Search

Primary familial brain calcification (PFBC) is a neurogenetic disorder characterized by bilateral calcified deposits in the brain. We previously identified that MYORG as the first pathogenic gene for autosomal recessive PFBC, and established a Myorg-KO mouse model. However, Myorg-KO mice developed brain calcifications until nine months of age, which limits their utility as a facile PFBC model system. Hence, whether there is another typical animal model for mimicking PFBC phenotypes in an early stage still remained unknown. In this study, we profiled the mRNA expression pattern of myorg in zebrafish, and used a morpholino-mediated blocking strategy to knockdown myorg mRNA at splicing and translation initiation levels. We observed multiple calcifications throughout the brain by calcein staining at 2–4 days post-fertilization in myorg-deficient zebrafish, and rescued the calcification phenotype by replenishing myorg cDNA. Overall, we built a novel model for PFBC via knockdown of myorg by antisense oligonucleotides in zebrafish, which could shorten the observation period and replenish the Myorg-KO mouse model phenotype in mechanistic and therapeutic studies.

Objective Recessive mutations in the CAPN1 gene have recently been identified in spastic paraplegia 76 (SPG76), a complex hereditary spastic paraplegia (HSP) that is combined with cerebellar ataxia, resulting in an ataxia‐spasticity disease spectrum. This study aims to assess the influence of CAPN1 variants on the occurrence of SPG76 and identify factors potentially contributing to phenotypic heterogeneity. Methods We screened a cohort of 240 unrelated HSP families for variants in CAPN1 using high‐throughput sequencing analysis. We described in detail the clinical and genetic features of the SPG76 patients in our cohort and summarized all reported cases. Results Six unreported CAPN1‐associated families containing eight patients with or without cerebellar ataxia were found in our cohort of HSP cases. These patients carried three previously reported homozygous truncating mutations (p.V64Gfs*103, c.759+1G>A, and p.R285*), and three additional novel compound heterozygous missense mutations (p.R481Q, p.P498L, and p.R618W). Lower limbs spasticity, hyperreflexia, and Babinski signs developed in about 94% of patients, with ataxia developing in 63% of cases. In total, 33 pathogenic mutations were distributed along the three reported functional domains of calpain‐1 protein, encoded by CAPN1, with no hotspot region. A comparison of gender distribution between the two groups indicated that female SPG76 patients were significantly more likely to present with complicated HSP than male patients (P = 0.015). Interpretation Our study supports the clinically heterogeneous inter‐ and intra‐family variability of SPG76 patients, and demonstrates that gender and calpain‐1 linker structure may contribute to clinical heterogeneity in SPG76 cases.

Hereditary spastic paraplegias refer to a heterogeneous group of neurodegenerative disorders resulting from degeneration of the corticospinal tract. Clinical characterization of patients with hereditary spastic paraplegias represents progressive spasticity, exaggerated reflexes and muscular weakness. Here, to expand on the increasingly broad pools of previously unknown hereditary spastic paraplegia causative genes and subtypes, we performed whole exome sequencing for six affected and two unaffected individuals from two unrelated Chinese families with an autosomal dominant hereditary spastic paraplegia and lacking mutations in known hereditary spastic paraplegia implicated genes. The exome sequencing revealed two stop-gain mutations, c.247_248insGTGAATTC (p.I83Sfs*11) and c.526G>T (p.E176*), in the ubiquitin-associated protein 1 (UBAP1) gene, which co-segregated with the spastic paraplegia. We also identified two UBAP1 frameshift mutations, c.324_325delCA (p.H108Qfs*10) and c.425_426delAG (p.K143Sfs*15), in two unrelated families from an additional 38 Chinese pedigrees with autosomal dominant hereditary spastic paraplegias and lacking mutations in known causative genes. The primary disease presentation was a pure lower limb predominant spastic paraplegia. In vivo downregulation of Ubap1 in zebrafish causes abnormal organismal morphology, inhibited motor neuron outgrowth, decreased mobility, and shorter lifespan. UBAP1 is incorporated into endosomal sorting complexes required for transport complex I and binds ubiquitin to function in endosome sorting. Patient-derived truncated form(s) of UBAP1 cause aberrant endosome clustering, pronounced endosome enlargement, and cytoplasmic accumulation of ubiquitinated proteins in HeLa cells and wild-type mouse cortical neuron cultures. Biochemical and immunocytochemical experiments in cultured cortical neurons derived from transgenic Ubap1flox mice confirmed that disruption of UBAP1 leads to dysregulation of both early endosome processing and ubiquitinated protein sorting. Strikingly, deletion of Ubap1 promotes neurodegeneration, potentially mediated by apoptosis. Our study provides genetic and biochemical evidence that mutations in UBAP1 can cause pure autosomal dominant spastic paraplegia.

