Search

Motions of two distinct ions can get correlated because the polarization induced by the ions can propagate through intervening water and can interfere with each other. This important aspect, which is not included in the continuum model based theories, has not been studied adequately. We calculate the effective force between two oppositely charged and similarly charged ions fixed in water as a function of separation distance R. At short separations, R less than 1.5 nm, the effective force vastly differs from the 1/esR2 dependence advocated by the screened Coulomb’s force law (SCFL), where es is the static dielectric constant of the medium. This breakdown of the SCFL is shown to be due to the persistent interference between the polarizations created by the two charges in a manner similar to the vortex–antivortex pair formation in the XY model Hamiltonian. The distance dependence of dielectric constants, es(R), extracted from our simulation exhibits interesting features and can be used in future modeling. In addition, we show that the force–force time autocorrelation between two neighboring ions decays differently at short separation and analyze the friction on the ion pair at different separation distances.Motions of two distinct ions can get correlated because the polarization induced by the ions can propagate through intervening water and can interfere with each other. This important aspect, which is not included in the continuum model based theories, has not been studied adequately. We calculate the effective force between two oppositely charged and similarly charged ions fixed in water as a function of separation distance R. At short separations, R less than 1.5 nm, the effective force vastly differs from the 1/esR2 dependence advocated by the screened Coulomb’s force law (SCFL), where es is the static dielectric constant of the medium. This breakdown of the SCFL is shown to be due to the persistent interference between the polarizations created by the two charges in a manner similar to the vortex–antivortex pair formation in the XY model Hamiltonian. The distance dependence of dielectric constants, es(R), extracted from our simulation exhibits interesting features and can be used in future modeling. In...

c-Jun N-terminal kinase (JNK), a member of the MAPK family, is associated with a variety of diseases and immune responses. To dissect the mechanistic role of JNKs in such processes, a specific inhibitor for JNKs holds great value. SP600125 is a widely used inhibitor of JNKs despite its non-specific activity. In an effort to obtain better specific inhibitors, three anthrapyrazolone halogenated derivatives have been synthesized and characterized. Among the three derivatives, 5-chloro-2-(2-chloroethyl)dibenzo[cd,g] indazol-6(2H)-one is clearly established as a specific inhibitor of JNK with augmented expression of chemokines in LPS-activated macrophages based on modelling studies followed by in vitro and ex vivo evaluation.

Ferroelectric based piezoceramics exhibiting large electromechanical response are used as sensors, actuators, and transducers in wide-ranging applications spanning sectors like space, defense, medical diagnostics, etc. In general, the large piezoelectric response in ferroelectric solid solutions is associated with a composition driven interferroelectric instability, commonly known as a morphotropic phase boundary (MPB). Here, we show that MPB is not necessarily required to achieve electromechanical response equivalent to, or even more than what can be achieved in MPB based ferroelectric solid solutions. We show this on two ferroelectric solid solution systems, namely, $(1--x)\mathrm{PbTi}{\mathrm{O}}_{3}\ensuremath{-}(x)\mathrm{Bi}(\mathrm{N}{\mathrm{i}}_{1/2}\mathrm{H}{\mathrm{f}}_{1/2}){\mathrm{O}}_{3}$ (PT-BNH) and $(\mathrm{Bi},\mathrm{La})\mathrm{Fe}{\mathrm{O}}_{3}\ensuremath{-}\mathrm{PbTi}{\mathrm{O}}_{3}$ (BF-PT:La) which show large piezoelectric response (${d}_{33}\ensuremath{\sim}450\phantom{\rule{0.16em}{0ex}}\mathrm{pC}/\mathrm{N}$) and extraordinarily high electrostrain of \ensuremath{\sim}1.3%, respectively. Although analogous to the conventional MPB systems, the critical compositions of these two alloys mimic a two-phase structural state (cubic + tetragonal), detailed analysis that suggests that it is not so. The cubic phase is rather a manifestation of short correlation length of the tetragonal regions and appears when the system is compositionally driven from a normal ferroelectric state to a relaxor ferroelectric state. This proves that, in contrast to conventional MPB systems, the large electromechanical response of the critical compositions of PT-BNH and BF-PT:La is not due to interferroelectric instability enabled polarization rotation. In the absence of the MPB, the sole contributor to large electromechanical response is a process associated with domain wall motion, large local polarization, and (non-MPB) lattice softening. The generalized ideas derived from our investigation offer scope for expanding the basket of high-performance piezoelectric materials by exploring solid solutions outside of the MPB framework.

The formation of two triplet excitons at the cost of one photon via singlet exciton fission in organic semiconductors can potentially enhance the photocurrent in photovoltaic devices. However, the role of spin density distribution in driving this photophysical process has been unclear until now. Here we present the significance of electronic spin density distribution in facilitating efficient intramolecular singlet exciton fission (iSEF) in π-bridged pentacene dimers. We synthetically modulate the spin density distribution in a series of pentacene dimers using phenyl-, thienyl- and selenyl- flanked diketopyrrolopyrrole (DPP) derivatives as π-bridges. Using femtosecond transient absorption spectroscopy, we find that efficient iSEF is only observed for the phenyl-derivative in ~2.4 ps while absent in the other two dimers. Electronic structure calculations reveal that phenyl-DPP bridge localizes α- and β-spin densities on distinct terminal pentacenes. Upon photoexcitation, a spin exchange mechanism enables iSEF from a singlet state which has an innate triplet pair character., Singlet exciton fission – the separation of photoexcited singlet states into two triplet states – holds promise for enhancing photocurrents in photovoltaic technologies. Krishnapriya et al. characterize how electron delocalization over the bridges in a series of pentacene dimers controls this process.

