Search

Primary central nervous system lymphoma (PCNSL) is an isolated type of lymphoma of the central nervous system and has a dismal prognosis despite intensive chemotherapy. Recent genomic analyses have identified highly recurrent mutations of MYD88 and CD79B in immunocompetent PCNSL, whereas LMP1 activation is commonly observed in Epstein–Barr virus (EBV)-positive PCNSL. However, a lack of clinically representative preclinical models has hampered our understanding of the pathogenic mechanisms by which genetic aberrations drive PCNSL disease phenotypes. Here, we establish a panel of 12 orthotopic, patient-derived xenograft (PDX) models from both immunocompetent and EBV-positive PCNSL and secondary CNSL biopsy specimens. PDXs faithfully retained their phenotypic, metabolic, and genetic features, with 100% concordance of MYD88 and CD79B mutations present in PCNSL in immunocompetent patients. These models revealed a convergent functional dependency upon a deregulated RelA/p65-hexokinase 2 signaling axis, codriven by either mutated MYD88/CD79B or LMP1 with Pin1 overactivation in immunocompetent PCNSL and EBV-positive PCNSL, respectively. Notably, distinct molecular alterations used by immunocompetent and EBV-positive PCNSL converged to deregulate RelA/p65 expression and to drive glycolysis, which is critical for intracerebral tumor progression and FDG-PET imaging characteristics. Genetic and pharmacologic inhibition of this key signaling axis potently suppressed PCNSL growth in vitro and in vivo. These patient-derived models offer a platform for predicting clinical chemotherapeutics efficacy and provide critical insights into PCNSL pathogenic mechanisms, accelerating therapeutic discovery for this aggressive disease. Significance: A set of clinically relevant CNSL xenografts identifies a hyperactive RelA/p65-hexokinase 2 signaling axis as a driver of progression and potential therapeutic target for treatment and provides a foundational preclinical platform.

Purpose: Oligodendroglioma has a relatively favorable prognosis, however, often undergoes malignant progression. We hypothesized that preclinical models of oligodendroglioma could facilitate identification of therapeutic targets in progressive oligodendroglioma. We established multiple oligodendroglioma xenografts to determine if the PI3K/AKT/mTOR signaling pathway drives tumor progression. Experimental Design: Two anatomically distinct tumor samples from a patient who developed progressive anaplastic oligodendroglioma (AOD) were collected for orthotopic transplantation in mice. We additionally implanted 13 tumors to investigate the relationship between PI3K/AKT/mTOR pathway alterations and oligodendroglioma xenograft formation. Pharmacologic vulnerabilities were tested in newly developed AOD models in vitro and in vivo. Results: A specimen from the tumor site that subsequently manifested rapid clinical progression contained a PIK3CA mutation E542K, and yielded propagating xenografts that retained the OD/AOD-defining genomic alterations (IDH1R132H and 1p/19q codeletion) and PIK3CAE542K, and displayed characteristic sensitivity to alkylating chemotherapeutic agents. In contrast, a xenograft did not engraft from the region that was clinically stable and had wild-type PIK3CA. In our panel of OD/AOD xenografts, the presence of activating mutations in the PI3K/AKT/mTOR pathway was consistently associated with xenograft establishment (6/6, 100%). OD/AOD that failed to generate xenografts did not have activating PI3K/AKT/mTOR alterations (0/9, P < 0.0001). Importantly, mutant PIK3CA oligodendroglioma xenografts were vulnerable to PI3K/AKT/mTOR pathway inhibitors in vitro and in vivo—evidence that mutant PIK3CA is a tumorigenic driver in oligodendroglioma. Conclusions: Activation of the PI3K/AKT/mTOR pathway is an oncogenic driver and is associated with xenograft formation in oligodendrogliomas. These findings have implications for therapeutic targeting of PI3K/AKT/mTOR pathway activation in progressive oligodendrogliomas.

In the revised World Health Organization classification 2016, anaplastic pleomorphic xanthoastrocytoma (PXA) has been newly defined as a variant of the PXA entity. Furthermore, some anaplastic PXA were reported to have extremely poor prognosis which showed a type of pediatric glioblastoma (GBM) molecular profile. Recent integrated molecular classification for primary central nervous system tumors proposed some differences between histological and molecular features. Herein, in a genome‐wide molecular analysis, we show an extreme aggressive anaplastic PXA that resulted in a pediatric GBM molecular profile. A full implementation of the molecular approach is the key to predict prognosis and decide the treatment strategy for anaplastic PXA.