Primary familial brain calcification (PFBC) is a rare neurodegenerative disorder with four causative genes (SLC20A2, PDGFRB, PDGFB, and XPR1) that have been identified. Here, we aim to describe the mutational spectrum of four causative genes in a series of 226 unrelated Chinese PFBC patients. Mutations in four causative genes were detected in 16.8% (38/226) of PFBC patients. SLC20A2 mutations accounted for 14.2% (32/226) of all patients. Mutations in the other three genes were relatively rare, accounting for 0.9% (2/226) of all patients, respectively. Clinically, 44.8% of genetically confirmed patients (probands and relatives) were considered symptomatic. The most frequent symptoms were chronic headache, followed by movement disorders and vertigo. Moreover, the total calcification score was significantly higher in the symptomatic group compared to the asymptomatic group. Functionally, we observed impaired phosphate transport induced by seven novel missense mutations in SLC20A2 and two novel mutations in XPR1. The mutation p.D164Y in XPR1 might result in low protein expression through an enhanced proteasome pathway. In conclusion, our study further confirms that mutations in SLC20A2 are the major cause of PFBC and provides additional evidence for the crucial roles of phosphate transport impairment in the pathogenies of PFBC.

IntroductionHereditary spastic paraplegias (HSPs) are uncommon but not rare neurodegenerative diseases. More than 100 pathogenic genes and loci related to spastic paraplegia symptoms have been reported. HSPs have the same core clinical features, including progressive spasticity in the lower limbs, though HSPs are heterogeneous (eg, clinical signs, MRI features, gene mutation). The age of onset varies greatly, from infant to adulthood. In addition, the slow and variable rates of disease progression in patients with HSP represent a substantial challenge for informative assessment of therapeutic efficacy. To address this, we are undertaking a prospective cohort study to investigate genetic–clinical characteristics, find surrogates for monitoring disease progress and identify clinical readouts for treatment.Methods and analysisIn this case-control cohort study, we will enrol 200 patients with HSP and 200 healthy individuals in parallel. Participants will be continuously assessed for 3 years at 12-month intervals. Six aspects, including clinical signs, genetic spectrum, cognitive competence, MRI features, potential biochemical indicators and nerve electrophysiological factors, will be assessed in detail. This study will observe clinical manifestations and disease severity based on different molecular mechanisms, including oxidative stress, cholesterol metabolism and microtubule dynamics, all of which have been proposed as potential treatment targets or modalities. The analysis will also assess disease progression in different types of HSPs and cellular pathways with a longitudinal study using t tests and χ2 tests.Ethics and disseminationThe study was granted ethics committee approval by the first affiliated hospital of Fujian Medical University (MRCTA, ECFAH of FMU (2019)194) in 2019. Findings will be disseminated via presentations and peer-reviewed publications. Dissemination will target different audiences, including national stakeholders, researchers from different disciplines and the general public.Trial registration numberNCT04006418.

Background Hereditary spastic paraplegias (HSP) is a heterogeneous group of rare neurodegenerative disorders affecting the corticospinal tracts. To date, more than 78 HSP loci have been mapped to cause HSP. However, both the clinical and mutational spectrum of Chinese patients with HSP remained unclear. In this study, we aim to perform a comprehensive analysis of clinical phenotypes and genetic distributions in a large cohort of Chinese HSP patients, and to elucidate the primary pathogenesis in this population. Methods We firstly performed next-generation sequencing targeting 149 genes correlated with HSP in 99 index cases of our cohort. Multiplex ligation-dependent probe amplification testing was further carried out among those patients without known disease-causing gene mutations. We simultaneously performed a retrospective study on the reported patients exhibiting HSP in other Chinese cohorts. All clinical and molecular characterization from above two groups of Chinese HSP patients were analyzed and summarized. Eventually, we further validated the cellular changes in fibroblasts of two major spastic paraplegia (SPG) patients (SPG4 and SPG11) in vitro. Results Most patients of ADHSP (94%) are pure forms, whereas most patients of ARHSP (78%) tend to be complicated forms. In ADHSP, we found that SPG4 (79%) was the most prevalent, followed by SPG3A (11%), SPG6 (4%) and SPG33 (2%). Subtle mutations were the common genetic cause for SPG4 patients and most of them located in AAA cassette domain of spastin protein. In ARHSP, the most common subtype was SPG11 (53%), followed by SPG5 (32%), SPG35 (6%) and SPG46 (3%). Moreover, haplotype analysis showed a unique haplotype was shared in 14 families carrying c.334C > T (p.R112*) mutation in CYP7B1 gene, suggesting the founder effect. Functionally, we observed significantly different patterns of mitochondrial dynamics and network, decreased mitochondrial membrane potential (Δψm), increased reactive oxygen species and reduced ATP content in SPG4 fibroblasts. Moreover, we also found the enlargement of LAMP1-positive organelles and abnormal accumulation of autolysosomes in SPG11 fibroblasts. Conclusions Our study present a comprehensive clinical spectrum and genetic landscape for HSP in China. We have also provided additional evidences for mitochondrial and autolysosomal-mediated pathways in the pathogenesis of HSP. Electronic supplementary material The online version of this article (10.1186/s13024-018-0269-1) contains supplementary material, which is available to authorized users.

