Search

This study characterized the pharmacokinetics, mass balance, routes and extent of elimination, metabolites, and safety of a single oral dose of 14C-linsitinib, an IGF-1R/IR inhibitor, in patients with advanced solid tumors. The tolerability of linsitinib after multiple-dose administration was assessed in those patients who wished to continue treatment beyond the single 14C-linsitinib dose. Five patients received a single oral dose of 150 mg 14C-linsitinib, followed by collection of blood, plasma, urine, and feces for 10 days. The collected material was analyzed for total radioactivity, linsitinib, and metabolites. The safety of 150 mg of unlabeled linsitinib administered twice daily until disease progression was also assessed. The median time to reach the maximum plasma concentration of linsitinib was 3.0 h, median maximum plasma concentration was 1789 ng/mL, median terminal half-life was 2.4 h, and median apparent oral clearance was 12.45 L/h. After a single dose of 14C-linsitinib, 5.44 and 76.4 % of mean total radioactivity administered were recovered in urine and feces, respectively. Eighteen linsitinib metabolites (M1–M18) were detected in plasma, urine, and feces samples, and their structures were elucidated. The main metabolic reactions of linsitinib in humans were oxidation and sulfate conjugation. Linsitinib was well tolerated after a single dose of 14C-linsitinib, and fatigue was the most frequent adverse event following multiple doses of unlabeled linsitinib. 14C-linsitinib is rapidly absorbed and extensively metabolized. Linsitinib excretion via bile into feces is the predominant elimination route from plasma with minor renal elimination.

There are few options for prophylaxis after exposure to Bacillus anthracis , especially in children and women of childbearing potential. Faropenem is a β-lactam in the penem subclass that is being developed as an oral prodrug, faropenem medoxomil, for the treatment of respiratory tract infections. Faropenem was shown to have in vitro activity against B. anthracis strains that variably express the bla1 β-lactamase (MIC range, ≤0.06 to 1 μg/ml). In this study we evaluated the pharmacokinetic-pharmacodynamic (PK-PD) relationships between the plasma faropenem free-drug ( f ) concentrations and efficacy against B. anthracis in a murine postexposure prophylaxis inhalation model. The plasma PKs and PKs-PDs of faropenem were evaluated in BALB/c mice following the intraperitoneal (i.p.) administration of doses ranging from 2.5 to 160 mg/kg of body weight. For the evaluation of efficacy, mice received by inhalation aerosol doses of B. anthracis (Ames strain; faropenem MIC, 0.06 μg/ml) at 100 times the 50% lethal dose. The faropenem dosing regimens (10, 20, 40, and 80 mg/kg/day) were administered i.p. at 24 h postchallenge at 4-, 6-, and 12-h intervals for 14 days. The sigmoid maximum-threshold-of-efficacy ( E max ) model fit the survival data, in which the free-drug area under the concentration-time curve ( f AUC)/MIC ratio, the maximum concentration of free drug in plasma ( fC max )/MIC ratio, and the cumulative percentage of a 24-h period that the free-drug concentration exceeds the MIC under steady-state pharmacokinetic conditions ( f % T MIC ) were each evaluated. Assessment of f % T MIC demonstrated the strongest correlation with survival ( R 2 = 0.967) compared to the correlations achieved by assessment of f AUC/MIC or fC max /MIC, for which minimal correlations were observed. The 50% effective dose (ED 50 ), ED 90 , and ED 99 corresponded to f % T MIC values of 10.6, 13.4, and 16.4%, respectively, and E max was 89.3%. Overall, faropenem demonstrated a high level of activity against B. anthracis in the murine postexposure prophylaxis inhalation model.

Purpose. The objective of this study was to determine the pharmacokinetics and safety for NX1838 following injection into the vitreous humor of rhesus monkeys.