Partial deletions in chromosomes 1p and 19q are found in a subset of astrocytic tumors; however, it remains unclear how these alterations affect their histological features and prognosis. Herein, we present 3 cases of isocitrate dehydrogenase (IDH)-mutant astrocytoma with chromosome 19q13 deletion. In the first case, the primary tumor harbored an IDH1 mutation with chromosome 1p/19q partial deletions, which covered 19q13 and exhibited a durable initial response to radiotherapy and temozolomide (TMZ) treatment. However, the tumor lost the chromosome 1p/19q partial deletions at recurrence and became resistant to TMZ. Histologically, an oligodendroglioma-like feature was found in the primary tumor but not in the recurrent tumor. Capicua transcriptional repressor (CIC), located on 19q13, was less expressed in the primary tumor but was highly expressed in the recurrent tumor. Similar histological findings were observed in 2 other astrocytic tumors with IDH1 or IDH2 mutations. These tumors also had chromosome 19q13 deletion, including the CIC gene, weakly expressed CIC, and oligodendroglioma-like morphology. These tumors recurred at 6 and 32 months, respectively. These findings suggest that IDH-mutant astrocytoma with chromosome 19q13 partial deletion, including the CIC gene, may induce an oligodendroglioma-like phenotype, but the clinical prognosis may not be similar to that of genetically defined oligodendroglioma.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Hemangiopericytoma/solitary fibrous tumor (HPC/SFT) is a perivascular mesenchymal tumor often found unexpectedly on histopathological examination, and occasionally shows malignant behavior. The incidence of intraoral HPC/SFT is extremely rare. We report a case of HPC/SFT located in the buccal mucosa. A 50-year-old woman presented with a 5-year history of a painless mass in the left buccal mucosa. Clinical findings showed the lesion was a well-defined tumor between the cheek skin and buccal mucosa with two feeding arteries, indicating hemangioma. The tumor was completely resected under general anesthesia. Histopathologically, immunostaining for STAT6 revealed results consistent with HPC/SFT, and no findings suggestive of malignancy, such as tumor size greater than 5 cm and high proliferative activity as shown by mitotic index and Ki-67 index. No other distinct primary lesion or distant metastasis was detected on whole-body computed tomography. Dealing with the lesion as a precancerous or potentially malignant tumor, follow-up was performed for 5 years after surgery, but neither recurrence nor metastasis was observed. As recurrence or metastasis may be delayed by many years, follow-up needs to be continued long-term according to risk factors of malignant behavior such as tumor size, cell characteristics and proliferative activity.

Succinate dehydrogenase-deficient renal cell carcinoma (SDH-deficient RCC) is a newly introduced histological type of RCC, which is caused by loss of subunit genes of SDH. It is known to frequently demonstrate familial occurrence and be frequently associated with gastrointestinal stromal tumors and paraganglioma. To date, only 53 cases have been reported. Here, we present an additional case of SDH-deficient RCC occurring in a 40-year-old female. The tumor was histologically biphasic, consisting of tubular and solid architectures. The tumor cells possessed oval nuclei with small nucleoli, and an eosinophilic granular cytoplasm with occasional vacuoles. These cells completely lost the immunohistochemical expression of B subunit of SDH (SDHB). Consequently, the tumor was diagnosed as SDHB-deficient RCC. We identified a novel germ line mutation of the SDHB gene, and also confirmed a hemizygous deletion of the wild-type allele in the tumor cells. To define the pathological characteristics of SDH-deficient RCC, precise diagnosis and accumulation of more cases are required.