Background Amyotrophic lateral sclerosis (ALS) is a devastating motor neuron disease characterized by substantial clinical and genetic heterogeneity. Thus far, only a few TARDBP-ALS families have been reported in China, and no mutation analysis has been reported in south-eastern China. Methods Seven index cases from ALS families negative for SOD1 and FUS mutations were screened by Sanger sequencing for TARDBP gene exons 2-6. TARDBP exon 6 was analysed in 215 sporadic ALS patients. Results Two TARDBP mutations in exon 6 (p.M337 V and p.G348C) were identified in 5 unrelated families. Four of these 5 families carried the same p.M337 V mutation (family 1II3, family 2II6, family 3II4, and family 4II4), and the p.G348C mutation was identified in family 5 (II5). Among the 215 sporadic patients, only a single nucleotide polymorphism (p.A366A) was detected in 5 patients, and no responsible mutation was identified. Among the TARDBP-linked familial ALS patients, the average age of onset was 57.0 ± 4.7 years, and a trend towards higher rates of bulbar (50.0%, 6/12) onset and upper limb (41.7%, 5/12) onset than lower rates of limb onset (8.3%, 1/12) was observed. Furthermore, ALS patients with TARDBP mutations showed a benign disease course, and the average survival was 106.5 ± 41.8 months (n = 8). Conclusions We found a high frequency of the TARDBP p.M337 V mutation in familial ALS in south-eastern China. The TARDBP-linked ALS patients showed a benign disease course and prolonged survival. Electronic supplementary material The online version of this article (10.1186/s12883-018-1028-1) contains supplementary material, which is available to authorized users.

Background: Progressive myoclonus epilepsies (PMEs) comprise a group of rare genetic disorders characterized by action myoclonus, epileptic seizures, and ataxia with progressive neurologic decline. Due to clinical and genetic heterogeneity of PMEs, it is difficult to decide which genes are affected. The aim of this study was to report an action myoclonus with or without renal failure syndrome (EPM4) family and summarize the clinical and genetic characteristics of all reported EPM4 patients. Methods: In the present study, targeted next-generation sequencing (NGS) was applied to screen causative genes in a Chinese PME family. The candidate variant was further confirmed by cosegregation analysis and further functional analysis, including the reverse transcription polymerase chain reaction and Western blot of the proband’s muscle. Moreover, literature data on the clinical and mutational features of all reported EPM4 patients were reviewed. Results: The gene analysis revealed a novel homozygous splicing mutation (c.995-1G>A) of the SCARB2 gene in two brothers. Further functional analysis revealed that this mutation led to loss function of the SCARB2 protein. The classification of the candidate variant, according to the American College of Medical Genetics and Genomics standards and guidelines and functional analysis, was pathogenic. Therefore, these two brothers were finally diagnostically confirmed as EPM4. Conclusions: These present results suggest the potential for targeted NGS to conduct a more rapid and precise diagnosis for PME patients. A literature review revealed that mutations in the different functional domains of SCARB2 appear to be associated with the phenotype of EPM4. Key words: Progressive Myoclonus Epilepsies; Progressive Myoclonus Epilepsy with or without Renal Failure; SCARB2 Gene; Targeted Next-Generation Sequencing

