Search

Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification.

The aim of this study was to compare different fluoroquinolones against Campylobacter spp., analysing the molecular mechanisms of resistance. Moxifloxacin exhibited the greatest activity of the quinolones tested, being active against isolates carrying a single mutation in the gyrA gene. High resistance levels to moxifloxacin were related to the presence of a double gyrA mutation.

The evolution of antimicrobial resistance in Salmonella isolates causing traveler's diarrhea (TD) and their mechanisms of resistance to several antimicrobial agents were analyzed. From 1995 to 2002, a total of 62 Salmonella strains were isolated from stools of patients with TD. The antimicrobial susceptibility to 12 antibiotics was determined, and the molecular mechanisms of resistance to several of them were detected as well. The highest levels of resistance were found against tetracycline and ampicillin (21 and 19%, respectively), followed by resistance to nalidixic acid (16%), which was mainly detected from 2000 onward. Molecular mechanisms of resistance were analyzed in 16 isolates. In these isolates, which were resistant to ampicillin, two genes encoding β-lactamases were detected: oxa-1 (one isolate) and tem -like (seven isolates [in one strain concomitantly with a carb-2 ]). Resistance to tetracycline was mainly related to tetA (five cases) and to tetB and tetG (one case each). Resistance to chloramphenicol was related to the presence of the floR and cmlA genes and to chloramphenicol acetyltransferase activity in one case each. Different genes encoding dihydrofolate-reductases ( dfrA1 , dfrA12 , dfrA14 , and dfrA17 ) were detected in trimethoprim-resistant isolates. Resistance to nalidixic acid was related to the presence of mutations in the amino acid codons 83 or 87 of the gyrA gene. Further surveillance of the Salmonella spp. causing TD is needed to detect trends in their resistance to antimicrobial agents, as we have shown in our study with nalidixic acid. Moreover, such studies will lead to better treatment and strategies to prevent and limit their spread.

The MIC of gemifloxacin and five other quinolones was tested against 31 clinical isolates of Neisseria gonorrhoeae; strains were analyzed for the presence of mutations in both the gyrA and parC genes. Only seven strains were resistant to nalidixic acid due to a mutation in the gyrA gene but not in the parC gene, with six and two considered intermediate to ciprofloxacin and levofloxacin, respectively. The activity of gemifloxacin was similar to that of trovafloxacin and moxifloxacin, but was more active than nalidixic acid, ciprofloxacin or levofloxacin against the gyrA mutant strains. Gemifloxacin is a valid therapeutic alternative to treat infections with N. gonorrhoeae, retaining its activity against strains already presenting a mutation in gyrA.

Clinical strains of Stenotrophomonas maltophilia are often highly resistant to multiple antibiotics and this resistance is steadily rising. Quinolones are included in the group of antimicrobial agents to which this microorganism is developing resistance. Therefore, the aim of this study was to analyze the epidemiological relationship among 22 clinical isolates of S. maltophilia as well as the molecular mechanisms responsible for the acquisition of quinolone-resistance in these strains. The results of the pulsed-field gel electrophoresis (PFGE) showed an heterogenicity of 82% among the strains used in the study. On the other hand, no amino acid changes were found in the quinolone resistance-determining region (QRDR) of either gyrA and parC genes among quinolone-susceptible and -resistant S. maltophilia strains. Besides, the amino acid of the GyrA found in the position equivalent to Ser-83 of E. coli was Gln instead of a Ser or Thr, the amino acids usually encountered in this position among Gram-negative bacteria. The results suggest that there is not a relationship between the presence of this Gln and the resistance to quinolones in S. maltophilia. We can conclude that, contrary to what has been described in other microorganisms, in these S. maltophilia isolates, the development of resistance to quinolones was not related to mutations in the QRDR of gyrA and parC genes. Thus, to our knowledge, this is the first report describing this phenomenon.