Small cell lung cancer (SCLC) is one of the most malignant neoplasms in common human cancers. The tumor is composed of small immature-looking cells with a round or fusiform shape, which possesses weak adhesion features among them, suggesting that SCLC shows the morphological characteristics of epithelial to mesenchymal transition (EMT). SCLC is characterized by high metastatic and recurrent rates, sensitivity to the initial chemotherapy, and easy acquirement of chemoresistance afterwards. These characters may be related to the EMT phenotype of SCLC. Notch signaling is an important signaling pathway, and could have roles in regulating neuroendocrine differentiation, proliferation, cell adhesion, EMT, and chemoresistance. Notch1 is usually absent in SCLC in vivo, but could appear after chemotherapy. Notch1 can enhance cell adhesion by induction of E-cadherin in SCLC, which indicates mesenchymal to epithelial transition. On the other hand, achaete-scute complex homologue 1 (ASCL1), negatively regulated by Notch signaling, is a lineage-specific gene of SCLC, and functions to promote neuroendocrine differentiation as well as EMT. ASCL1-transfected adenocarcinoma cell lines induced neuroendocrine phenotypes and lost epithelial cell features. SCLC is characterized by neuroendocrine differentiation and EMT-like features, which could be produced by inactive Notch signaling and ASCL1 expression. In addition, chemical and radiation treatments can activate Notch signaling, which suppress neuroendocrine differentiation and induces chemoradioresistance, accompanied by secession from EMT. Thus, the status of Notch signaling and ASCL1 expression may determine the cell behaviors of SCLC partly through modifying EMT phenotypes.

Epithelioid glioblastoma (E-GBM) predominantly arises at younger age and promotes dismal prognosis. Because of its rare etiology, pathological and genetical characterization of E-GBM remains elusive. Herein, we report unique patient-derived E-GBM xenograft (PDX) models from 3 E-GBM patients (2 BRAFV600E mutant and 1 BRAFV600E wild-type). Two BRAF mutant E-GBM cells (YMG62 and YMG89) were originated from adolescent and young adult patients and harbored TERT promoter mutation and CDKN2A homozygous deletion, while 1 BRAFV600E E-GBM cell (YMG64) was from elderly patient and had TERT wild-type. YMG62 and YMG89 could be propagated at multiple passage in vitro, while YMG64 could not be maintained. PDX models were established from YMG62, YMG89, and YMG64. All PDX tumors were preferentially disseminated and negative expression of GFAP, which were recapitulated to the patient characteristics. BRAF and MEK inhibitor mildly suppressed cell viability in vitro. Collectively, E-GBM PDX models recapitulate patient characteristics, which may be helpful to elucidate tumor biology and establish novel therapeutic target in E-GBM.

Leukoencephalopathies encompass all clinical syndromes that predominantly affect brain white matter. Genetic diagnosis informs clinical management of these patients, but a large part of the genetic contribution to adult leukoencephalopathy remains unresolved. To examine this genetic contribution, we analyzed genomic DNA from 60 Japanese patients with adult leukoencephalopathy of unknown cause by next generation sequencing using a custom-designed gene panel. We selected 55 leukoencephalopathy-related genes for the gene panel. We identified pathogenic mutations in 8 of the 60 adult leukoencephalopathy patients (13.3%): NOTCH3 mutations were detected in 5 patients, and EIF2B2, CSF1R, and POLR3A mutations were found independently in 1 patient each. These results indicate that cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) caused by NOTCH3 mutations is the most frequent adult leukoencephalopathy in our cohort. Moreover, brain imaging analysis indicates that CADASIL patients who do not present typical phenotypes may be underdiagnosed if not examined genetically.

Ependymomas are primary neuroepithelial malignancies that mainly occur during childhood, and arise from ependymal cells along the ventricular systems of the CNS. Recently, it was elucidated that two-thirds of supratentorial (ST) ependymomas harbor oncogenic fusions of RELA, whose protein product is the principal effector of canonical NF-κB signaling. RELA fusion proteins activate signaling for tumor proliferation and malignant progression, resulting in poorer prognoses in these patients compared to those in patients with other ST ependymomas. In this study, we encountered a case of C11orf–RelA fusion-positive ST anaplastic ependymoma that was diagnosed in first tumor resection surgery of multi-staged gross total resection with molecular evidence. In ependymomas, regardless of tumor location or pathological grade, subtotal resection is associated with higher rates of mortality compared with GTR. Molecular analysis based on the application of recent molecular knowledge for ST ependymomas performs a role in appropriate and individualized treatment strategies.

