 4qA/4qB alleles within 4q35 and 10q26 is confirmed using PFGE in normal Chinese Han population. Although both alleles are almost equally common, shorten 4qB-type EcoRI fragment is not pathogenic. The frequency of 4qA/4qB heterozygote is significantly higher than that of homozygote.

Background The difficulties and incurability of spinal muscular atrophy (SMA) highlight the importance of prenatal diagnosis in families with SMA. However, the system applied in prenatal screening is far from perfect. Objectives To optimize the molecular assays and establish a relatively perfect system for prenatal screening. Design, Setting, and Patients A total of 87 patients and 132 parents from 77 families with SMA were screened for SMN1 mutations. Prenatal prediction was performed for 11 fetuses from 10 families with SMA. All of the samples to be tested were from the Department of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, China. Main Outcome Measures All of the 87 patients and their parents were screened for SMN1 deletion by restriction fragment length polymorphism analysis and denaturing high-performance liquid chromatography (DHPLC). For those patients without the SMN1 deletion, the SMN1 copy numbers were detected by real-time fluorescence quantitative polymerase chain reaction and the subtle mutations of SMN were screened by direct sequencing. Prenatal prediction was performed by restriction fragment length polymorphism analysis, DHPLC, and linkage analysis for 11 fetuses. Furthermore, the SMN1 copy numbers and detected carriers of SMA were found by DHPLC and real-time fluorescence quantitative polymerase chain reaction in 14 parents and the fetuses without the SMN1 deletion. Results in aborted fetuses and born babies were reconfirmed by restriction fragment length polymorphism analysis and DHPLC. The born babies were followed up and physically examined twice a year. Results The frequency of the SMN1 deletion we detected was 93.5% (72 of 77 patients). No subtle mutations were detected in the other 5 families. Four fetuses had the SMN1 deletion and were aborted. The other 7 fetuses, 4 carriers and 3 normal individuals, were born under suggestion by the physician. Fourteen parents were carriers. The reconfirmation of results in the aborted fetuses and born babies was completely consistent with prenatal prediction. The 7 born babies were followed up until recently and all were normal. Conclusions The molecular diagnosis system based on restriction fragment length polymorphism analysis, DHPLC, and linkage analysis is an efficient and accurate method that is well suited for routine use in clinical laboratories.

To investigate the clinical characteristics and GCH I gene mutations in patients with dopa-responsive dystonia (DRD).The clinical features of 3 families with 6 affected members and 8 sporadic cases were analyzed to determine the clinical characteristics, and 2 families with 4 affected members and 2 sporadic cases were screened for mutations of the GCH I gene.Age at onset was (10 +/- 3) years. Onset occurred earlier in female (9 +/- 4) years than in male (12 +/- 1) years. The initial symptom was a gait disorder, dystonia or tremor in most patients and nine patients (64%) presented with diurnal fluctuation. Thirteen patients (93%) were cured and one was improved after administration of low doses of levodopa for 3 months and no long-term side effects of levodopa had occurred. Two independent mutations were found in three patients. Gln161Pro, a new missense mutation, was found in a sporadic case, leading to a relatively severe phenotype. The two patients with mild phenotype in one family were found to have Lys224Arg mutation, as previously described.DRD patients have diverse phenotypes and diurnal fluctuation is an important feature. They have dramatic and sustained response to levodopa. There may be a correlation between genotype and phenotype. The detection of GCH I mutations is helpful in early diagnosis of non-typical cases.

To construct a method for detecting the copy number of survival of motor neuron 1 gene (SMN1) with single copy difference based on real-time fluorescence quantitative PCR, and to make practical use of the method for acquiring the data on SMN1 copy number in Chinese as well as for screening the carriers of spinal muscular atrophy (SMA) from healthy individuals and SMA families.Exon 7 and flanking area of SMN1 gene were amplified by real-time fluorescence quantitative PCR in 264 healthy individuals, in 1 standard sample having 2 SMN1 but having no SMN2, and in 88 parents of SMA patients. The samples for detecting were diluted to 30 ng/microL and the standard sample was diluted to 15 ng/microL, 30 ng/microL, 45 ng/microL, 60 ng/microL; the unknown samples and 4 standard samples with different concentrations were amplified at the same time, a standard curve could be drawn out according to the results of the 4 standard samples, then the copy number of samples could be calculated.Of 88 parents' samples, 84 samples each had 1 copy of SMN1, and the rest 4 each had 2 copies of SMN1. Of 264 healthy individuals' samples, 5 samples each had only 1 copy of SMN1 (an indicator of definite gene carriers), 232 samples each had 2 copies of SMN1, 25 samples each had 3 copies of SMN1, and 2 samples each had 4 copies of SMN1. Of the samples of 32 members of SMA families, 2 samples each had only 1 copy of SMN1 indicating definite gene carriers, 25 samples each had 2 copies of SMN1, and 5 samples each had 3 copies of SMN1.SMN1 copy number could be detected precisely by real-time fluorescence quantitative PCR; the screening of gene carriers could provide essential data for genetic counseling.