Received 11 November 2013; returned 12 December 2013; revised 15 February 2014; accepted 5 March 2014Objectives: To investigate the potential relationship between quinolone resistance and biofilm production in acollection of Salmonella enterica clinical isolates and inS. enterica serovar Typhimurium serial mutants withincreasing resistance to ciprofloxacin.Methods:Nalidixicacidsusceptibilityandbiofilmformationwereassessedinacollectionof122S.entericaclinicalisolates. An in vitro quinolone-resistant mutant, 59-64, was obtained from a biofilm-producing and quinolone-susceptible clinical isolate, 59-wt, in a multistep selection process after increasing ciprofloxacin concentrations.The quinolone resistance mechanisms [target gene and multidrug resistance (MDR) regulatory mutations, MICsof several antibiotics, cell envelope protein analysis, real-time PCR and ciprofloxacin accumulation] were charac-terized for mutant strains. In addition, analysis of fitness, biofilm formation, rdar morphotype and expression ofbiofilm-related genes by real-time PCR were also determined.Results: Nalidixic acid-susceptible S. enterica strains were more prevalent in producing biofilm than the resistantcounterparts. Strain 59-64 acquired five target gene mutations and showed an MDR phenotype. AcrAB andacrF overexpression were ruled out, whereas TolC did show increased expression in 59-64, which, in addition,accumulated less ciprofloxacin. Consistently, increased ramA expression was seen in 59-64 and attributed to amutation within its promoter. Reduced biofilm production related to diminishedcsgB expression as well asreduced fitness was seen for 59-64, which was unable to form the rdar morphotype.Conclusions: Quinolone resistance acquisition may be associated with decreased production of biofilm due tolower csgB expression. Efflux, biofilm production and fitness seem to be interrelated.Keywords: Salmonella Typhimurium, rdar morphotype, csgB, efflux, ramA

Sixteen amikacin-resistant clinical Acinetobacter baumannii isolates from nine different hospitals in Spain were investigated to determine whether the high incidence of amikacin-resistant A. baumannii was due to the dissemination of an amikacin-resistant strain or to the spread of an amikacin resistance gene. The epidemiological relationship studied by repetitive extragenic palindromic PCR and low-frequency restriction analysis of chromosomal DNA showed that the same clone was isolated in eight of nine hospitals, although other clones were also found. The strains were studied for the presence of the aph(3′)-VIa and aac(6′)-I genes, which encode enzymes which inactivate amikacin, by PCR. All 16 clinical isolates had positive PCRs with primers specific for the amplification of the aph(3′)-VIa gene, whereas none had a positive reaction for the amplification of the aac(6′)-I gene. Therefore, the high incidence of amikacin resistance among clinical A. baumannii isolates in Spain was mainly due to an epidemic strain, although the spread of the aph(3′)-VI gene cannot be ruled out.

Background Onychomycoses caused by opportunistic moulds are not well understood, and many are due to Scopulariopsis brevicaulis and other species. Aspergillus versicolor is not documented as an etiological agent in most studies. We have found an increasing prevalence of this species which is involved in 5.8% of all fungal infections of toe nails. Objective To study the clinical and mycological characteristics of the onychomycosis caused by A. versicolor and the in vitro susceptibility of this mould to antifungal agents. Results Onychomycosis due to A. versicolor is mainly seen in people over 60 and presents with chronic involvement of the big toe nails. Predisposing factors are not always present and the infection does not respond to conventional topical antifungals. In vitro, A. versicolor has been shown to be resistant to griseofulvin and fluconazole as well as to amphotericin B, whereas MICs for itraconazole and ketoconazole are variable but within a range of 0.50–4.0 μg/ml; on the contrary, MICs for terbinafine are very low ( Discussion Aspergillus versicolor could be considered as an emergent pathogen causing toenail onychomycosis. Local treatment seems not to be effective. Of the various systemic antifungal agents studied terbinafine appears to be the most effective in treating onychomycosis.