A green colored nano-pigment Y2BaCuO5 with impressive near infra-red (NIR) reflectance (61% at 1100 nm) was synthesized by a nano-emulsion method. The developed nano-crystalline powders were characterized by X-ray diffraction (XRD), Transmission electron microscopy (TEM), UV-vis-NIR diffuse reflectance spectroscopy and CIE-L*a*b* 1976 color scales. The XRD and Rietveld analyses of the designed pigment powders reveal the orthorhombic crystal structure for Y2BaCuO5, where yttrium is coordinated by seven oxygen atoms with the local symmetry of a distorted trigonal prism, barium is coordinated by eleven oxygen atoms, and the coordination polyhedron of copper is a distorted square pyramid CuO5]. The UV-vis spectrum of the nano-pigment exhibits an intense d-d transition associated with CuO5 chromophore between 2.1 and 2.5 eV in the visible domain. Therefore, a green color has been displayed by the developed nano-pigment. The potential utility of the nano-pigments as ``Cool Pigments'' was demonstrated by coating on to a building roofing material like cement slab and PVC coatings. (C) 2014 Elsevier Ltd. All rights reserved.

Several time dependent fluorescence Stokes shift (TDFSS) experiments have reported a slow power law decay in the hydration dynamics of a DNA molecule. Such a power law has neither been observed in computer simulations nor in some other TDFSS experiments. Here we observe that a slow decay may originate from collective ion contribution because in experiments DNA is immersed in a buffer solution, and also from groove bound water and lastly from DNA dynamics itself. In this work we first express the solvation time correlation function in terms of dynamic structure factors of the solution. We use mode coupling theory to calculate analytically the time dependence of collective ionic contribution. A power law decay in seen to originate from an interplay between long-range probe-ion direct correlation function and ion-ion dynamic structure factor. Although the power law decay is reminiscent of Debye-Falkenhagen effect, yet solvation dynamics is dominated by ion atmosphere relaxation times at longer length scales (small wave number) than in electrolyte friction. We further discuss why this power law may not originate from water motions which have been computed by molecular dynamics simulations. Finally, we propose several experiments to check the prediction of the present theoretical work.

Extending our earlier investigation of magnetic properties of Nd2NiMnO6, we show that it exhibits a magnetic transition below ∼6 K to a ferrimagnetic state. This behavior is interpreted as arising from a long-range ordering of Nd moments antiferromagnetically coupled to the ferromagnetic Ni–Mn ordered moments. Due to the richness of its multiple magnetic transitions and the easily influenced magnetic state by the application of an external magnetic field, established in our earlier study, it has a remarkable inverse magneto-caloric effect (IMCE) at low temperatures (T c ∼ 200 K). IMCE and CMCE correspond to the antiferromagnetic arrangement of Nd and Ni–Mn sublattices and ferromagnetic ordering of Ni–Mn sublattices, respectively. Nd2NiMnO6 with its second order phase transition follows the universal behavior of ∆SM(T); it also shows a power law dependency on the magnetic field as Δ S M ∝ H η .

Iron-based superconductors have been found to exhibit an intimate interplay of orbital, spin, and lattice degrees of freedom, dramatically affecting their low-energy electronic properties, including superconductivity. Albeit the precise pairing mechanism remains unidentified, several candidate interactions have been suggested to mediate the superconducting pairing, both in the orbital and in the spin channel. Here, we employ optical spectroscopy (OS), angle-resolved photoemission spectroscopy (ARPES), ab initio band-structure, and Eliashberg calculations to show that nearly optimally doped NaFe$_{0.978}$Co$_{0.022}$As exhibits some of the strongest orbitally selective electronic correlations in the family of iron pnictides. Unexpectedly, we find that the mass enhancement of itinerant charge carriers in the strongly correlated band is dramatically reduced near the $\Gamma$ point and attribute this effect to orbital mixing induced by pronounced spin-orbit coupling. Embracing the true band structure allows us to describe all low-energy electronic properties obtained in our experiments with remarkable consistency and demonstrate that superconductivity in this material is rather weak and mediated by spin fluctuations., Comment: Open access article available online at http://www.nature.com/articles/srep18620

There has been a paradigm shift in research foci toward elemental electrodes from the conventional intercalation compound-based electrochemical storage. Replacing intercalation transition metal (oxide) compounds with elemental cathodes (e.g., sulfur, oxygen) theoretically raises the storage capacities by more than one order in magnitude. The insulating nature and complexities of the redox reaction associated with electroactive elements necessitates their housing inside an electronic conductor, which has been mainly carbon. Efficiency of the electrochemical storage using such elemental electrodes, besides depending on factors related to the electrolyte, solid-state diffusion, mainly depends on characteristics of the carbon host. We report here a novel, simple, and efficient pressure-induced capillary encapsulation protocol for the confinement of chalcogens, sulfur (5) and selenium (Se), inside carbon nanotubes (CNTs). Confinement led to lowering of the surface tension of molten S/Se, resulting in superior wetting and ultrahigh loading of the CNTs. Higher than 95% of the CNTs is loaded, and very high loading, nearly 85% of S/Se inside the CNTs, is achieved. When assembled at a very high areal loading (similar to 10 mg cm(-2)) in the Li-S/Se battery, the S/Se-CNT cathodes exhibited very stable cyclability and high values of specific capacity at widely varying operating current densities (0.1-10 C-rates).

In recent years, Graphene Oxide (GO) and its derivatives have attracted significant attention owing to their unique physicochemical, optical and conductive properties and have been used in a diverse range of applications. One of the properties of GO, which is important for its applications in biological systems, is the nature of its interactions with biomolecules such as proteins. We present here the dynamic aspects of the interaction of GO with human ubiquitin (8.6 kDa) unraveled using nuclear magnetic resonance (NMR) spectroscopy. This study, for the first time, reveals an interaction involving fast and reversible association-dissociation of the protein molecules from the surface of the GO sheet. The conformation of the protein is not affected due to the interactions. The interactions were found to be electrostatic in nature and are attributed to the polar functional groups present on the protein and GO sheets, which was verified by titration of GO with ubiquitin at different pH. Taken together, the study provides new insights into protein-GO interactions, and the NMR methods described will be of utility for probing such interactions in general while designing new chemical and biological applications involving functionalized graphene oxide.