EGF receptor (EGFR) inhibitors are used in the therapy of lung and pancreatic cancers and effectively prevent cancers in multiple animal models. Although daily dosing with erlotinib is effective, weekly dosing may reduce toxicity and have advantages, particularly for prevention. We tested alternative dosing regimens for preventive/therapeutic efficacy in a rat mammary cancer model. For prevention, erlotinib was administered by gavage beginning 5 days after methylnitrosourea (MNU). For therapy and biomarker studies, rats with palpable mammary cancers were treated for six weeks or for six days, respectively. Experiment A, erlotinib (6 mg/kg body weight/day, intragastric): daily (7 times/week); one day on/one day off; and two days on/two days off. All regimens decreased tumor incidence, increased tumor latency, and decreased cancer multiplicity versus controls (P < 0.01). However, intermittent dosing was less effective than daily dosing (P < 0.05). Experiment B, erlotinib (6 mg/kg body weight/day) daily or two days on/two days off or one time per week at 42 mg/kg body weight. All regimens reduced cancer incidence and multiplicity versus controls (P < 0.01). Interestingly, daily and weekly dosing were equally effective (P > 0.5). Experiment C, erlotinib administered at 42 or 21 mg/kg body weight 1 time per week, decreased tumor incidence and multiplicity (P < 0.01). Erlotinib had a serum half-life of ≤8 hours and weekly treatment yielded effective serum levels for ≤48 hours. Daily or weekly treatment of cancer bearing rats reduced mammary tumor size 25% to 35%, whereas control cancers increased >250%. Levels of phosphorylated extracellular signal-regulated kinase (ERK) were strongly decreased in rats treated daily/weekly with erlotinib. Thus, altering the dose of erlotinib retained most of its preventive and therapeutic efficacy, and based on prior clinical studies, is likely to reduce its toxicity. Cancer Prev Res; 6(5); 448–54. ©2013 AACR.