Gap junction intercellular communication (GJIC) is considered to play roles in regulation of homeostasis, development and differentiation of many tissues. In the present study, using reverse transcription-polymerase chain reaction (RT-PCR) and in situ RT-PCR, we examined expression of Connexins (Cx26, 32, 37, 40, 43 and 45) in the normal lung and lung tumors of mice to determine whether their expressions change during lung tumorigenesis. Cx26, 32 and 40 were expressed similarly in the normal lung tissue and tumors with smaller size (0.5–1.5 mm) though expression of Cx32 and 40 decreased in tumors with larger size (>2.5 mm). Cx26 was undetectable in larger size tumors. Cx37 and 45 were expressed in both normal lung and larger size tumors but no expression was seen in smaller size tumors. Cx43 was similarly detectable in normal lung, smaller size tumor and larger size tumor, but western blotting showed that Cx43 was phosphorylated during lung tumorigenesis. Thus, it is likely that alteration of expression of these Cx may be involved in expression of the neoplastic phenotype.

A 45-year-old man complained of a palpable mass in his left abdomen. Computed tomography showed a horseshoe kidney with a Bosniak type II complicated cyst from a left segment. Three years after his initial examination, due to the growing cystic lesion and the compression imposed on the urinary collecting system and surrounding organs, we performed a left heminephrectomy. The diagnosis was mucinous cystadenoma of the kidney. No recurrence was observed 6 months after surgery. The histopathology was unique since the inner surface of the cyst was covered by a mucin-positive columnar epithelium connected to a urothelium, with continuous transition between the two. This suggests that the mucinous tumour may have originated from a sequestered segment of the renal pelvic epithelium in the renal parenchyma.

Objectives: To evaluate the effects of the nerve-muscle pedicle (NMP) method on the rat thyroarytenoid (TA) muscle after transection of the recurrent laryngeal nerve (RLN). Study Design: Quantitative histologic assessment of the TA muscle after NMP implantation. Methods: Thirty-six Wistar rats were divided into two groups: animals subjected to transection of the left RLN alone (DNV group) and animals subjected to transection of the left RLN followed by immediate transplantation of a NMP flap containing the sternohyoid (SH) muscle and ansa cervicalis nerve branch (NMP group). Animals were killed 2, 4, and 10 weeks after the treatments. The TA muscle stained with hematoxylin-eosin was evaluated quantitatively. The pre- and postsynaptic structures of the neuromuscular junction (NMJ) in the TA muscle were analyzed histochemically. The myosin heavy chain (MyHC) isoforms were evaluated using immunohistochemistry and reverse-transcriptase polymerase chain reaction (RT-PCR). Results: In the NMP group, the TA muscle fiber recovered to almost normal at 10 weeks, and the ratio of the number of synaptophysin-positive nerve terminals to that of α-bungarotoxin-positive acetylcholine receptors recovered to 79.8 ± 11.8% (P < .05, compared with the control). Immunohistochemistry and the RT-PCR method after laser capture microdissection revealed the expression of MyHC isoforms type 2B and type 2A; the latter was detected in the SH muscle but not in the normal or denervated TA muscle. Conclusion: The NMP method was effective for recovering from the atrophic changes of the TA muscle after transection of the RLN. This was attributed to successful reinnervation by reconstruction of the NMJ, which might change MyHC isoform expression.

Trichoblastic carcinoma is a rare skin cancer originating from hair germ cells. We report a case of an 84-year-old man who presented with a tumor on the stoma of the descending colon, which was preoperatively diagnosed as colon cancer. He underwent colectomy with adjacent skin, and the tumor was diagnosed as trichoblastic carcinoma by postoperative pathological examination. We are not aware of any similar cases published in the English literature. Therefore, we report this case because it is quite a rare condition.

Afferent loop necrosis after Roux-en-Y cholangiojejunostomy biliary reconstruction is rare. We present the case of a 36-year-old woman with acute necrotic afferent loop obstruction. The peripheral area of the Roux-en-Y limb, including the cholangiojejunostomy portion, was twisted just proximal to the cholangiojejunostomy. Cholangiojejunostomy was completely separated due to necrosis of the Roux-en-Y jejunum. In addition to the case report, we discuss features of cholangiojejunostomy that require special attention.