Campylobacter jejuni is a frequent cause of enteritis and sometimes it requires antimicrobial therapy. We have studied the evolution of resistance to nine antibiotics from 1990 to 1994 and investigated how frequently gyrA mutations are involved in the acquisition of quinolone resistance. The percentage of chloramphenicol-, clindamycin-, tertracycline- and amoxicillin plus clavulanic acid-resistant strains has remained practically unchanged and erythromycin and gentamicin resistance has decreased, whereas the percentage of ampicillin-, nalidixic acid- or ciprofloxacin-resistant strains has almost doubled in the follow-up period, from 56 to 76% for ampicillin- and from 47.5 to 88% for quinolone-resistant strains. This study clearly shows that a mutation in Thr-86 to Ile or Lys is a frequent mechanism associated with the acquisition of a high level of resistance to quinolones in clinical isolates of C. jejuni.

A comparative study of the antimicrobial action of seven root canal sealers: Traitement Spad, Endomethasone, N2 Universal, Diaket-A, AH26 with silver, Tubli Seal, and Sealapex was done with 120 strains of Staphylococcus aureus. Two antimicrobial susceptibility tests were used: the agar dilution test and the agar diffusion test. The Diaket-A and Traitement Spad sealer cements showed the highest efficiency in the dilution test, whereas Diaket-A was in fourth place in the diffusion test, only better than the antimicrobial activity of the Tubli Seal and Sealapex sealers.

Enterotoxigenic Escherichia coli isolates were identified as a cause of traveler’s diarrhea in 82 of 520 (16%) patients and tested for resistance to seven antimicrobial agents. Thirty patients (36%) needed antimicrobial therapy: 17 (56%) for persistence of symptoms and 13 (44%) for severity of symptoms. Ampicillin, tetracycline, and trimethoprim-sulfamethoxazole resistance was high. Chloramphenicol showed moderate activity, and amoxicillin plus clavulanic acid, nalidixic acid, and ciprofloxacin showed very good activity. Five nalidixic acid-resistant strains were isolated, four from patients visiting India. Enterotoxigenic Escherichia coli (ETEC) is the major cause of traveler’s diarrhea in people from industrialized countries visiting less-developed countries (6, 7) and is an important cause of dehydrating diarrhea in infants and children in lessdeveloped countries (13). Traveler’s diarrhea caused by ETEC strains is usually a mild, self-limited disease, but for severe traveler’s diarrhea, early treatment with loperamide and an antibiotic such as trimethoprim-sulfamethoxazole, doxycycline, or a fluoroquinolone has been recommended (4). Many previous studies of antimicrobial susceptibility of ETEC involved a small number of isolates from a single geographic location. We, therefore, performed antimicrobial susceptibility testing of ETEC isolates causing traveler’s diarrhea originating from diverse geographical locations. Investigation of the mechanisms of acquisition of quinolone resistance in the nalidixic acid-resistant ETEC strains was also performed. During the period from 1994 to 1997, stool specimens from 520 adult patients with traveler’s diarrhea were analyzed. The patients were recruited from the traveler’s clinic of the Tropical Medicine Department of the Hospital Clinic. All patients had diarrhea on arrival in Spain or within 2 days after their return. The stool specimens were cultured for E. coli and other bacterial enteropathogens by conventional methods (11). Single-colony subcultures of all different lactose-fermenting colonial morphotypes growing on MacConkey agar were identified by conventional criteria. The E. coli isolates were tested by PCR to detect the heat-stable (ST) and heat-labile (LT) toxin genes (15). ETEC strains were isolated from 82 patients (16%) with traveler’s diarrhea. The distribution of these strains according to the type of enterotoxin synthesized was as follows: 58 strains (71%) produced the ST, 11 strains (13%) produced LT, and 13 strains (16%) produced both toxins (LT/ST). ETEC strains were isolated from stool samples of patients traveling to different tropical and subtropical areas, except for Central and South Africa. The range of prevalence was from 7.5% to 31%, with West Africa and the Indian Subcontinent being the two geographic areas where ETEC strains were more prevalent, at 31 and 22%, respectively. Thirty patients (36%) needed antimicrobial therapy: 17 patients (56%) because of persistence of symptoms and 13 (44%) because of severity of symptoms. In 14 treated patients, the cause of diarrhea was ST-producing ETEC (ETEC-ST), representing 24% of the total number of strains of ETEC-ST, whereas in 7 (63%) and 9 (69%) patients, the cause was LT- and LT/ST-producing ETEC, respectively (P , 0.02). All patients were empirically treated with ciprofloxacin, and in all, the duration of diarrhea was shortened and the accompanying symptoms such as abdominal discomfort, flatulence, nausea, and vomiting were relieved. It is noteworthy that patients with ETEC-LT and ETEC-LT/ST strains required antimicrobial therapy more frequently than patients with ETEC-ST strains. However, this finding needs to be confirmed in future studies. The MICs for the clinical isolates studied were determined by E-test according to standard practice. E. coli ATCC 25922 was used as a reference strain for quality control. The breakpoints considered to define a resistant strain were those recommended in reference 12. The MICs of antimicrobial agents for ETEC-ST, ETEC-LT, and ETEC-ST/LT strains are shown in Table 1. Randomized, controlled studies have demonstrated that a 3- to 5-day course of an antibiotic can reduce the duration of an acute diarrheal episode in travelers. Most studies