Olivine structured lithium iron phosphate, LiFePO4 (LFP), is a promising alternative cathode material due to its high theoretical capacity (170 mA h g(-1)), low cost and higher environmental compatibility. However, due to its poor electronic conductivity and Li+-ion diffusivity the electrochemical performance of LFP deteriorates with increasing charge/discharge rates. Networking of downsized LFP particles with an improperly chosen carbon conduit may not effectively reduce the Li+-ion diffusion pathways and improve electron transport. We demonstrate here a unique 3D configuration comprising ultra-small LFP particles (size: 5 +/- 2 nm) ``adhered'' to few-layer reduced holey-graphene oxide sheets (h-GO) that allows Li+-ions to traverse shorter non-tortuous pathways. The h-GO sheets, which are only

Single crystals of lithium D-isoascorbate monohydrate (LDAM), (C6H7O6Li center dot H2O), are grown by a solution growth method. The crystal structure of LDAM is solved using single crystal X-ray diffraction. The space group is orthorhombic P2(1)2(1)2(1) with four formula units per unit cell and lattice parameters a = 7.7836(3) angstrom, b = 8.7456(3) angstrom, and c = 11.0368(4) angstrom. Solubility of the material in water is determined thermogravimetrically and found to have a positive temperature coefficient of solubility. Large optical quality single crystals are subsequently grown from aqueous solution by a slow cooling method. The crystal has a bulky prismatic habit and among the prominent faces the c face appears as the only principal morphological face. The crystal exhibits a (010) cleavage. Dielectric spectroscopy reveals a nearly Debye type Cole-Cole behavior with anisotropy in relaxation. Optical transmission range is found to be from 300 to 1400 nm. The principal refractive indices of this biaxial crystal, measured using Brewster's angle method, at wavelengths 405, 543, and 632.8 nm, show high dispersion. The crystal is negative biaxial with 2V(z) = 107.8 degrees (405 nm) and belongs to the Hobden class 3. Theoretically generated type 1 and type 2 second order phase matching curves match very well with the experimental results. The second-order nonlinear coefficient d(14) was determined to be 7 x 10(-13) m/V. For the optimum phase matching direction (type 2), the second-order effective nonlinear coefficient and the walk off angle are determined to be 0.84 times d(14) and 3.5 degrees respectively. The crystal possesses high multiple surface damage thresholds of 18 GW/cm(2) and 8 GW/cm(2) at laser wavelengths 1064 and 532 nm, respectively.

New C-13-detected NMR experiments have been devised for molecules in solution and solid state, which provide chemical shift correlations of methyl groups with high resolution, selectivity and sensitivity. The experiments achieve selective methyl detection by exploiting the one bond J-coupling between the C-13-methyl nucleus and its directly attached C-13 spin in a molecule. In proteins such correlations edit the C-13-resonances of different methyl containing residues into distinct spectral regions yielding a high resolution spectrum. This has a range of applications as exemplified for different systems such as large proteins, intrinsically disordered polypeptides and proteins with a paramagnetic centre.

While the effect of electrochemical doping on single-layer graphene (SG) with holes and electrons has been investigated, the effect of charge-transfer doping on SG has not been examined hitherto. Effects of varying the concentration of electron donor and acceptor molecules such as tetrathiafulvalene (TTF) and tetracyanoethylene (TCNE) on SG produced by mechanical exfoliation as well as by the reduction of single-layer graphene oxide have been investigated. TTF softens the G-band in the Raman spectrum, whereas TCNE stiffens the G-band. The full-width-at-half-maximum of the G-band increases on interaction with both TTF and TCNE. These effects are similar to those found with few-layer graphene, but in contrast to those found with electrochemical doping. A common feature between the two types of doping is found in the case of the 2-D band, which shows softening and stiffening on electron and hole doping, respectively. The experimental results are explained on the basis of the frequency shifts, electron-phonon coupling and structural inhomogeneities that are relevant to molecule-graphene interaction.

By employing x-ray photoelectron spectroscopy (XPS), we have been able to establish the occurrence of charge-transfer doping in few-layer graphene covered with electron acceptor (TCNE) and donor (TTF) molecules. We have performed quantitative estimates of the extent of charge transfer in these complexes and elucidated the origin of unusual shifts of their Raman G bands and explained the differences in the dependence of conductivity on n- and p-doping. The study unravels the cause of the apparent difference between the charge-transfer doping and electrochemical doping., Comment: 15 pages, 5 figures

For a general tripartite system in some pure state, an observer possessing any two parts will see them in a mixed state. By the consequence of Hughston-Jozsa-Wootters theorem, each basis set of local measurement on the third part will correspond to a particular decomposition of the bipartite mixed state into a weighted sum of pure states. It is possible to associate an average bipartite entanglement ($\bar{\mathcal{S}}$) with each of these decompositions. The maximum value of $\bar{\mathcal{S}}$ is called the entanglement of assistance ($E_A$) while the minimum value is called the entanglement of formation ($E_F$). An appropriate choice of the basis set of local measurement will correspond to an optimal value of $\bar{\mathcal{S}}$; we find here a generic optimality condition for the choice of the basis set. In the present context, we analyze the tripartite states $W$ and $GHZ$ and show how they are fundamentally different., Comment: 14+ pages, 1 figure; final version; in different context, a part of the work can be found at arXiv:1201.5620

A study on self-assembly of anisotropically substituted penta-aryl fullerenes in water has been reported. The penta-phenol-substituted amphiphilic fullerene derivative C60Ph5(OH)(5)],exhibited self-assembled vesicular nanostructures in water under the experimental conditions. The size of the vesicles Was observed to depend upon the kinetics of self-assembly and could be varied from similar to 300 to similar to 70 nm. Our mechanistic study indicated that the self-assembly of C60Ph5(OH)(5) is driven by extensive intermolecular as well as water-mediated hydrogen :bonding along with fullerene-fullerene hydrophobic interaction in water. The cumulative effect of these interactions is responsible for the stability of vesicular structures even on the removal of solvent. The substitution of phenol with anisole resulted in different packing and interaction of the fullerene derivative, as Indicated in the molecular dynamics studies, thus resulting in different self-assembled nanostructures. The hollow vesicles were further encapsulated with a hydrophobic conjugated polymer and water-soluble dye as guest molecules. Such confinement of pi-conjugated polymers in fullerene has significance in bulk heterojunction devices for efficient exciton diffusion.