Introduction: ASP2215, a new tyrosine kinase inhibitor with activity against FMS-like receptor tyrosine kinase-3 (FLT3) and AXL receptor tyrosine kinase, is currently in development for the treatment of acute myeloid leukemia (AML). Methods: In an ongoing, first-in-human Phase 1/2, dose-escalation/dose-expansion study, the pharmacokinetic (PK) profile and pharmacodynamic (PD) effects of ASP2215 were evaluated under fasting conditions in patients with relapsed or refractory AML (R/R AML). Patients who met study criteria were assigned to treatment in the dose-escalation cohorts or were randomized to an open dose level in the dose-expansion cohorts. The dose-escalation cohort was a modified 3+3 with accelerated titration design that evaluated ascending oral doses of ASP2215 (20-450 mg), the dose-expansion cohort was a parallel, multi-dose-expansion cohort. Blood samples were collected and safety/tolerability assessments, including 12-lead electrocardiogram, were evaluated at protocol-specified time points for both cohorts. Effect of increasing ASP2215 exposure on inhibition of FLT3 phosphorylation, assessed via plasma inhibitory assay (PIA), was evaluated using an inhibitory PK/PD Emaxmodel. PK/PD analyses were performed to evaluate the relationship between ASP2215 exposure and changes from baseline in QTcF intervals (ΔQTcF) and changes from baseline in clinical laboratory values (e.g., creatinine kinase [ΔCK], aspartate aminotransferase [ΔAST]). Results: Data from an interim analysis of the dose-escalation/dose-expansion study were available from 215 subjects (n=23 [dose escalation], n=192 [dose expansion]). The ASP2215 PK parameters across the dose range (20-450 mg), evaluated after both single- and multiple-dose administration, are presented (Table); statistical analyses suggest the ASP2215 PK parameters are dose proportional from 20-450 mg. Median time to maximal concentration (Tmax) was observed between 2 hr and 6 hr after single and repeated oral dosing. The estimated median half-life (t1/2) ranged from approximately 45 hr to 159 hr based on the accumulation ratio; ASP2215 accumulation was extensive after multiple dose administration as reflected by the accumulation index (Rac) ranging from approximately 3.2-10. A strong correlation was shown for ASP2215 exposure-related inhibition of FLT3 phosphorylation, with >90% FLT3 inhibition observed by Day 8 at ASP2215 doses of ≥80 mg. Although a positive slope was observed between ΔQTcF and ASP2215 exposure, only 5% of the study population were reported as having a maximum post-baseline QTcF interval >500 msec. A similar trend was observed with ASP2215 concentration-related increases in ΔCK and ΔAST; however, Conclusions: ASP2215 has demonstrated exposure-related FLT3 inhibition and a pharmacokinetic profile that support once-daily oral administration for the treatment of AML in subjects who relapsed after, or are refractory to, induction or salvage treatment. Table. ASP2215 Pharmacokinetic Parameters after Multiple-Dose Administration 20 mg (n=4) 40 mg (n=3) 80 mg (n=3) 120 mg (n=3) 200 mg (n=2) 300 mg (n=3) 450 mg (n=3) Cmax(ng/mL) 45.6 (30.5, 137) 106 (76.7, 140) 396 (217, 516) 282 (248, 593) 1460 (886, 2040) 1260 (1040, 2280) 1150 (776, 1530) Tmax(hr) 4.01 (4.00, 6.00) 3.87 (0.500, 6.00) 4.33 (4.00, 4.42) 2.02 (1.95, 5.75) 6.03 (6.00, 6.07) 6.05 (4.08, 6.07) 5.00 (4.07, 5.93) AUC0-24(ng·h/mL) 926 (543, 2480) 2460 (1750, 2800) 6280 (4160, 10600) 6190 (4200, 11300) 31500 (16500, 46600) 28700 (22300, 43300) 11500 (8070, 14900) t1/2 (hr) 52.8 (39.7, 83.1) 83.7 (68.5, 243) 91.5 (60.9, 108) 45.3 (30.5, 63.3) 143 (99.7, 186) 159 (83.3, 187) 56.9 (51.5, 62.3) Rac 3.70 (2.92, 5.51) 5.55 (4.64, 15.1) 6.02 (4.18, 7.02) 3.25 (2.38, 4.33) 9.08 (6.51, 11.7) 10.1 (5.53, 11.7) 3.94 (3.62, 4.27) Data are presented as median (minimum, maximum). AUC0-24, area under the concentration-time curve between 0-24 hr; Cmax, maximal concentration; t1/2, elimination half-life; Tmax, time to maximal concentration; Rac, accumulation ratio. Disclosures Smith: Astellas: Research Funding; Plexxikon: Research Funding. Off Label Use: ASP2215 is an investigational product for the treatment of AML. Perl:Astellas US Pharma Inc.: Consultancy; Ambit/Daichi Sankyo: Consultancy; Arog Pharmaceuticals: Consultancy; Asana Biosciences: Consultancy; Actinium Pharmaceuticals: Consultancy. Altman:Novartis: Other: Advisory board; BMS: Other: Advisory board; Seattle Genetics: Other: Advisory board; Spectrum: Other: Advisory board; Ariad: Other: Advisory board; Astellas: Other: Advisory board; assistance with abstract preparation. Gill:Astellas Pharma US, Inc: Employment. Kadokura:Astellas Pharma Global Development: Employment, Other: Personal fees. Yuen:Astellas Pharma, Inc.: Employment. Fisniku:Astellas: Employment. Liu:Astellas: Employment. Nagase:Astellas: Employment. Sargent:Astellas Pharma US, Inc: Employment. Bahceci:Astellas Pharma Global Development: Employment.

Background : Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) is a potent inducer of new blood vessel growth (angiogenesis) that contributes to the pathology of many angiogenesis-associated disease states such as psoriasis, rheumatoid arthritis and cancer. Few molecular entities capable of binding to VPF/VEGF with high affinity and specificity have been described to date. Results : Nuclease-resistant 2′-amino-2′-deoxypyrimidine nucleotide RNA (2′-aminopyrimidine RNA) ligands that bind to VPF/VEGF with high affinity have been identified by iterative rounds of affinity-selection/amplification from two independent random libraries. The sequence information that confers high affinity binding toVPF/VEGF is contained in a contiguous stretch of 24 nucleotides, 5′- CCCUGAUGGUAGACGCCGGGGUG -3′ (2′-aminopyrimidine nucleotides are designated with italic letters). Of the 14 ribopurines in this minimal ligand, 10 can be substituted with the corresponding 2′-O-methylpurine nucleotides without a reduction in binding affinity to VPF/VEGF. In fact, the 2′ O-methyl substitution at permissive positions leads to a ∼17-fold improvement in the binding affinity to VPF/VEGF The higher affinity results from the reduction in the dissociation rate constant of the 2′-O-methyl-substituted RNA ligand from the protein compared to the unsubstituted ligand. The 2′-O-methyl-substituted minimal ligand, which folds into a bulged hairpin motif, is also more thermally stable than the unsubstituted ligand. Nuclease resistance of the ligand is further improved by the 2′-O-methyl substitutions and the addition of short phosphorothioate caps to the 3′- and 5′-ends. Conclusions : We have used the SELEX (systematic evolution of ligands by exponential enrichment) process in conjunction with post-SELEX modifications to define a highly nuclease-resistant oligonucleotide that binds to VPF/VEGF with high affinity and specificity.