Introduction: The objective of this investigation was to identify the mechanism of decreased susceptibility to gentamicin in a Salmonella clinical isolate, leading to the detection of a aminoglycoside acetyltransferase gene found in a class 1 integron. Methods: A multidrug-resistant Salmonella strain was recovered from feces of a traveler to Egypt. The antimicrobial susceptibility test to 12 antimicrobial agents was performed with the Kirby-Bauer method. The presence of class 1 integron was determined by PCR. The amplified product was recovered and sequenced in order to establish the genes carried. In addition, susceptibility to gentamicin C1a, gentamicin C1, sisomicin, neomycin, dibekacin, kanamycin, tobramycin, amikacin, netilmicin, apramycin, dactimicin, spectinomycin, streptomycin, lividomycin and butirosin, was established. The Champion TM pET101 Directional TOPO s Expression Kit was used to clone and express the aac(3)-I gene. Results: The isolate was identified as Salmonella enterica serovar Haifa, showing resistance to nalidixic acid, tetracycline and decreased susceptibility to gentamicin. One integron with a size circa 1,500 bp, encoding an aac(3)-Id plus aadA7 genes was observed. The analysis of the susceptibility to different aminoglycosides in the E. coli TOP10F’ transformed with the vector carrying aac(3)-Id gene showed resistance to gentamicin C1a, gentamicin C1, and dactimicin, in accordance with the presence of this enzyme but, was susceptible to sisomicin. The homology of the amino acid and nucleotide sequences with the AAC(3)-Id enzyme was of 100%. Conclusion: The presence of the AAC(3)-Id enzyme was described for the first time in a S. Haifa.

The prevalence of 31 virulence factors was analyzed among nalidixic acid-susceptible and -resistant Escherichia coli strains from phylogenetic group B2. Hemolysin, cytotoxic necrotizing factor 1, and S and F1C fimbriae genes were less prevalent among nalidixic acid-resistant E. coli strains. Quinolone resistance may be associated with a decrease in the presence of some virulence factors.

Molecular analysis of 63 Escherichia coli urine isolates showed that pyelonephritis (n=23) and prostatitis (n=17) isolates exhibited more virulence factors (VFs) among the 35 sought than did cystitis isolates (n=23). Several nontraditional VFs--including bmaE (M fimbriae), gafD (G fimbriae), fyuA (yersiniabactin receptor), ireA and iroN (novel siderophore receptors), cvaC (colicin [microcin] V), traT (serum-resistance associated), ibeA (invasion of brain endothelium), ompT (outer membrane protease T), and malX (pathogenicity island marker)--either differentiated significantly between syndromes (despite small numbers of isolates and possible multiple-comparison artifacts) or were broadly prevalent. Thus, interventions that target conserved uro-VFs may be possible, despite the likely existence of syndrome-specific pathogenetic mechanisms and/or host defense systems.