We study sequence dependent complexation between oligonucleotides (single strand DNA) and various generation ethylene diamine (EDA) cored poly amido amide (PAMAM) dendrimers through atomistic molecular dynamics simulations accompanied by free energy calculations and inherent structure determination. Simulations reveal formation of a stable complex and provide a detailed molecular level understanding of the structure and dynamics of such a complexation. The reaction free energy surface in the initial stage is found to be funnel-like with a significant barrier arising in the late stage due to the occurrence of misfolded states of DNA. Complexation shows surprisingly strong sensitivity to the ssDNA sequence which is found to arise from a competition between enthalpic versus entropic rigidity of ssDNA., Comment: 28 pages

Symmetrized density-matrix-renormalization-group calculations have been carried out, within Pariser-Parr-Pople Hamiltonian, to explore the nature of the ground and low-lying excited states of long polythiophene oligomers. We have exploited C-2 symmetry and spin parity of the system to obtain excited states of experimental interest, and studied the lowest dipole allowed excited state and lowest dipole forbidden two photon state, for different oligomer sizes. In the long system limit, the dipole allowed excited state always lies below the lowest dipole forbidden two-photon state which implies, by Kasha rule, that polythiophene fluoresces strongly. The lowest triplet state lies below two-photon state as usual in conjugated polymers. We have doped the system with a hole and an electron and obtained the charge excitation gap and the binding energy of the 1(1)B(u)(-) exciton. We have calculated the charge density of the ground, one-photon and two-photon states for the longer system size of 10 thiophene rings to characterize these states. We have studied bond order in these states to get an idea about the equilibrium excited state geometry of the system. We have also studied the charge density distribution of the singly and doubly doped polarons for longer system size, and observe that polythiophenes do not support bipolarons.

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is subdiffusive, with mean square displacement (MSD) growing as $t^{\alpha}$ with $\alpha \simeq 0.43$. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859–73). We compare these results with dynamics of watermolecules at the surface of an anionicmicelle, cesiumperfluorooctanoate(CsPFO). Watermolecules on the surface ofCsPFOalso exhibit slowtranslation and non-exponential orientational dynamics.

Elastic properties of $Li_{2}O-PbO-B_{2}O_{3}$ glasses have been investigated using sound velocity measurements at 10 MHz. Four series of glasses have been investigated with different concentrations of $Li_{2}O$, PbO and $B_{2}O_{3}$. The variations of molar volume have been examined for the influences of $Li_{2}O$ and PbO. The elastic moduli reveal trends in their compositional dependence. The bulk and shear modulus increases monotonically with increase in the concentration of tetrahedral boron which increases network dimensionality. The variation of bulk moduli has also been correlated to the variation in energy densities. The Poisson's ratio found to be insensitive to the concentration of tetrahedral boron in the structure. The experimental Debye temperatures are in good agreement with the expected theoretical values. Experimental observations have been examined in view, the presence of borate network and the possibility of non-negligible participation of lead in network formation.

We propose an alternative explanation of the size-dependent maximum in ion mobility in water in terms of the levitation effect, which accounts for the observed size-dependent maximum in the mobility of guest diffusion in porous media. In this explanation, the size at which the maximum occurs is related to the structure of the void space of the water; at the mobility maximum, the diffusant passes smoothly through necks connecting voids, and its potential energy shows minimum fluctuations. Molecular dynamics simulations of charged spheres of varying sizes are used to support this hypothesis. As in the levitation effect, the friction coefficient, the potential energy fluctuations, and the activation energy are found to be minima for particles with maximum self diffusivities similar to the guest diffusion in zeolites. Wavelength-dependent self diffusivities indicate a monotonic and oscillatory dependence, respectively, on wavenumber k for anomalous (AR) and linear regimes (LR). These are associated with single and biexponential decay of the incoherent intermediate scattering function.

We present results of extensive computer simulations and theoretical analysis of vibrational phase relaxation of a nitrogen molecule along the critical isochore and also along the gas-liquid coexistence. The simulation includes all the different contributions [atom-atom (AA), vibration-rotation (VR) and resonant transfer] and their cross-correlations. Following Everitt and Skinner, we have included the vibrational coordinate ($q$) dependence of the interatomic potential. It is found that the latter makes an important contribution. The principal important results are: (a) a crossover from a Lorentzian-type to a Gaussian line shape is observed as the critical point is approached along the isochore (from above), (b) the root mean square frequency fluctuation shows nonmonotonic dependence on the temperature along critical isochore, (c) along the coexistence line and the critical isochore the temperature dependent linewidth shows a divergence-like $\lambda$-shape behavior, and (d) the value of the critical exponents along the coexistence and along the isochore are obtained by fitting. The origin of the anomalous temperature dependence of linewidth can be traced to simultaneous occurrence of several factors, (i) the enhancement of negative cross-correlations between AA and VR contributions and (ii) the large density fluctuations as the critical point (CP) is approached. The former makes the decay faster so that local density fluctuations are probed on a femtosecond time scale. A mode coupling theory (MCT) analysis shows the slow decay of the enhanced density fluctuations near critical point. The MCT analysis demonstrates that the large enhancement of VR coupling near CP arises from the non-Gaussian behavior of density fluctuation and this enters through a nonzero value of the triplet direct correlation function., Comment: 35 pages, 15 figures, revtex4 (preprint form)