Semaphorin III/collapsin-1 (Sema3A) guides a specific subset of neuronal growth cones as a repulsive molecule. In this study, we have investigated a possible role of non-neuronal Sema3A in lung morphogenesis. Expression of mRNAs of Sema3A and neuropilin-1 (NP-1), a Sema3A receptor, was detected in fetal and adult lungs. Sema3A-immunoreactive cells were found in airway and alveolar epithelial cells of the fetal and adult lungs. Immunoreactivity for NP-1 was seen in fetal and adult alveolar epithelial cells as well as endothelial cells. Immunoreactivity of collapsin response mediator protein CRMP (CRMP-2), an intracellular protein mediating Sema3A signaling, was localized in alveolar epithelial cells, nerve tissue and airway neuroendocrine cells. The expression of CRMP-2 increased during the fetal, neonate and adult periods, and this pattern paralleled that of NP-1. In a two-day culture of lung explants from fetal mouse lung (E11.5), with exogenous Sema3A at a dose comparable to that which induces growth cone collapse of dorsal root ganglia neurons, the number of terminal buds was reduced in a dose-dependent manner when compared with control or untreated lung explants. This decrease was not accompanied with any alteration of the bromodeoxyuridine-positive DNA-synthesizing fraction. A soluble NP-1 lacking the transmembrane and intracellular region, neutralized the inhibitory effect of Sema3A. The fetal lung explants from neuropilin-1 homozygous null mice grew normally in vitro regardless of Sema3A treatment. These results provide evidence that Sema3A inhibits branching morphogenesis in lung bud organ cultures via NP-1 as a receptor or a component of a possible multimeric Sema3A receptor complex.

To elucidate the role of p53 and apoptosis in the pathogenesis of lung injury, we examined histological changes, expressions of p53 and p21waf1/cip1 (p21), apoptosis, DNA double strand breaks, cell kinetics, and DNA synthesis in C57/BL6 mice (p53+/+) and mice deficient for p53 (p53−/−) at 2 hours to 7 days after a single intravenous administration of bleomycin. We also compared these parameters between the lung cells and small intestinal epithelial cells to explore potential differences in their response to DNA damage. Bleomycin induced p21 expression in a p53-dependent manner in p53+/+ mice but neither p53 nor p21 expression in p53−/− mice. In the lung of both groups of mice, focal inflammation followed by fibrosis was observed, but there was no evidence of apoptosis. Cells with DNA breaks and those undergoing DNA synthesis were unequivocally increased, but the cycling cell fraction remained unchanged, suggesting that the DNA synthesis detected in the lung reflected unscheduled DNA synthesis for repair of damaged DNA. DNA breaks and unscheduled DNA synthesis were prolonged in p53−/− mice compared to p53+/+ mice. By contrast, in the small intestine, marked cell cycle arrest and extensive apoptosis were evoked in the cycling crypt cells of both groups of mice, but these changes were milder and DNA breaks remained detectable for a longer time in p53−/− mice than in p53+/+ mice. Among the resting enterocytes in the villi, apoptosis was observed almost equally in both groups, but repair of DNA breaks was significantly delayed in the p53−/− mice. These observations imply that apoptosis is mediated largely by the p53-dependent pathway in the crypts but exclusively by the p53-independent pathway in the villi, that this pathway is particularly important in DNA repair in the villi, and that despite this difference in the significance of apoptosis, p53 plays an important role in DNA repair in both the crypts and villi. Our results suggest that the lung cells and small intestinal cells respond to the bleomycin treatment in different ways in terms of the induction of apoptosis and that p53 carries out an essential role in the early response to and repair of DNA damage by a non-apoptotic mechanism which appears to be crucial in the noncycling lung cells and enterocytes. Importantly, the p53-p21 pathway and apoptosis are unlikely to be essential for bleomycin-induced tissue injury in the lung.

In order to ascertain that alpha-subunit of guanine nucleotide-binding protein Go (Go alpha)-positive cells in the lung epithelia are pulmonary neuroendocrine cells (PNECs), we carried out an immunohistochemical study in young adult and fetal lungs of rodents and in cultured fetal lung explants. Serial sections showed that Go alpha-positive cells were immunostained for calcitonin gene-related peptide and serotonin in young adult mouse, rat, and hamster lungs and that these cells are, therefore, PNECs. In the fetal lungs of hamster and mouse, Go alpha-positive PNECs appeared in the epithelium of the lobar bronchus by gestational day 13 in hamster and by day 15.5 in mouse, and they increased with a proximal-to-distal wave during the late fetal period. Explants of immature lung from the fetal hamster on gestational day 11 were cultured. After 2 days of culture, Go alpha-positive PNEC clusters appeared in the main and lobar bronchi and many PNEC clusters were seen after 4 days of culture. To determine the functional significance of Go in the development of the fetal lung, pertussis toxin, a Go inhibitor, was added to the medium, and changes in branching morphogenesis and PNEC development were studied. Although branching morphogenesis was not disturbed by pertussis toxin, the toxin treatment induced large PNEC clusters in the cultured lung explant. In summary, we showed that Go alpha is a neuroendocrine marker for PNECs and that Go alpha-positive cells appear along with development of PNECs in fetal hamster lung in vivo and in vitro. The functional significance of Go in the development of fetal lung is obscure, but signals mediated through this GTP-binding protein could be related to some functions of PNECs.