Summary. In vitro susceptibility to the sordarin derivative GM 237354 and amphotericin B were tested in a total of 190 Cryptococcus neoformans clinical isolates from different geographical areas of Spain and South American countries. Minimal inhibitory concentrations (MICs) were obtained using the NCCLS reference microbroth dilution method and analysed according the serotypes of Cr. neoformans. The MICs for amphotericin B were lower than 1.0 μg ml−1 (MIC90% 0.5 μg ml−1, MIC50% 0.125 μg ml−1) but five isolates showed MICs of 2.0 μg ml−1 to GM 237354 (MIC90% 1.0 μg ml−1, MIC50% 0.5 μg ml−1). Cryptococcus neoformans var. gattii serotype B, was significantly less susceptible than A and AD serotypes (P=0.047 and P=0.022, respectively). Zusammenfassung. An 190 klinischen Isolaten von Cryptococcus neoformans aus unterschiedlichen Regionen Spaniens und Sudamerikas wurde die Empfindlichkeit in vitro fur das Sordanin-Derivat GM 237354 im Vergleich zu Amphotericin B getestet. Die MHK-Werte wurden mittels NCCLS-Mikroverdunnungs-Referenzmethode erhoben und ein Vergleich nach Cr. neoformans-Serotypen durchgefuhrt. Die MHKs fur Amphotericin B lagen unter 1.0 µg ml−1 (MHK90% 0.5 μg ml−1, MHK50% 0.125 μg ml), aber funf Isolate zeigten MHKs von 2.0 μg ml−1 fur GM 237354 (MHK90% 1.0 μg ml−1, MHK50% 0.5 μg ml−1). Cryptococcus neoformans var. gatti Serotyp. B war signifikant weniger empfindlich als die Serotypen A und AD (P=0.047 bzw. P=0.022).

Differences in the presence of nine urovirulence factors among clinical isolates of Escherichia coli causing cystitis and pyelonephritis in women and prostatitis in men have been studied. Hemolysin and necrotizing factor type 1 occur significantly more frequently among isolates causing prostatitis than among those causing cystitis ( P < 0.0001) or pyelonephritis ( P < 0.005). Moreover, the papGIII gene occurred more frequently in E. coli isolates associated with prostatitis (27%) than in those associated with pyelonephritis (9%) ( P < 0.05). Genes encoding aerobactin and PapC occurred significantly less frequently in isolates causing cystitis than in those causing prostatitis ( P < 0.01 and P < 0.0001, respectively) and pyelonephritis ( P < 0.01 and P < 0.0001, respectively). No differences in the presence of Sat or type 1 fimbriae were found. Finally, AAFII and Bfp fimbriae are no longer considered uropathogenic virulence factors since they were not found in any of the strains analyzed. Overall, the results showed that clinical isolates producing prostatitis need greater virulence than isolates producing pyelonephritis in women or, in particular, cystitis in women ( P < 0.05). Overall, the results suggest that clinical isolates producing prostatitis are more virulent that those producing pyelonephritis or cystitis in women.

The distribution of beta-lactamases in a group of 20 epidemiologically well defined Acinetobacter baumannii clinical isolates and the in vitro activity of Syn 2190, a novel beta-lactamase AmpC inhibitor, were determined. Twenty-five per cent of the strains carried and expressed a TEM-type beta-lactamase, whereas 35% had an OXA-type beta-lactamase. In nine out of 11 (82%) ceftazidime-resistant and four out of 13 (30.7%) cefepime-resistant strains, the MIC of these beta-lactam antibiotics decreased when determined in the presence of Syn 2190. Thus, our results suggest that in a high percentage of A. baumannii clinical isolates the increased production of AmpC, in combination or not with other resistance mechanisms, contributes to the resistance pattern in A. baumannii to beta-lactams.