Abstract 4327 Quizartinib (AC220) is an oral tyrosine kinase inhibitor that has shown promising activity in refractory/relapsed acute myeloid leukemia patients in a Phase 1 and a Phase 2 study. The absorption, metabolism, and excretion of quizartinib were characterized in healthy volunteers in a Phase 1 mass balance study. Six healthy males (mean ± SD age 29 ± 8.4 years) received a single oral dose of 60 mg quizartinib as a solution; approximately 1.6% of the total dose was labeled with 14C (approximately 100 μCi). Blood, plasma, urine, and feces were collected for 14 days (336 h) after dosing. Maximum mean ± SD blood radioactivity concentrations, reached 4 h after dosing, were 296 ± 67.4 ng equivalents/g. Maximum blood radioactivity concentrations in individual subjects occurred 4 h after dosing and ranged from 228 to 397 ng equivalents/g. Excretion of radioactivity was relatively consistent throughout the study. The maximum mean ± SD urinary concentration of radioactivity was 112 ± 52.3 ng equivalents/g at 8 to 24 hours after dosing, and the maximum mean ± SD fecal concentration of radioactivity was 51,100 ± 21,300 ng equivalents/g at 24 to 48 h after dosing. A mean ± SD of 1.64 ± 0.482% of the dose was recovered in urine, and 76.3 ± 6.23% was recovered in feces. The overall mean ± SD recovery of radioactivity in urine and feces was 78.0 ± 6.24% over the course of the study, with recovery from individual subjects ranging from 72.4% to 88.3%. Excretion of radioactivity was still ongoing at study completion (336 h). Recovery of The major radiolabeled components of plasma were unchanged quizartinib and the oxidative metabolite AC886. Five additional metabolites in plasma were identified by LC-MS but could not be identified by measurement of radioactivity, because of low levels. Eighteen radioactive peaks in urine were detected, representing less than 0.09% of the administered dose, but their putative structures could not be identified because of low levels. Quizartinib was extensively metabolized, with the metabolites excreted primarily in feces, suggesting hepatobiliary excretion of radioactivity, non-biliary excretion into the gastrointestinal tract, or metabolism within the gastrointestinal tract. Forty-two radioactive peaks were detected in fecal extracts, of which unchanged quizartinib was a significant radioactive component (mean of 4.0% of the administered radioactive dose), and 15 metabolites, each representing a mean of 1.0% to 3.5% of the administered radioactive dose, were identified. Quizartinib was predominantly metabolized by phase I biotransformations, as was evident by the absence of any conjugates of quizartinib or of oxidative metabolites under the analytical conditions used to profile plasma, urine, and feces. Quizartinib was metabolized by multiple biotransformation pathways, including oxidation, reduction, dealkylation, deamination, and hydrolysis, and by combinations of these pathways. Quizartinib was well tolerated as a single 60 mg dose in this study. There were no clinically significant changes in vital signs, ECGs, or laboratory test results. Two subjects experienced adverse events. Grade 1 dry skin in 1 subject was considered to be unrelated to study treatment, and Grade 1 diarrhea in 1 subject was considered to be possibly related to treatment. The results of this study indicated that, in humans, quizartinib was orally available and predominantly eliminated in feces, with renal clearance as a minor elimination route, and that AC886 was the only major metabolite in the circulation. Disclosures: Li: Ambit Biosciences: Employment. Bresnahan:Ambit Biosciences: Employment. Gammon:Ambit Biosciences: Employment. Sanga:Covance Laboratories, Inc.: Employment. Hale:Covance, Inc.: Employment. Hashimoto:Astellas Pharma, Inc.: Employment. Gill:Astellas Pharma, Inc.: Employment. James:Ambit Biosciences: Employment.