To clarify the process and mechanisms of the development and progression of peripheral lung adenocarcinoma, we investigated the relationships among the patterns of basement membrane (BM), stromal fibrosis, and the expressions of gelatinase A and tissue inhibitor of metalloproteinases-2 (TIMP-2) in 33 lesions of atypical alveolar cell hyperplasia (AAH) and 48 lesions of lung adenocarcinoma, including 24 lesions of bronchioloalveolar carcinoma (BAC). We found that the architecture of alveolar BM was intact in all 33 AAH lesions and 11 nonsclerosing BAC lesions that formed no central scar, suggesting that these lesions are early-stage intraepithelial neoplasia. The preexistent BM of the lung was disrupted, and the BM components around the neoplastic glands were disrupted or absent in the area of the central scar of some sclerosing BAC lesions with collapse fibrosis alone (2 of 4) and in those of all of the adenocarcinoma lesions associated with desmoplastic stromal fibrosis (nine sclerosing BAC and 24 non-BAC tumors). These results suggested that, in lung adenocarcinomas, destruction of the BM was correlated with the formation of a central scar, particularly with desmoplasia. It is likely that adenocarcinomas with a central scar are advanced and invasive cancers potentially having metastatic activity. The expression of gelatinase A and TIMP-2 was associated with central scar formation as well as with destruction of the BM components. Both the neoplastic and stromal cells expressed gelatinase A and TIMP-2 and probably play a role in tumor cell invasion.

We have examined the distribution of calcium-binding proteins (CaBPs) in adult and fetal lungs of Syrian golden hamsters (Mesocricetus auratus) using immunostaining with confocal laser microscopy and electron microscopy. Single and grouped (neuroepithelial body; NEB) endocrine cells were distributed from bronchi to alveolar ducts in the adult lung. Serial frozen sections immunostained for CaBPs in combination with immunostaining for endocrine markers such as calcitonin gene-related peptide, serotonin, PGP9.5, and synaptophysin revealed that positive immunostaining for calbindin-D28K (CB-D28K) was seen in single endocrine cells and NEBs. However, other so-called EF-hand family CaBPs, parvalbumin and calretinin, were not detected. Electron microscopically, positive immunoreaction for CB-D28K was mainly in the organelle-free cytoplasmic matrix of endocrine cells, and partly in nuclei and associated with secretory granules and endoplasmic reticulum. In fetal developing lungs, endocrine cells appeared first on gestational day 13, and they were positive for all the endocrine markers used. However, pulmonary endocrine cells were positively immunostained for CB-D28K from gestational days 15 and 16 onward. In summary, our observations suggest that CB-D28K is a useful marker for endocrine cells of the lung, and CB-D28K could function as a mediator of endocrine stimulation or calcium homeostasis in pulmonary endocrine cells.

The subcellular localization of five isoforms of facilitated-diffusion glucose transporters (GLUTs), from GLUT1 to GLUT5, in rat pancreatic islets was studied by immunohistochemistry using rabbit polyclonal antisera against mouse or rat GLUT peptides. Animals were perfusion-fixed with phosphate-buffered 4% paraformaldehyde and the pancreases were removed. Some specimens were embedded in paraffin, serially sectioned, and immunostained for glucagon, insulin, somatostatin, and the GLUTs for light microscopic observation. Others were prepared for immunoelectron microscopy by the post-embedding method. By these methods, GLUT2 immunostaining was observed on the lateral membranes of pancreatic beta-cells, whereas GLUT3 immunoreaction was predominantly localized in the cytoplasm of beta-cells and was not found in alpha-cells. In contrast, GLUT5 immunostaining was preferentially localized in the cytoplasm of alpha-cells compared to that of beta-cells. However, GLUT1 and GLUT4 were either barely or not at all detectable in any cells. These results suggest that rat islets take up glucose by at least three different processes and that blood glucose levels could be modulated differentially by: a high Km glucose transporter, GLUT2, in beta-cells; by a low Km glucose transporter, GLUT3, in beta-cells; and by a low Km glucose transporter, GLUT5, in alpha-cells.