A total of 33 Stenotrophomonas maltophilia clinical isolates were tested for their susceptibility to clinafloxacin in comparison with ciprofloxacin, levofloxacin, moxifloxacin, nalidixic acid, norfloxacin, sparfloxacin and trovafloxacin. The MIC(50) and MIC(90) were as follows: ciprofloxacin 4 and 64 microg/mL; clinafoxacin 0.5 and 4 microg/mL; levofloxacin 2 and 32 microg/mL; moxifloxacin 1 and 8 microg/mL; nalidixic acid 8 and 128 microg/mL; norfloxacin 64 and 256 microg/mL; sparfloxacin 1 and 16 microg/mL; and trovafloxacin 1 and 8 microg/mL. Clinafloxacin was the most active quinolone, with only a 15.1% of strains showing resistance. When the MICs were determined in the presence of 25 microg/ml of reserpine, the MIC(90) of trovafloxacin and moxifloxacin did not change, whereas decreased 2-fold for clinafloxacin, levofloxacin, sparfloxacin and nalidixic acid, and 4- and 8-fold for ciprofloxacin and norfloxacin respectively. No clinafloxacin-resistant strains were observed when the MIC was performed in the presence of reserpine. Therefore, clinafloxacin shows the better "in vitro"activity against these 33 strains of S.maltophilia.

A sparfloxacin-susceptible clinical isolate of Staphylococcus aureus was grown in increased concentrations of sparfoxacin. The presence of mutations in gyrA, gyrB, grlA and grlB genes was analyzed. The primary point mutation was located in the gyrA gene (Glu-88 to Lys). Two further mutation steps appeared in the amino acid change Ser-80 to Tyr in GrlA. No mutations occurred in the gyrB or grlB genes. Efflux pumps involved in the increase of resistance were also found to affect norfloxacin and ciprofloxacin. This effect may be related to NorA. An overexpression of NorA, may be associated with the increase of the MIC of norfloxacin from 32 mg/ lt o200 mg/l in the final mutant. The MICs levels of sparfloxacin were affected by unknown mechanism. © 2001 Elsevier Science B.V. and International Society of Chemotherapy. All rights reserved.

Traveler's diarrhea is the most common health problem of international travelers. Although enterotoxigenic Escherichia coli seems to be the most frequent cause of traveler's diarrhea, many other microorganisms, such as Campylobacter jejuni, may cause this infectious disease. Campylobacter jejuni is recognized as a leading cause of enteritis in humans both in developing and in developed countries. However, a few reports on the incidence and antimicrobial resistance of Campylobacter spp. as a cause of traveler's diarrhea have been published. The limited data on the treatment of C. jejuni infections suggest that ciprofloxacin may shorten the duration of symptoms. However, treatment failure associated with the emergence of quinolone-resistant strains of C. jejuni has been documented. The purpose of this study was to determine the prevalence of C. jejuni associated with traveler's diarrhea and to analyze the geographic distribution as well as the clinical features and susceptibility to antibiotics.

BackgroundNalidixic acid resistance among Salmonella Typhimurium clinical isolates has steadily increased, whereas the level of ciprofloxacin resistance remains low. The main objective of this study was to characterize the fluoroquinolone resistance mechanisms acquired in a S. Typhimurium mutant selected with ciprofloxacin from a susceptible isolate and to investigate its invasion ability.Methodology/principal findingsThree different amino acid substitutions were detected in the quinolone target proteins of the resistant mutant (MIC of ciprofloxacin, 64 microg/ml): D87G and G81C in GyrA, and a novel mutation, E470K, in ParE. A protein analysis revealed an increased expression of AcrAB/TolC and decreased expression of OmpC. Sequencing of the marRAB, soxRS, ramR and acrR operons did not show any mutation and neither did their expression levels in a microarray analysis. A decreased percentage of invasion ability was detected when compared with the susceptible clinical isolate in a gentamicin protection assay. The microarray results revealed a decreased expression of genes which play a role during the invasion process, such as hilA, invF and the flhDC operon. Of note was the impaired growth detected in the resistant strain. A strain with a reverted phenotype (mainly concerning the resistance phenotype) was obtained from the resistant mutant.Conclusions/significanceIn conclusion, a possible link between fluoroquinolone resistance and decreased cell invasion ability may exist explaining the low prevalence of fluoroquinolone-resistant S. Typhimurium clinical isolates. The impaired growth may appear as a consequence of fluoroquinolone resistance acquisition and down-regulate the expression of the invasion genes.