To elucidate the structural polymorphism of EcoR I fragment within chromosomes 4q35 and 10q26 in the Chinese population and investigate the relationship of plasticity, translocation and somatic mosaicism in these domains with deletion of D4Z4 repeated units.One hundred and ten unrelated healthy individuals from a random Chinese population were investigated. The genomic DNA was extracted from peripheral blood lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoR I or double digested with EcoR I and Bln I. The cleaved DNA was separated by pulsed field gel electrophoresis (PFGE) and Southern blotted with the probe p13E-11. The sizes of EcoR I fragments were calculated by "curve fitting" according to the MidRange PFG marker and the alleles were assigned to their respective chromosomes based on their Bln I sensitivity. Data were analyzed using a commercially available statistical package (Version 11.0 SPSS).Seventy-seven point three per cent (85/110) of the unrelated healthy individuals displayed a standard configuration distribution. The mean and median of 4q35 repeat arrays are (87.9+/-3.3) kb and 78.5 kb respectively, whereas the mean and median of 10q26 homologous arrays are (90.1+/-4.1) kb and 73.0 kb. Repeat size distributions between both of them were of no significance according to the t test (P0.05). 19.1% (21/110) of the individuals displayed a translocation repeat array configuration on chromosomes 4 and 10. No significant difference was detected between 4q--10q translocation and 10q--4q translocation according to Chisquare test (Chi2 test=0.053, P0.05). Somatic mosaicism was observed in 3.6% (4/110) of the subjects and less than 35 kb 10-type array was found in 14.5% (16/110) of the individuals.The structural polymorphism and dynamic behaviors of EcoR I fragments within 4q35 and 10q26 were demonstrated in this study using PFGE. The occurrence of frequent translocations and somatic mosaicism between 4q35 and 10q26 subtelomeric domains in the Chinese population further confirmed that mitotic interchromosomal gene conversion or translocation might be a major mechanism relating to the deletion of D4Z4 units.

To study the changes of the intramembrane protein particles of erythrocyte from Duchenne muscular dystrophy (DMD) patients and the gene carriers and to explore the pathogenesis of DMD and the diagnostic value of erythrocyte freeze-fracture technology.The fixed erythrocyte mass was treated to form replica membrane by means of the freeze-fracture technology. Then the replica membrane was observed and a picture was taken under electron microscope. The protein particles of extracellular face(EF) and protoplasmic face(PF) per square were counted. The statistical comparative analysis was performed.The protein particle counts of EF face and PF face of erythrocyte membrane from DMD patients and DMD carriers decreased obviously in comparison with the normal control group (P0.001).The erythrocyte freeze-fracture electron microscopic technology may serve as a method for accessory examination of diagnosing DMD patients and a method for detecting DMD carriers. This investigation material supplies reliable evidence for the theory of the systemic membrane defect of DMD.

To investigate the translocation between chromosomes 4q and 10q and its putative correlation with facioscapulohumeral muscular dystrophy (FSHD).Double digestion of the genomic DNA of 50 controls and 45 FSHD cases, 16 cases of sporadic FSHD and 19 cases of familial FSHD from 7 families, with restriction enzymes BglII and BlnI was followed by separation and Southern blotting with the probe p13E-11. By Scion Image program, the density of hybridized fragments was analyzed and the 4q:10q density ratio was then calculated to infer the types of 4q-10q translocation. The frequencies of translocation among the controls, sporadic FSHD cases, and familial cases were compared.In the 95 subjects 4 different translocation types were detected with a translocation rate of 17.89%. Both the rate of 4q--10q translocation and the rate of 10q--4q translocation were 8.0% among the healthy controls. Only 4q--10q translocation was found in sporadic FSHD cases with a frequency of 43.75%, while only 10q--4q translocation was found in familial FSHD patients with a frequency of 6.89%. The frequency of 4q--10q translocation in the sporadic FSHD cases was significantly higher than that in the control group (chi(2) = 11.154, P0.001), while the frequency of 10q--4q translocation in the familial FSHD cases was not significantly different from that in the controls (chi(2) = 0.012, P0.5).Frequent translocations between chromosomes 4q and 10q occur in normal population and FSHD cases, while the 4q--10q translocation is only related to sporadic FSHD. Excessive loss or conversion (to 10q26) of 4q35 D4Z4 repeats, caused by 4q-10q interactions, may be essential for the mechanism of this disorder.