The development of clinical trials for Duchenne muscular dystrophy (DMD) in China faces many challenges due to limited information about epidemiological data, natural history and clinical management. To provide these detailed data, we developed a comprehensive database based on registered DMD patients from South China and analysed their clinical and mutational characteristics. The database included DMD registrants confirmed by clinical presentation, family history, genetic detection, prognostic outcome, and/or muscle biopsy. Clinical data were collected by a registry form. Mutations of dystrophin were detected by multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing. Currently, 132 DMD patients from 128 families in South China have been registered, and 91.7% of them were below 10 years old. In mutational detection, large deletions were the most frequent type (57.8%), followed by small deletion/insertion mutations (14.1%), nonsense mutations (13.3%), large duplications (10.9%), and splice site mutations (3.1%). Clinical analysis revealed that most patients reported initial symptoms between 1 and 3 years of age, but the diagnostic age was more frequently between 6 and 8 years. 81.4% of patients were ambulatory. Baseline cardiac assessments at diagnosis were conducted in 39.4% and 29.5% of patients by echocardiograms and electrocardiograms, respectively. Only 22.7% of registrants performed baseline respiratory assessments. A small numbers of patients (20.5%) were treated with glucocorticoids. 13.3% of patients were eligible for stop codon read-through therapy, and 48.4% of patients would potentially benefit from exon skipping. The top five exon skips applicable to the largest group of registrants were skipping of exons 51 (14.8% of total mutations), 53 (12.5%), 45 (7.0%), 55 (4.7%), and 44 (3.9%). In conclusion, our database provided information on the natural history, diagnosis and management status of DMD in South China, as well as potential molecular therapies suitable for these patients. This comprehensive database will promote future experimental therapies in China.

Background Owing to the clinical variability and molecular heterogeneity, the traditional Sanger sequencing takes time and effort and is inefficient. In this paper, target region capture sequencing in the diagnosing of autosomal recessive Charcot-Marie-Tooth disease (AR-CMT) is explored. Methods Clinical data and peripheral blood sample of 5 clinically suspected AR - CMT patients were collected. Charcot-Marie-Tooth disease (CMT) related gene mutation were detected by target region capture sequencing. The candidate variants were confirmed in the peripheral blood sample of the patients and their parents by Sanger sequencing. Results Target region capture sequencing revealed that compound heterozygous mutations of GDAP1 gene was found in 2 patients, and was not seen in the other 3 patients. Sanger sequencing revealed that among the 2 patients with mutation of GDAP1 gene, compound heterozygous mutation c.767A > G (p. His256Arg) and c.866T > A (p. Phe289Tyr) were seen in Case 1, whose father carried c.866T > A (p. Phe289Tyr) heterozygous mutation and mother carried c.767A > G (p. His256Arg) heterozygous mutation, while compound heterozygous mutation c.571C > T (p. Arg191X) and c.589delC (p. Asp198IlefsX8) were seen in Case 2, whose father carried c.589delC (p. Asp198IlefsX8) heterozygous mutation and mother carried c.571C > T (p. Arg191X) heterozygous mutation. Therefore, Case 1 and Case 2 were all diagnosed as AR-CMT. Conclusions Target region capture sequencing is a rapid and reliable genetic testing method with high efficiency. It is applicable for the diagnosis of AR-CMT. DOI: 10.3969/j.issn.1672-6731.2017.08.009

Four causative genes, including solute carrier family 20 member 2 (SLC20A2), platelet-derived growth factor receptor b (PDGFRB), platelet-derived growth factor b (PDGFB)and xenotropic and polytropic retrovirus receptor 1 (XPR1), have been identified to cause primary familial brain calcification (PFBC). However, PDGFRB mutations seem to be quite rare and no PDGFRB mutations have been reported in Chinese PFBC patients. A total of 146 PFBC patients including 12 families and 134 sporadic patients were recruited in this study. All of them were previously tested negative for the SLC20A2. Mutational analyses of the entire exons and exon-intron boundaries of PDGFRB were carried out by direct gene sequencing. In silico analyses of the identified variants were conducted using Mutation Taster, PolyPhen-2 and Sorts Intolerant From Tolerant. Two heterozygous variants, c.3G>A and c.2209G>A, of the PDGFRB gene were revealed in two PFBC families, respectively. These two variants were not observed in 200 healthy controls. The variant c.3G>A was located in exon 2 and affected the initiation codon of the PDGFRB gene. The variant c.2209G>A resulted in amino-acid substitutions of aspartic acid to asparagine at position 737. Both of these two variants co-segregated with the disease phenotype (variant carriers in Family 1: I1, II2 and II3; variant carriers in Family 2: I2 and II8), suggesting a pathogenic impact of these variants. The prevalence of PDGFRB mutations in Chinese PFBC patients seems to be quite low, indicating that PDGFRB is not a major causative gene of PFBC in Chinese population.