We examined the immunolocalization of stage-specific embryonic antigen-1 (SSEA-1) and related antigens in the developing trachea and lungs of fetal hamsters both in vitro and in vitro. On gestational days 10-16 (the day ot birth), fetal tracheas and lungs were fixed in phosphate-buffered paraform-aldehyde and frozen. Frozen sections were incubated with monoclonal antibodies against SSEA-1 (Lex hapten), sialyl SSEA-1 carrying i antigen and fucosyl SSEA-1 (LeYhapten). Some sections were treated with FITC-labeled secondary antibody for observation by confocal laser microscopy, and others were treated with colloidal gold-labeled secondary antibody for ultrastructural observation. In the developing tracheas, preferential staining in the ventral and lateral tracheal epithelium appeared for all of the antibodies by day 15, and ultrastructural study demonstrated that the regional difference in staining occurred regardless of cell type. In the developing lungs, positive sialyl SSEA-1-i antigen immunostaining was seen in the terminal portion of the epithelium by day 14, and the staining disappeared during the postnatal period. An in vitro study using explant organ culture of gestational day-11 lung with trachea revealed similar immuno-localization patterns. In the cultured trachea, the regional difference in immuno-staining was also seen with development of cartilage and smooth muscle, and in the cultured lung, the staining intensity became stronger in the terminal epithelium than in larger airway epithelium.

Calcitonin gene-related peptide (CGRP) is one of the major neuropeptides released from sensory nerve endings and neuroendocrine cells of the lung. Two CGRP isoforms, alpha-and beta-CGRP, have been identified in rats and humans, but no studies have attempted to reveal direct evidence of differences in action or location of these isoforms in allergic inflammation (AI). We investigated mRNA expressions of alpha-and beta-CGRP in lungs, nodose ganglia (NG), and dorsal root ganglia (DRG) of an animal model for AI of the airways, utilizing a model created by sensitizing Brown Norway (BN) rats with ovalbumin (OVA). By semiquantitative RT-PCR analysis, long-lasting enhanced expression of the beta-CGRP mRNA was shown in the lungs of the AI rats (14.5-fold enhancement at 6 hr, 8.1-fold at 24 hr, and 3.7-fold at 120 hr after OVA-challenge compared to the level in the lungs of phosphate-buffered saline (PBS)-challenged control rats). In contrast, the mRNA expression of the alpha-CGRP in AI lungs showed only a transient increase after OVA-challenge (2.7-fold at 6 hr) followed by a lower level of expression (0.5-fold at 48 hr and 0.6-fold at 120 hr). The mRNA expressions of both isoforms in NG, but not in DRG, were transiently up-regulated at 6 hr after antigen challenge. In situ RT-PCR in combination with immunohistochemical analysis revealed that beta-CGRP was expressed in neuroendocrine cells in clusters (termed neuroepithelial bodies [NEBs]) in AI lungs. These results indicate that the long-term induction of beta-CGRP in NEBs may play an important role in pulmonary AI such as bronchial asthma.

To clarify the mechanisms that regulate neuroendocrine differentiation of fetal lung epithelia, we have studied the expression of the mammalian homologs of achaete-scute complex (Mash1) (Ascl1 – Mouse Genome Informatics); hairy and enhancer of split1 (Hes1); and the expression of Notch/Notch-ligand system in the fetal and adult mouse lungs, and in the lungs of Mash1- or Hes1-deficient mice. Immunohistochemical studies revealed that Mash1-positive cells seemed to belong to pulmonary neuroendocrine cells (PNEC) and their precursors. In mice deficient for Mash1, no PNEC were detected. Hes1-positive cells belong to non-neuroendocrine cells. In the mice deficient in Hes1, in which Mash1 mRNA was upregulated, PNEC appeared precociously, and the number of PNEC was markedly increased. NeuroD (Neurod1 – Mouse Genome Informatics) expression in the lung was detected in the adult, and was enhanced in the fetal lungs of Hes1-null mice. Expression of Notch1, Notch2, Notch3 and Notch4 mRNAs in the mouse lung increased with age, and Notch1 mRNA was expressed in a Hes1-dependent manner. Notch1, Notch2 and Notch3 were immunohistochemically detected in non-neuroendocrine cells. Moreover, analyses of the lungs from the gene-targeted mice suggested that expression of Delta-like 1 (Dll1 – Mouse Genome Informatics) mRNA depends on Mash1. Thus, the neuroendocrine differentiation depends on basic helix-loop-helix factors, and Notch/Notch-ligand pathways may be involved in determining the cell differentiation fate in fetal airway epithelium.