To investigate the correlation between genotype and phenotype of patients with Wilson disease (WD) in the Chinese population.Using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and subsequent direct sequencing to identify the mutations of ATP7B. Statistical analysis was performed using t test or chi(2) test.The common mutation Arg778Leu was homozygous in 18 patients. It was also found to be heterozygous in 29 patients. 11 of 29 patients who carried another missense mutation in the other chromosome were regarded as Arg778Leu compound heterozygotes. We observed that the average age at onset in Arg778Leu homozygotes was significantly younger than that in Arg778Leu compound heterozygotes (P0.05). The average ceruloplasmin level of Arg778Leu homozygotes was significantly lower than that of Arg778Leu compound heterozygotes (P0.001).The result shows that Arg778Leu homozygotes are associated with the early onset of WD with hepatic presentation. The Arg778Leu mutation is not a mild mutation. It has severe effects on the function of ATP7B.

Background The potential for therapy for Wilson disease (WD) emphasizes the importance of presymptomatic diagnosis in families with WD (WD families). Objectives To investigate the feasibility of presymptomatic DNA diagnosis and evaluate the efficacy of zinc sulfate therapy in WD families. Methods Seventy-eight clinically unaffected siblings were studied from 51 unrelated WD families that were ascertained by affected individuals. The diagnosis in presymptomatic patients was established by a combination of direct mutational analysis and haplotype analysis with 3 short tandem repeat markers. The presymptomatic patients were treated with 50 mg of elemental zinc sulfate twice a day from the time of molecular diagnosis and followed up for 3 to 5 years. Results Of the 78 siblings, 17 were diagnosed as presymptomatic patients. Kayser-Fleischer rings were absent in 7 and faint in 4 of the 17 presymptomatic patients. The serum ceruloplasmin values gradually increased and 24-hour urinary copper values gradually diminished during zinc therapy, which indicate effective control of copper metabolism. None of the siblings developed clinical symptoms of WD or adverse effects from zinc therapy. Conclusion We conclude that presymptomatic DNA diagnosis and zinc therapy are effective treatment of patients with WD.

The defective gene (ATP7B) that causes Wilson disease (WD) codes for a putative copper-transporting P-type adenosine triphosphatase. After cloning of ATP7B, the spectrum of mutations and their clinical consequences have been investigated in patients with WD in different ethnic populations. However, the spectrum of mutations and the correlation of genotype-phenotype in the Chinese population have not been extensively studied.To investigate the characterization of mutations of ATP7B and the correlation between genotype and phenotype in the Chinese population.We studied 60 unrelated healthy Chinese and 65 unrelated Chinese families, including 84 patients with WD and 126 parents. Genomic DNA was prepared from peripheral blood leukocytes using a salt-precipitation method. Polymerase chain reaction single-strand conformation polymorphism and subsequent direct sequencing were used to identify the mutations and polymorphisms of ATP7B. Statistical analysis was performed using t test or chi(2) test.We identified 18 mutations (7 novel) and 11 polymorphisms (3 novel). The novel mutations are -36C--T, Trp650ter, Gln914ter, 2810delT, Thr935Met, Arg1041Pro, and Glu1173Lys. The novel polymorphisms are 1168A--G (Ile390Val), 2785A--G (Ile929Val), and 3316G--A (Val1106Ile). Two mutations, Arg778Leu and Thr935Met, are relatively frequent, representing 37.7% and 10.0% of patients, respectively. To our knowledge, we are the first to report the correlation between the genotype and phenotype of Arg778Leu. The result shows that Arg778Leu homozygotes are associated with the early onset of WD with hepatic presentation.The Arg778Leu and Thr935Met mutations are hot spots in the Chinese population. The features of mutations of ATP7B differ between the Chinese and Western ethnic populations. The Arg778Leu mutation has severe effects on the function of ATP7B. These findings are valuable for developing a fast and effective method to diagnose the presence of the WD gene.