The antifungal activity of eberconazole, a new imidazole derivative, against 124 clinical isolates of Candida comprising eight different species and to 34 isolates of Cryptococcus neoformans was compared to those of clotrimazole and ketoconazole. MICs of eberconazole, determined by the National Committee for Clinical Laboratory Standards standardized microbroth method, were equal to or lower than those of other azoles, especially for Candida krusei and Candida glabrata , which are usually resistant to triazoles.

Haemophilus influenzae is a frequent cause of upper and lower respiratory tract infections (9). The new fluoroquinolones have been widely used as therapy for respiratory tract infections and have shown good activity against H. influenzae (3). Resistance to quinolones in H. influenzae is mainly due to chromosomal mutations in the gyrA and parC genes, which encode the A subunits of the DNA gyrase and topoisomerase IV, respectively (2, 7), similar to those found in other bacterial species (11, 12). Although ciprofloxacin-resistant H. influenzae strains have been isolated (2, 4), the development of quinolone resistance in H. influenzae from patients with chronic lung disease has been infrequently reported, and the mechanism of quinolone resistance acquisition has not been investigated (1). We studied the increase in the level of quinolone resistance of an H. influenzae clinical isolate during ofloxacin therapy in a patient with recurrent respiratory infections. The patient was a 59-year-old female with severe bronchiectasis and recurrent respiratory infections repeatedly submitted to multiple courses of antibiotics (frequently including amoxicillin plus clavulanic acid or ciprofloxacin). In May 1997, she was admitted to the hospital for an episode of bronchial infection, respiratory failure, and severe hypoxemia. She was on ventilatory support and intravenous therapy. Sputum culture for noncapsulated H. influenzae (isolate 1) with susceptibility to ciprofloxacin (MIC, 2 μg/ml), ofloxacin (MIC, 4 μg/ml), and nalidixic acid (MIC, ≥256 μg/ml) was positive. The patient was treated with ofloxacin (200 mg/12 h orally) for 4 days and subsequently with amoxicillin plus clavulanic acid and was discharged after compensation. Four months later, she attended the outpatient clinic and a control sputum culture was positive, with two colonial morphotypes of H. influenzae being detected. One (isolate 2) had the same resistance pattern as the one isolated in May (isolate 1), while the only difference with the other (isolate 3) was that the MIC of ciprofloxacin was 32 μg/ml (isolate 3). Finally, three months later, the patient was again admitted for respiratory deterioration, and two H. influenzae isolates with resistance patterns identical to those previously recovered were found in sputum. The epidemiological relationship of these isolates was investigated by pulsed-field gel electrophoresis (PFGE), showing that the three isolates belonged to the same clone (Fig. ​(Fig.1).1). FIG. 1 Molecular typing of H. influenzae strains by PFGE. Lanes 1, 2, and 10 are molecular weight markers. Lanes 3, 4, and 5 are isolates 1, 2, and 3 of this study, respectively. Lanes 6, 7, 8, and 9 are different strains of H. influenzae chosen randomly. MICs were determined by a commercial microdilution test (Emiza 2E; Sensititre Ltd., Imberhorne, United Kingdom) and for nalidixic acid, by the E-test method (AB Biodisk, Dalvagen, Sweden) performed according to the manufacturers’ instructions. In addition, for the strain with a MIC of ciprofloxacin higher than 2 μg/ml, the MIC was determined by the macrodilution broth method according to the National Committee for Clinical Laboratory Standards recommendations (10). PCR amplification was used to amplify the quinolone resistance-determining region (QRDR) of the gyrA and parC genes, and the nucleotide sequences of these amplicons were determined. The oligonucleotide primers used to amplify the QRDR of the gyrA gene from nucleotides 17 to 816 (800 bp) (from codon 6 to 272) were 5′ AATCATCTATCACCCCTGTC 3′ and 5′ TTTTGCTTTATTTACTTGGT 3′, whereas for the amplification of the QRDR of the parC gene from nucleotides 95 to 471 (377 bp) (from codon 32 to 157) the oligonucleotide primers used were 5′ ATCGTGCGTTGCCTTTTATC 3′ and 5′ TTCAGCCAAGGTTCCATCAA 3′. The PCR program and the DNA sequencing methodology used were as described in reference 11. Nucleotide sequencing of the 800- and 377-bp amplicons obtained from the QRDR of the gyrA and parC genes, respectively, revealed several mutations leading to the amino acid substitutions shown in Table ​Table1.1. TABLE 1 Mutations in the gyrA and parC genes of different isolates of H. influenzae The substitution at amino acid 84 (Ser-Leu) of the GyrA protein or its equivalent in other microorganisms is the most prevalent and has been found in H. influenzae (2, 7) and in other bacteria (11, 12). Georgiou et al. (7) found that strains with MICs of 2 μg/ml showed double mutations, one in the amino acid codon Asp-88 of the gyrA gene and another in the amino acid codon Ser-84 of the parC gene. Similarly, isolates 1 and 2 (MICs of ciprofloxacin of 2 μg/ml) of our study also present a double mutation, whereas the strain for which the MIC of ciprofloxacin was 32 μg/ml showed three main substitutions, two in the GyrA protein (Ser-84 to Leu and Asp-88 to Ala) and one in the ParC protein (Ser-84 to Arg). These results are also in agreement with those found by Georgiou et al. (7). The mutation in the amino acid codon Asp-83, which generated a substitution to Asn, is apparently neutral despite the change in the charge. Studying H. influenzae in sputum samples, Groeneveld et al. (8) found patients persistently infected with the same H. influenzae strain for up to 23 months. Similarly, the strain described herein persisted for at least 7 months despite the treatment with amoxicillin plus clavulanic acid. These results emphasize the potential risk of development of quinolone-resistant H. influenzae during fluoroquinolone therapy in patients with recurrent respiratory infections and confirm the role of substitutions in positions Ser-84 and Asp-88 of the GyrA protein and Ser-84 of the ParC protein in the acquisition of quinolone resistance in this microorganism.