// Xiang Lin 1, * , Jin-Jing Li 1, * , Wen-Jing Qian 2, * , Qi-Jie Zhang 1 , Zhong-Feng Wang 2 , Ying-Qian Lu 1 , En-Lin Dong 1 , Jin He 1 , Ning Wang 1 , Li-Xiang Ma 3 and Wan-Jin Chen 1, 4 1 Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou 350005, China 2 Institutes of Brain Science, Institute of Neurobiology, State Key Laboratory of Medical Neurobiology, Collaborative Innovation Center for Brain Science, Fudan University, Shanghai 200032, China 3 Department of Anatomy, Histology & Embryology, Shanghai Medical College, Fudan University, Shanghai 200032, China 4 Fujian Key Laboratory of Molecular Neurology, Fujian Medical University, Fuzhou 350005, China * These authors have contributed equally to this work Correspondence to: Wan-Jin Chen, email: wanjinchen75@fjmu.edu.cn Li-Xiang Ma, email: lxma@fudan.edu.cn Keywords: spinal muscular atrophy (SMA), induced pluripotent stem cells (iPSCs) derived enriched motor neurons (MNs), survival motor neuron (SMN) protein, neurite outgrowth, neuronal activity Received: August 20, 2016 Accepted: December 27, 2016 Published: January 31, 2017 ABSTRACT Spinal muscular atrophy (SMA) is a devastating motor neuron disease caused by mutations of the survival motor neuron 1 ( SMN1 ) gene. SMN2 , a paralogous gene to SMN1 , can partially compensate for the loss of SMN1 . On the basis of age at onset, highest motor function and SMN2 copy numbers, childhood-onset SMA can be divided into three types (SMA I-III). An inverse correlation was observed between SMN2 copies and the differential phenotypes of SMA. Interestingly, this correlation is not always absolute. Using SMA induced pluripotent stem cells (iPSCs), we found that the SMN was significantly decreased in both SMA III and SMA I iPSCs derived postmitotic motor neurons (pMNs) and γ-aminobutyric acid (GABA) neurons. Moreover, the significant differences of SMN expression level between SMA III (3 copies of SMN2 ) and SMA I (2 copies of SMN2 ) were observed only in pMNs culture, but not in GABA neurons or iPSCs. From these findings, we further discovered that the neurite outgrowth was suppressed in both SMA III and SMA I derived MNs. Meanwhile, the significant difference of neurite outgrowth between SMA III and SMA I group was also found in long-term cultures. However, significant hyperexcitability was showed only in SMA I derived mature MNs, but not in SMA III group. Above all, we propose that SMN protein is a major factor of phenotypic modifier. Our data may provide a new insight into recognition for differential phenotypes of SMA disease.

Charcot-Marie-Tooth disease type 2 (CMT2) is a clinically and genetically heterogeneous inherited neuropathy. Although new causative and disease-associated genes have been identified for CMT2 in recent years, molecular diagnoses are still lacking for a majority of patients. We here studied a cohort of 35 CMT2 patients of Chinese descent, using whole exome sequencing to investigate gene mutations and then explored relationships among genotypes, clinical features, and mitochondrial DNA levels in blood as assessed by droplet digital PCR. We identified pathogenic variants in 57% of CMT2 patients. The most common genetic causes in the cohort were MFN2 mutations. Two patients with typical CMT phenotype and neuromyotonia were detected to harbor compound heterozygous variations in the HINT1 gene. In conclusion, our work supports that the molecular diagnostic rate of CMT2 patients can be increased via whole exome sequencing, and our data suggest that assessment of possible HINT1 mutations should be undertaken for CMT2 patients with neuromyotonia.

Purpose Tuberous sclerosis complex (TSC) is characterized by the development of hamartomas in multiple organ systems. This study attempted to screen mutations and to investigate the mutation distribution and related phenotypes including epilepsy of Chinese TSC patients. Methods We performed the genotypic analysis of TSC1 and TSC2 genes in 77 unrelated Chinese TSC patients using direct Sanger sequencing and Multiplex ligation-dependent probe amplification (MLPA). Results Mutations were identified in a total of 63 (81.8%) cases, including 18 TSC1 mutations (8 nonsense mutations, 6 frameshift, 1 in-frame shift, 1 missense and 2 splice-site) and 45 TSC2 mutations (13 missense, 3 nonsense, 6 splicing, 6 in-frame shift,12 frameshift mutations and 5 large deletions). Large deletions were presented exclusively in TSC2 gene, accounting for 7.9% of all mutations in this study. Fourteen novel mutations were identified in this study. Conclusions Epilepsy occurs in approximately 75.3% (58/77) of patients. Hypomelanotic macules occurred significantly more often in patients with TSC2 mutations and cases with TSC1/TSC2 mutations had a significantly higher frequency of cortical nodule than patients with no mutations identified. Overall, our data expands the spectrum of mutations associated with the TSC loci and will be of value to the genetic counseling in patients with the disease.