Severe sepsis or septic shock is one of the rising causes for mortality worldwide representing nearly 10% of intensive care unit admissions. Susceptibility to sepsis is identified to be mediated by innate pattern recognition receptors and responsive signaling pathways of the host. The c-Jun N-terminal Kinase (JNK)-mediated signaling events play critical role in bacterial infection triggered multi-organ failure, cardiac dysfunction and mortality. In the context of kinase specificities, an extensive library of anthrapyrazolone analogues has been investigated for the selective inhibition of c-JNK and thereby to gain control over the inflammation associated risks. In our comprehensive biochemical characterization, it is observed that alkyl and halogen substitution on the periphery of anthrapyrazolone increases the binding potency of the inhibitors specifically towards JNK. Further, it is demonstrated that hydrophobic and hydrophilic interactions generated by these small molecules effectively block endotoxin-induced inflammatory genes expression in in vitro and septic shock in vivo, in a mouse model, with remarkable efficacies. Altogether, the obtained results rationalize the significance of the diversity oriented synthesis of small molecules for selective inhibition of JNK and their potential in the treatment of severe sepsis.

We study Heisenberg spin-1/2 and spin-1 chains with alternating ferromagnetic ($J_1^F$) and antiferromagnetic ($J_1^A$) nearest-neighbor interactions and a ferromagnetic next-nearest-neighbor interaction ($J_2^F$). In this model frustration is present due to the non-zero $J_2^F$. The model with site spin $s$ behaves like a Haldane spin chain with site spin 2$s$ in the limit of vanishing $J_2^F$ and large $J_1^F/J_1^A$. We show that the exact ground state of the model can be found along a line in the parameter space. For fixed $J_1^F$, the phase diagram in the space of $J_1^A-J_2^F$ is determined using numerical techniques complemented by analytical calculations. A number of quantities, including the structure factor, energy gap, entanglement entropy and zero temperature magnetization, are studied to understand the complete phase diagram. An interesting and potentially important feature of this model is that it can exhibit a macroscopic magnetization jump in the presence of a magnetic field; we study this using an effective Hamiltonian., 24 pages; 18 figures; 1 table; open chain results excluded; final version, to appear in J. Phys.: Condens. Matter

N-Alkyl substituted pyrazoloanthrone derivatives were synthesized, characterized and tested for their in vitro inhibitory activity over c-Jun N-terminal kinase (JNK). Among the tested molecules, a few derivatives showed significant inhibitory activity against JNK with minimal off-target effect on other mitogen-activated protein kinase (MAP kinase) family members such as MEK1/2 and MKK3,6. These results suggested that N-alkyl (propyl and butyl) bearing pyrazoloanthrone scaffolds provide promising therapeutic inhibitors for JNK in regulating inflammation associated disorders.

Hexagonal Ln(2)CuTiO(6) (Ln = Y, Dy, Ho, Er, and Yb) exhibits a rare combination of interesting dielectric properties, in the form of relatively large dielectric constants (epsilon' > 30), low losses, and extremely small temperature and frequency dependencies, over large ranges of temperature and frequency Choudhury et al., Appl. Phys. Lett. 96, 162903 (2010) and Choudhury et al., Phys. Rev. B 82, 134203 (2010)], making these compounds promising as high-k dielectric materials. The authors present a brief review of the existing literature on this interesting class of oxides, complimenting it with spectroscopic data in conjunction with first-principles calculation results, revealing a novel mechanism underlying these robust dielectric properties. These show that the large size differences in Cu2+ and Ti4+ at the B-site, aided by an inherent random distribution of CuO5 and TiO5 polyhedral units, frustrates the ferroelectric instability, inherent to the noncentrosymmetric P6(3) cm space group of this system, and gives rise to the observed relatively large dielectric constant values. Additionally, the phononic contributions to the dielectric constant are dominated primarily by mid-frequency (>100 cm(-1)) polar modes, involving mainly Ti4+ 3d(0) ions. In contrast, the soft polar phonon modes with frequencies typically less than 100 cm(-1), usually responsible for dielectric properties of materials, are found to be associated with non-d(0) Cu2+ ions and to contribute very little, giving rise to the remarkable temperature stability of dielectric properties of these compounds. (C) 2014 American Vacuum Society.

One of the fascinating fields of study in magnetism in recent years has been the study of quantum phenomena in nanosystems. While semiconductor structures have provided paradigms of nanosystems from the stand point of electronic phenomena, the synthesis of high nuclearity transition metal complexes have provided examples of nano magnets. The range and diversity of the properties exhibited by these systems rivals its electronic counterparts. Qualitative understanding of these phenomena requires only a knowledge of basic physics, but quantitative study throws up many challenges that are similar to those encountered in the study of correlated electronic systems. In this article, a brief overview of the current trends in this area are highlighted and some of the efforts of our group in developing a quantitative understanding of this field are outlined.

We report results of tunneling studies on the charge ordering compound Nd_{0.5}Sr_{0.5}MnO_{3} in a magnetic field up to 6T and for temperature down to 25K.We show that a gap (2\Delta_{CO} \approx 0.5eV opens up in the density of state (DOS) at the Fermilevel (E_F) on charge ordering (T_{CO}=150K) which collapses in an applied magnetic field when the charge ordered state melts. There is a clear correspondence between the behavior of the resistivity and the gap formation and its collapse in an applied magnetic field. We conclude that a gap in the DOS at E_F is necessary for the stability of the charge ordered state., Comment: 4 pages REVTeX, 5 postscript figures included, submitted to Phys. Rev. Lett

We have studied the metal-insulator transition at integer fillings in a triply degenerate Hubbard model using the Lanczos method. The critical Coulomb interaction strength U-c, is found to depend strongly on the band filling, with U-c similar to root 3 W (W is the bandwidth) at half filling for this case with threefold degeneracy. We discuss the implications of our results on metal-insulator transitions in strongly correlated systems in general, and on the unusual electronic ground state of the alkali-metal-doped fullerenes, in particular. [S0163-1829(99)11003-8].