Enteroaggregative Escherichia coli (EAggEC) isolates were identified as a cause of traveller's diarrhoea in 50 (9%) of 517 patients and their antimicrobial susceptibility was determined. Molecular epidemiological characterisation and investigation of the mechanisms of acquisition of quinolone resistance among nalidixic acid-resistant EAggEC strains was performed. Seventeen (34%) of 50 patients needed antimicrobial therapy, because of persistence of symptoms in nine cases and the severity of symptoms in eight cases. Ampicillin and tetracycline resistance was high, whereas chloramphenicol and co-trimoxazole showed moderate activity and amoxicillin plus clavulanic acid, nalidixic acid and ciprofloxacin showed very good activity. Resistance to nalidixic acid was demonstrated in three isolates, two from patients who had travelled to India. In all three strains the resistance was linked to mutations in the gyrA gene alone or in both gyrA and parC genes. Although ciprofloxacin shows excellent in-vitro activity and could be useful in the treatment of traveller's diarrhoea in patients travelling abroad, it may not be useful in patients who have journeyed to India or to Mexico.

The in vitro activity of clinafloxacin was studied in comparison with ciprofloxacin, levofloxacin, moxifloxacin, nalidixic acid, sparfloxacin and trovafloxacin against Acinetobacter baumannii clinical isolates. Clinafloxacin showed a MIC(90) of 4 mg/L, whereas the remaining quinolones showed a MIC(90) equal to or higher than 16 mg/L. MIC(50) determination in the presence of reserpine resulted in a two-fold decrease, except for trovafloxacin, which decreased four-fold, and for moxifloxacin and nalidixic acid, which did not change. The effect of reserpine was most pronounced among strains with a low level of resistance to quinolones. The MIC of clinafloxacin for strains with no mutation in either gyrA or parC genes ranged from 0.008 to 0.25 mg/L. In strains with a single mutation at amino acid codon Ser83 of the gyrA gene, the MIC of clinafloxacin ranged from 0.12 to 1 mg/L, whereas strains with a double mutation, one in the gyrA gene and another in the parC gene, showed a range of MIC of clinafloxacin from 1 to 8 mg/L. Therefore, clinafloxacin shows good activity against strains carrying a single mutation in the gyrA gene, and hence a second mutation is required for the microorganism to express resistance.