The human iPS cell line, hiPS-SPG76 (FJMUi001-A), derived from skin fibroblasts from a 42-year-old male hereditary spastic paraplegia patient carrying compound heterozygous p.P498L (c.1493C > T) and p.R618W (c.1852C > T) mutations in the CAPN1 gene, was generated by non-integrative reprogramming vectors encoding OCT3/4, SOX2, KLF4, and c-MYC. The established hiPS-SPG76 was free of genomically integrated reprogramming genes, had a normal karyotype, expressed pluripotency markers, and had capacity to form three germ layers in vitro and in vivo. This generated hiPS cell line offers a useful resource to study the pathogenesis of SPG76.

Autosomal recessive optic neuropathies (IONs) are extremely rare disorders affecting retinal ganglion cells and the nervous system. RTN4IP1 has recently been identified as the third known gene associated with the autosomal recessive ION optic atrophy 10 (OPA10). Patients with RTN4IP1 mutations show early-onset optic neuropathy that can be followed by additional neurological symptoms such as seizures, ataxia, mental retardation, or even severe encephalopathy. Here, we report two siblings from a Chinese family who presented with early-onset optic neuropathy, epilepsy, and mild intellectual disability. Using whole exome sequencing combined with Sanger sequencing, we identified novel compound heterozygous RTN4IP1 mutations (c.646G > A, p.G216R and c.1162C > T, p.R388X) which both co-segregated with the disease phenotype and were predicted to be disease-causing by prediction software. An in vitro functional study in urine cells obtained from one of the patients revealed low expression of the RTN4IP1 protein. Our results identify novel compound heterozygous mutations in RTN4IP1 which are associated with OPA10, highlighting the frequency of RTN4IP1 mutations in human autosomal recessive IONs. To our knowledge, this is the first report of RTN4IP1 carriers from China.

Introduction The pathophysiologic mechanism of paroxysmal kinesigenic dyskinesia (PKD) is largely unclear. Basal ganglia-thalamo-cortical circuit involvement is thought to underlie PKD pathophysiology. However, microstructural alternations in the motor circuit of PKD require further elucidation. Methods Diffusion tensor imaging and high-resolution T1-weighted imaging were performed on 30 PKD patients (15 PRRT2 carriers, 15 PRRT2 non-carriers) and 15 matched healthy controls. Tract-based spatial statistics were conducted on diffusion indices to examine microstructural integrity of white matter. Voxel-based morphometry analysis was used to examine volumetric changes of gray matter. Multiple regression was employed to test the contribution of demography, disease duration, and PRRT2 status to pathological changes in brain structure. Results Six (including two novel) PRRT2 mutations were identified in PKD patients who exhibited significantly reduced mean diffusivity mainly along the left corticospinal tract, and reduced gray matter volume in pre-supplementary motor area (preSMA) and right opercular part of inferior frontal gyrus (IFGoperc), compared to healthy controls. Both gray matter volume reductions in preSMA and diffusion indices of abnormal white matter negatively correlated with disease duration. Genotype-phenotype analysis revealed that PRRT2 mutation carriers had earlier onset age, longer attacks, and a larger proportion of bilateral symptoms than non-carriers. Conclusions We observed that PRRT2 mutations were associated with disease severity, while neuroanatomical abnormality was associated with disease duration in patients with PKD. Aberrant microstructural changes in preSMA and IFG areas, independent of mutation status, point to dysregulated motor inhibition in patients and provide new insights into neurobiological mechanisms underlying motor symptoms of PKD.

Demyelinating Charcot-Marie-Tooth disease (CMT) is the most common subtype of CMT. It is caused mainly by 17p11.2 heterozygous duplication, but also by mutations in more than 20 genes which affect development and function of Schwann cells. To investigate the profile of genes mutated and clinical features in demyelinating CMT of Chinese descent, we collected a cohort of 44 demyelinating CMT patients and screened them using multiplex ligation-dependent probe amplification (MLPA) and targeted next-generation sequencing (NGS) technology. The MLPA technology revealed that 77.3% demyelinating CMT patients harbored 17p11.2 heterozygous duplication and 6.8% patients harbored heterozygous deletion of exon 6 of MPZ gene, that was further confirmed a novel c.674_675insA mutation in MPZ gene. In the patients with 17p12 heterozygous duplication, 3 sets of independent families were discordant for the CMT phenotype within the same family. The targeted NGS technology revealed that 6 candidate mutations including 1 previously reported mutation (GDAP1: c.571C>T) and 5 novel mutations (SBF2: c.415T>C, c.619G>T, c.1258A>G; GDAP1: c.589delC; PMP22: c.318delT) were found. In conclusion, combined MLPA technique with targeted NGS, the demyelinating CMT genetic diagnostic success rate was increased.