The experimental realization of various spin ladder systems has prompted their detailed theoretical investigations. Here we study the evolution of ground state magnetization with an external magnetic field for two different antiferromagnetic systems: a three-legged spin-1/2 ladder, and a two-legged spin-1/2 ladder with an additional diagonal interaction. The finite system density-matrix renormalization group method is employed for numerical studies of the three-chain system, and an effective low-energy Hamiltonian is used in the limit of strong interchain coupling to study the two- and three-chain systems. The three-chain system has a magnetization plateau at one-third of the saturation magnetization. The two-chain system has a plateau at zero magnetization due to a gap above the singlet ground state. It also has a plateau at half of the saturation magnetization for a certain range of values of the couplings. We study the regions of transitions between plateaus numerically and analytically, and find that they are described, at first order in a strong-coupling expansion, by an XXZ spin-1/2 chain in a magnetic field; the second order terms give corrections to the XXZ model. We also study numerically some low-temperature properties of the three-chain system, such as the magnetization, magnetic susceptibility and specific heat., Comment: Revtex, 26 pages including 17 epsf figures; a few minor changes; this is the final published version

A reentrant transition from an incipient charge-ordered (CO) state to a charge-delocalized ferromagnetic (CDFM) state has been established in the manganate Nd0.25La0.25Ca0.5MnO3, in which the average A-site ionic radius is 1.19 Angstrom. The reentrant CDFM phase is associated with a first-order phase transition that reduces the orthorhombic distortion of the lattice, in contrast to the CO transition in other manganates where the orthorhombically distorted CO state is stabilized at low temperatures. At the CO-CDFM transition, there is a collapse of the charge-ordering gap as measured by vacuum tunneling spectroscopy.

We use the density matrix renormalization group (DMRG) method to study the ground and low-lying excited states of three kinds of uniform and dimerized alternating spin chains. The DMRG procedure is also employed to obtain low-temperature thermodynamic properties of these systems. We consider a 2N site system with spins $s_1$ and $s_2$ alternating from site to site and interacting via a Heisenberg antiferromagnetic exchange. The three systems studied correspond to $(s_1 ,s_2 )$ being equal to $(1,1/2),(3/2,1/2)$ and $(3/2,1)$; all of them have very similar properties. The ground state is found to be ferrimagnetic with total spin $s_G =N(s_1 - s_2)$. We find that there is a gapless excitation to a state with spin $s_G -1$, and a gapped excitation to a state with spin $s_G +1$. Surprisingly, the correlation length in the ground state is found to be very small for this gapless system. The DMRG analysis shows that the chain is susceptible to a conditional spin-Peierls instability. Furthermore, our studies of the magnetization, magnetic susceptibility $\chi$ and specific heat show strong magnetic-field dependences. The product $\chi T$ shows a minimum as a function of temperature T at low magnetic fields; the minimum vanishes at high magnetic fields. This low-field behavior is in agreement with earlier experimental observations. The specific heat shows a maximum as a function of temperature, and the height of the maximum increases sharply at high magnetic fields. Although all the three systems show qualitatively similar behavior, there are some notable quantitative differences between the systems in which the site spin difference, $|s_1 - s_2|$, is large and small respectively.

The pulsed laser deposition technique has been employed for the growth of single crystalline oriented films of indium antimonide on bulk cadmium telluride substrates. The films grown during this study were tested for surface quality and interface features, generally prevalent due to film-substrate reactions. The composition of the grown film was found to deviate from that of the target owing to loss of antimony during evaporation, leading to the formation of an interfacial compound. The antimony deficiency in the films was compensated by correcting the target composition. Growth parameters and their effects on these manifestations have been studied. The optimization of these parameters has led to growth of layers with good surface morphology and abrupt interfaces. Efforts have been made to detect the origin of the diffuse interface and to identify the compound resulting at the interface through photoluminescence spectroscopy. Using PL and thermoenergetic calculations for the plausible reactions at the interface, we have ascertained that the interfacial compound is more likely to be In 2 Te 3 .

We study here different regions in phase diagrams of the spin-1/2, spin-1 and spin-3/2 one dimensional antiferromagnetic Heisenberg systems with frustration (next-nearest-neighbor interaction $J_2$) and dimerization ($\delta$). In particular, we analyze the behaviors of the bipartite entanglement entropy and fidelity at the gapless to gapped phase transitions and across the lines separating different phases in the $J_2-\delta$ plane. All the calculations in this work are based on numerical exact diagonalizations of finite systems., Comment: 12 pages, 15 figures; provided some finite size analysis results, some changes in text accordingly; to appear in J. Phys.: Condens. Matter

To address the amount of disorder and interface diffusion induced by annealing, all-Heusler multilayer structures, consisting of ferromagnetic Co2MnGe and nonmagnetic Rh2CuSn layers of varying thicknesses, have been investigated by means of hard x-ray photoelectron spectroscopy and x-ray magnetic circular dichroism. We find evidence for a 4 angstrom thick magnetically dead layer that, together with the identified interlayer diffusion, are likely reasons for the unexpectedly small magnetoresistance found for current-perpendicular-to-plane giant magnetoresistance devices based on this all-Heusler system. We find that diffusion begins already at comparably low temperatures between 200 and 250 degrees C, where Mn appears to be most prone to diffusion.