We report a fatal case of death due to unusual aspiration of sardine fry in an elderly Japanese man with lung cancer. The cause of death was sudden respiratory arrest while eating. Autopsy revealed peculiar materials with cell nests and pigmented particles, together with striated muscle and skin, in the ectatic bronchioles of the left lower lobe. Serial histologic sections suggested that the structures observed were the eyeballs of small animals that appeared to have been inhaled. The patient had habitually eaten sardine fry and rice gruel, which were also detected in the gastric contents. Therefore, the eyes were considered to be those of the fry, which is a popular food item in Japan. This was confirmed by histologic examination of fry that were obtained commercially.

Excessive stimulation of insulin secretion may be one cause of the beta-cell dysfunction induced by hyperglycemia. We investigated a possible link between the prior endogenous hypersecretion of insulin and this dysfunction by performing a 7-day glucose infusion (50% wt/vol, 1.2 ml/h) on ventromedial hypothalamic VMH-lesioned hyperinsulinemic rats. Intravenous glucose tolerance tests (i.v.GTT 1.0 g/kg) revealed that a 3-day glucose infusion enhanced the insulin responses in both the sham- and VMH-lesioned rats compared with saline infusions. A similar 7-day glucose infusion enhanced the insulin response to glucose in sham-lesioned rats but not in VMH-lesioned rats. Batch-incubation of islets isolated from sham-lesioned rats showed an enhanced insulin response to glucose after 7 days of glucose treatment compared with the saline infusions. Conversely, the glucose infusion in VMH-lesioned rats markedly suppressed the in vitro insulin response. In sham- and VMH-lesioned rats, similar islet insulin contents were produced by saline and glucose treatments. Electron microscopy revealed that glucose infusions impaired the granule-releasing function of the beta-cells in VMH-lesioned rats, while insulin synthesis was accelerated in either group. These findings support the notion that excessive secretion is partly responsible for the beta-cell dysfunction induced by hyperglycemia without signs of exhaustion.

The pulmonary tumorigenicity of dimethylarsinic acid (DMAA), a main metabolite of inorganic arsenics, was examined in A/J mice fed with drinking water containing DMAA for 25 and 50 weeks. Mice fed with 400 ppm DMAA for 50 weeks produced more pulmonary tumors than untreated mice (mean number per animal 1.36 versus 0.50; P < 0.05). Histological examination revealed that the number of mice which bore adenocarcinomas or papillary adenomas correlated with the concentration of DMAA given (untreated versus 400 ppm; P = 0.002), suggesting that DMAA could promote tumorigenic processes. These results are consistent with the epidemiological studies on the pulmonary carcinogenesis of arsenics and suggest that DMAA alone can act as a carcinogen in mice.

The expression of gap junction protein was examined immunohistochemically using affinity-purified antibody against rat liver gap junction protein, connexin 32 (Cx32), in the kidneys of fetal (gestation days 13-16) and adult Syrian golden hamsters. Phalloidin histochemical staining, PNA- and RCA I-lectin staining, NCAM immunostaining, and alkaline phosphatase and Na(+)-K(+)-ATPase enzyme-histochemical staining were performed in combination with Cx32 immunostaining. The kidney sections were observed with a confocal scanning laser microscope. By gestation day 13, Cx32 immunoreactivity was observed in the differentiating tubules. The Cx32 staining was localized on the lateral cell membrane of the cells lining the developing proximal tubules, while the S-shaped bodies, developing distal tubules, and collecting tubules showed no positive immunostaining. As the kidney developed, the density of Cx32 immunoreactivity increased. As the gap junction provides pathways for cell-cell communication, the development of Cx32 expression may imply that this structure plays an important role in renal tubule development. Confocal scanning laser microscopy provided a clear image of the fluorescence-labeled cell structures, free from out-of-focus blur. Using the same sections, stereoscopic images were easily reconstructed from serial optical sections, and were helpful in understanding the spatial distribution of Cx32 expression in the developing fetal proximal tubules.