Summary Primary familial brain calcification (PFBC) is a genetically heterogeneous disorder characterized by bilateral calcifications in the basal ganglia and other brain regions. The genetic basis of this disorder remains unknown in a significant portion of familial cases. Here, we reported a recessive causal gene, MYORG , for PFBC. Compound heterozygous or homozygous mutations of MYORG co-segregated completely with PFBC in six families, with logarithm of odds (LOD) score of 4.91 at the zero recombination fraction. In mice, Myorg mRNA was expressed specifically in S100β-positive astrocytes, and knockout of Myorg induced the formation of brain calcification at 9 months of age. Our findings provide strong evidence that loss-of-function mutations of MYORG cause brain calcification in humans and mice.

Spinal muscular atrophy (SMA) is an autosomal recessive genetic disorder caused by survival motor neuron (SMN) protein deficiency leading the loss of motor neurons in the anterior horns of the spinal cord and brainstem. More than 95% of SMA patients are attributed to the homozygous deletion of survival motor neuron 1 (SMN1) gene, and approximately 5% are caused by compound heterozygous with a SMN1 deletion and a subtle mutation. Here, we identified a rare variant c.835-5T>G in intron 6 of SMN1 in a patient affected with type I SMA. We analyzed the functional consequences of this mutation on mRNA splicing in vitro. After transfecting pCI-SMN1, pCI-SMN2, and pCI-SMN1 c.835-5T>G minigenes into HEK293, Neuro-2a, and SHSY5Y cells, reverse transcription polymerase chain reaction (RT-PCR) was performed to compare the splicing effects of these minigenes. Finally, we found that this mutation resulted in the skipping of exon 7 in SMN1, which confirmed the genetic diagnosis of SMA.

Paroxysmal kinesigenic dyskinesia (PKD) and myotonia congenita (MC) are independent disorders that share some clinical features. We aimed to investigate the sequences of PRRT2 and CLCN1 in a proband diagnosed with PKD and suspected MC. Clinical evaluation and auxiliary examinations were performed. Direct sequencing of the entire coding regions of the PRRT2 and CLCN1 genes was conducted. Haplotype analysis confirmed the relationships among the family members. The proband suffered choreoathetosis attacks triggered by sudden movements, and lower-limb weakness and stiffness that worsened in cold weather. Carbamazepine monotherapy completely controlled his choreoathetosis and significantly relieved his limb weakness and stiffness. His father, when young, had similar limb stiffness, while his mother and brother were asymptomatic. Genetic analysis revealed that the proband and his father harbored a PRRT2 c.649dupC mutation, and CLCN1 c.1723C>T and c.2492A>G mutations. His brother carried only the two CLCN1 mutations. None of these mutations were identified in his mother and 150 unrelated controls. This is the first report showing the coexistence of PRRT2 and CLCN1 mutations. Our results also indicate that both the PRRT2 and CLCN1 genes need to be screened if we fail to identify PRRT2 mutations in PKD patients or CLCN1 mutations in MC patients.

Idiopathic basal ganglia calcification (IBGC) is a rare neuropsychiatric disorder characterized by bilateral and symmetric cerebral calcifications. Recently, SLC20A2 was identified as a causative gene for familial IBGC, and three mutations were reported in a northern Chinese population. Here, we aimed to explore the mutation spectrum of SLC20A2 in a southern Chinese population. Sanger sequencing was employed to screen mutations within SLC20A2 in two IBGC families and 14 sporadic IBGC cases from a southern Han Chinese population. Four novel mutations ( c.82G > A p.D28N , c.185T > C p.L62P , c.1470_1478delGCAGGTCCT p.Q491_L493del and c.935-1G > A ) were identified in two families and two sporadic cases, respectively; none were detected in 200 unrelated controls. No mutation was found in the remaining 12 patients. Different mutations may result in varied phenotypes, including brain calcification and clinical manifestations. Our study supports the hypothesis that SLC20A2 is a causative gene of IBGC and expands the mutation spectrum of SLC20A2 , which facilitates the understanding of the genotype–phenotype correlation of IBGC.

Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 ( IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711+1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.

Background Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. Methods Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. Results Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype–phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. Conclusion The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.