Mn-doped SrTiO_3.0, when synthesized free of impurities, is a paramagnetic insulator with interesting dielectric properties. Since delocalized charge carriers are known to promote ferromagnetism in a large number of systems via diverse mechanisms, we have looked for the possibility of any intrinsic, spontaneous magnetization by simultaneous doping of Mn ions and electrons into SrTiO_3 via oxygen vacancies, thereby forming SrTi_(1-x)Mn_xO_(3-d), to the extent of making the doped system metallic. We find an absence of any enhancement of the magnetization in the metallic sample when compared with a similarly prepared Mn doped, however, insulating sample. Our results, thus, are not in agreement with a recent observation of a weak ferromagnetism in metallic Mn doped SrTiO_3 system., Comment: 10 pages and 4 figures

We extend the density-matrix renormalization-group (DMRG) method to exploit parity, ${\mathit{C}}_{2}$ (rotation by \ensuremath{\pi}), and electron-hole symmetries of model Hamiltonians. We demonstrate the power of this method by obtaining the lowest-energy states in all eight symmetry subspaces of Hubbard chains with up to 50 sites. The ground-state energy, optical gap, and spin gap of regular U=4t and U=6t Hubbard chains agree very well with exact results. This development extends the scope of the DMRG method and allows future applications to study of optical properties of low-dimensional conjugated polymeric systems. \textcopyright{} 1996 The American Physical Society.

We develop a multiconfigurational symmetrized-projector quantum Monte Carlo (MSPQMC) method to calculate excited-state properties of Hubbard models. We compare the MSPQMC results for finite Hubbard chains with exact results (where available) or with density-matrix renormalization-group results for longer chains. The energies and correlation functions of the excited states are in good agreement with those obtained from the alternate techniques.

We have investigated the multiferroic and glassy behaviour of metal-organic framework (MOF) material (CH3)(2)NH2Co(CHOO)(3). The compound has perovskite-like architecture in which the metal-formate forms a framework. The organic cation (CH3)(2)NH2+ occupies the cavities in the formate framework in the framework via N-H center dot center dot center dot O hydrogen bonds. At room temperature, the organic cation is disordered and occupies three crystallographically equivalent positions. Upon cooling, the organic cation is ordered which leads to a structural phase transition at 155 K. The structural phase transition is associated with a para-ferroelectric phase transition and is revealed by dielectric and pyroelectric measurements. Further, a PE hysteresis loop below 155 K confirms the ferroelectric behaviour of the material. Analysis of dielectric data reveal large frequency dispersion in the values of dielectric constant and tan delta which signifies the presence of glassy dielectric behaviour. The material displays a antiferromagnetic ordering below 15 K which is attributed to the super-exchange interaction between Co2+ ions mediated via formate linkers. Interestingly, another magnetic transition is also found around 11 K. The peak of the transition shifts to lower temperature with increasing frequency, suggesting glassy magnetism in the sample. (C) 2016 AIP Publishing LLC.

We show that newly found BF3-doped polyaniline, though highly conducting, remains amorphous. Magnetic studies reveal many unusual properties, while suggesting that the intrinsic conductivity of this system is significantly larger than all other known forms of conducting polyaniline, establishing it as an interesting class of highly conducting amorphous polymer., 5 pages, 3 figures

Molecular dynamics simulations have been performed on monatomic sorbates confined within zeolite NaY to obtain the dependence of entropy and self-diffusivity on the sorbate diameter. Previously, molecular dynamics simulations by Santikary and Yashonath [J. Phys. Chem. 98, 6368 (1994)], theoretical analysis by Derouane et al. [J. Catal. 110, 58 (1988)] as well as experiments by Kemball [Adv. Catal. 2, 233 (1950)] found that certain sorbates in certain adsorbents exhibit unusually high self-diffusivity. Experiments showed that the loss of entropy for certain sorbates in specific adsorbents was minimum. Kemball suggested that such sorbates will have high self-diffusivity in these adsorbents. Entropy of the adsorbed phase has been evaluated from the trajectory information by two alternative methods: two-phase and multiparticle expansion. The results show that anomalous maximum in entropy is also seen as a function of the sorbate diameter. Further, the experimental observation of Kemball that minimum loss of entropy is associated with maximum in self-diffusivity is found to be true for the system studied here. A suitably scaled dimensionless self-diffusivity shows an exponential dependence on the excess entropy of the adsorbed phase, analogous to excess entropy scaling rules seen in many bulk and confined fluids. The two trajectory-based estimators for the entropy show good semiquantitative agreement and provide some interesting microscopic insights into entropy changes associated with confinement.

Investigations into the variation of self-diffusivity with solute radius, density, and degree of disorder of the host medium is explored. The system consists of a binary mixture of a relatively smaller sized solute, whose size is varied and a larger sized solvent interacting via Lennard-Jones potential. Calculations have been performed at three different reduced densities of 0.7, 0.8, and 0.933. These simulations show that diffusivity exhibits a maximum for some intermediate size of the solute when the solute diameter is varied. The maximum is found at the same size of the solute at all densities which is at variance with the prediction of the levitation effect. In order to understand this anomaly, additional simulations were carried out in which the degree of disorder has been varied while keeping the density constant. The results show that the diffusivity maximum gradually disappears with increase in disorder. Disorder has been characterized by means of the minimal spanning tree. Simulations have also been carried out in which the degree of disorder is constant and only the density is altered. The results from these simulations show that the maximum in diffusivity now shifts to larger distances with decrease in density. This is in agreement with the changes in void and neck distribution with density of the host medium. These results are in excellent agreement with the predictions of the levitation effect. They suggest that the effect of disorder is to shift the maximum in diffusivity towards smaller solute radius while that of the decrease in density is to shift it towards larger solute radius. Thus, in real systems where the degree of disorder is lower at higher density and vice versa, the effect due to density and disorder have opposing influences. These are confirmed by the changes seen in the velocity autocorrelation function, self part of the intermediate scattering function and activation energy. (C) 2012 American Institute of Physics. http://dx.doi.org/10.1063/1.3701619]

We study the bipartite entanglement of strongly correlated systems using exact diagonalization techniques. In particular, we examine how the entanglement changes in the presence of long-range interactions by studying the Pariser-Parr-Pople model with long-range interactions. We compare the results for this model with those obtained for the Hubbard and Heisenberg models with short-range interactions. This study helps us to understand why the density matrix renormalization group (DMRG) technique is so successful even in the presence of long-range interactions. To better understand the behavior of long-range interactions and why the DMRG works well with it, we study the entanglement spectrum of the ground state and a few excited states of finite chains. We also investigate if the symmetry properties of a state vector have any significance in relation to its entanglement. Finally, we make an interesting observation on the entanglement profiles of different states (across the energy spectrum) in comparison with the the corresponding profile of the density of states. We use isotropic chains and a molecule with non-Abelian symmetry for these numerical investigations., Comment: 24 pages, 11 figures and 2 tables

We report magnetic, dielectric, and magnetodielectric responses of the pure monoclinic bulk phase of partially disordered La2NiMnO6, exhibiting a spectrum of unusual properties and establish that this compound is an intrinsically multiglass system with a large magnetodielectric coupling (8%-20%) over a wide range of temperatures (150-300 K). Specifically, our results establish a unique way to obtain colossal magnetodielectricity, independent of any striction effects, by engineering the asymmetric hopping contribution to the dielectric constant via the tuning of the relative-spin orientations between neighboring magnetic ions in a transition-metal oxide system. We discuss the role of antisite (Ni-Mn) disorder in emergence of these unusual properties.

Lithium iron phosphate (LiFePO4) electronically wired by multi-walled carbon nanotubes (MWCNTs) and in-situ transformed graphitic carbon for lithium-ion batteries are discussed here. Presence of MWCNTs up to a maximum of 0.5% in porous LiFePO4 (abbreviated as LFP-CNT) resulted in remarkable reversible cyclability and rate capability compared to LFP coated with highly disordered carbon (abbreviated as LFP-C). In the current range (30-1500) mAg(-1), specific capacity of LFP-CNT (approximate to 150-50 mAhg(-1)) is observed to be always higher compared to LFP-C (approximate to 120-0 mAhg(-1)). At higher currents of 250-1500 mAg(-1) LFP-C performed poorly compared to LFP-CNT. LFP-C showed considerable decay in capacity with increase in cycle number at intermediate high currents (approximate to 250 mAg(-1)) whereas at very high currents (approximate to 750 mAg(-1)) it is nearly zero. The LFP-CNT showed no such detrimental behavior in battery performance. The exemplary performance of the LFP-CNT is attributed to combination of both enhanced LFP structural stability, as revealed by Raman spectra and formation of an efficient percolative network of carbon nanotubes which during the course of galvanostatic cycling gets gradually transformed to graphitic carbon. (C) 2012 The Electrochemical Society. [DOI: 10.1149/2.015204jes] All rights reserved.

Here we study thermodynamic properties of an important class of single-chain magnets (SCMs), where alternate units are isotropic and anisotropic with anisotropy axes being non-collinear. This class of SCMs shows slow relaxation at low temperatures which results from the interplay of two different relaxation mechanisms, namely dynamical and thermal. Here anisotropy is assumed to be large and negative, as a result, anisotropic units behave like canted spins at low temperatures; but even then simple Ising-type model does not capture the essential physics of the system due to quantum mechanical nature of the isotropic units. We here show how statistical behavior of this class of SCMs can be studied using a transfer matrix (TM) method. We also, for the first time, discuss in detail how weak inter-chain interactions can be treated by a TM method. The finite size effect is also discussed which becomes important for low temperature dynamics. At the end of this paper, we apply this technique to study a real helical chain magnet., 15 pages, 3 figures, 2 tables; extra factor 'N' in Eqn. 11 has been removed; by mistake it appears in both the published journal version and earlier arxiv versions; rest of the paper remains unchanged

A molecular dynamics simulation study of aqueous solution of LiCl is reported as a function of pressure. Experimental measurements of conductivity of Li+ ion as a function of pressure shows an increase in conductivity with pressure. Our simulations are able to reproduce the observed trend in conductivity. A number of relevant properties have been computed in order to understand the reasons for the increase in conductivity with pressure. These include radial distribution function, void and neck distributions, hydration or coordination numbers, diffusivity, velocity autocorrelation functions, angles between ion-oxygen and dipole of water as well as OH vector, mean residence time for water in the hydration shell, etc. These show that the increase in pressure acts as a structure breaker. The decay of the self part of the intermediate scattering function at small wave number k shows a bi-exponential decay at 1 bar which changes to single exponential decay at higher pressures. The k dependence of the ratio of the self part of the full width at half maximum of the dynamic structure factor to 2Dk(2) exhibits trends which suggest that the void structure of water is playing a role. These support the view that the changes in void and neck distributions in water can account for changes in conductivity or diffusivity of Li+ with pressure. These results can be understood in terms of the levitation effect. (C) 2012 American Institute of Physics. http://dx.doi.org/10.1063/1.4756909]

Variable-temperature X-ray diffraction studies of C70 suggest the occurrence of two phase transitions around 350 and 280 K where the high-temperature phase is fcc and the low-temperature phase is monoclinic, best described as a distorted hcp structure with a doubled unit cell; two like-phases (possibly hcp) seem to coexist in the 280-350 K range. Application of pressure gives rise to three distinct transitions associated with characteristic pressure coefficients, the extrapolated values of the transition temperatures at ambient pressure being around 340, 325 and 270 K. Pressure delineates closely related phases Of C70 just as in the case Of C60 which exhibits two orientational phase transitions at high pressures.

We describe a blue/green inorganic material, Ba(3)(P(1-x)-Mn(x)O(4))(2) (I) based on tetrahedral MnO(4)(3-):3d(2) chromophore. The solid solutions (I) which are sky-blue and turquoise-blue for x = 0-50, are readily synthesized in air from commonly available starting materials, stabilizing the MnO(4)(3-) chromophore in an isostructural phosphate host. We suggest that the covalency/ionicity of P-O/Mn-O bonds in the solid solutions tunes the crystal field strength around Mn(V) such that a blue colour results for materials with small values of x. The material could serve as a nontoxic blue/green inorganic pigment.