The aim of this study was to determine the clinical features and frequencies of genetic subtypes in a series of patients with Charcot-Marie-Tooth (CMT) disease from Eastern China. Patients were divided into three subtypes, CMT1, CMT2 and hereditary neuropathy with liability to pressure palsy (HNPP), according to their electrophysiological manifestations. Multiplex ligation-dependent probe analysis (MLPA) was performed to detect duplications/deletions in the PMP22 gene. The coding regions and splice sites of the GJB1, MPZ, MFN2 and GDAP-1 genes were determined by direct sequencing. Among the 148 patients in the study, 37.2% of the cases had mutations in genes assessed. The mutation detection rate was higher in patients with family histories than in spontaneous cases. PMP22 duplication (13.5%) was predominant in this group of patients, followed by PMP22 deletion (11.5%), and point mutations in GJB1 (8.8%), MPZ (2.0%) and MFN2 (0.7%). Three novel mutations (c.151T>C and c.310 A>G in GJB1 and c.1516 C>G in MFN2) were detected. A small deletion in PMP22 exon 4 was detected in a patient with severe CMT1. Genetic tests have great value in CMT patients with family histories. The frequency of PMP22 duplications was lower in Asian patients than in others. We suggest that genetic testing strategies in CMT patients should be primarily based on electromyography data.

Dopa-responsive dystonia is a rare hereditary movement disorder caused by mutations in the guanosine triphosphate cyclohydrolase 1 ( GCH1) gene. This disease typically manifests in dystonia, with marked diurnal fluctuation and a dramatic response to levodopa. However, growth retardation in dopa-responsive dystonia has rarely been reported, and the etiology of short stature is not clarified. Here, we report a 14-year-old patient with extremities dystonia and short stature. Treatment with levodopa relieved his symptoms and resulted in a height increase. We also investigated the mutation in GCH1 and the etiology of short stature in this case. Sequence analysis of GCH1 revealed a novel mutation (c.695G>T). Laboratory examinations and imaging confirmed the diagnosis of growth hormone deficiency. We conclude that our case reveals a rare feature for dopa-responsive dystonia and suggests a possible pathogenic link between growth hormone deficiency and dopa-responsive dystonia. We recommend levodopa as the first choice for treating dopa-responsive dystonia in children with growth hormone deficiency.

The Bruno et al.1 criteria are commonly used to diagnose paroxysmal kinesigenic dyskinesia (PKD), listed as follows: The authors thank the participants for taking part in this study.

To investigate chloride channel 1 (CLCN1) gene mutation and clinical features of 2 Chinese patients with myotonia congenita.Clinical data of a patient from a family affected with myotonia congenita in addition with a sporadic patient from Fujian province were analyzed. Exons of CLCN1 gene were amplified and sequenced.The proband from the affected family was found to carry a c.1024GA heterozygous missense mutation in exon 8, whilst the sporadic patient has carried a c.1292CT heterozygous missense mutation in exon 11.Detection of CLCN1 gene mutation is an effective method for the diagnosis of myotonia congenita. Exon 8 of CLCN1 gene may be a mutational hotspot in Chinese patients with myotonia congenita.

Our objective was to investigate the association between senataxin mutations and sporadic amyotrophic lateral sclerosis (ALS) in Chinese patients. DNA from 45 sporadic ALS patients was screened for mutations in senataxin using polymerase chain reaction (PCR) and direct sequencing. A novel variation, Thr1118Ile, was identified in a 42-year-old individual with sporadic ALS. This variation was not detected in 200 unrelated control individuals. In conclusion, the presence of this variation in a patient with sporadic ALS, and its absence in 200 controls, supports an association between senataxin and sporadic ALS. This study has broadened the mutation spectrum of senataxin and expanded the clinical phenotypes of senataxin mutations.

Wilson disease (WD) is the most common disorder resulting in hepatic copper overload. A similar form of copper-associated cirrhosis caused by mutations of the canine copper toxicosis MURR1 gene is also observed in Bedlington terriers. Recent studies indicate that MURR1 might influence human copper metabolism and the clinical presentations of WD. However, the correlation between the MURR1 gene and the Chinese patients with WD has not been reported. In the present study, all three exons of the MURR1 gene including the intron-exon boundaries were directly sequenced in 120 unrelated healthy Chinese and 218 unrelated Chinese patients with WD. No mutations were detected in coding and splice site sequence in the human MURR1 gene. A novel polymorphism 3'+119T--A in the 3' untranslated region (UTR) was identified in three healthy individuals and four patients with two disease-causing mutations in the ATP7B gene and a great diversity of clinical presentations. Of the ATP7B mutations reported here, Gly1268Arg is a novel one. Also, the previously described nucleotide change IVS2+63C--G was detected in 31.66% of normal chromosomes and 26.15% of WD chromosomes. The results have indicated that there is no correlation between MURR1 and WD in the Chinese population.