Search

The detection of gravitational waves from GW170817 has provided a new opportunity to constrain the equation of state (EOS) of neutron stars. In this article, we investigate the possible existence of quarks inside the neutron star core in the context of GW170817. The nucleon phase is treated within the relativistic nuclear mean-field approach where we have employed a fully comprehensive set of available models, and the quark phase is described in the Bag model. We show that the nucleonic EOSs which are inconsistent with the tidal deformability bound become consistent when phase transition to quark matter via Gibbs construction is allowed. We find that several nucleonic EOSs support the presence of pure quark matter core with a small mass not more than $0.17M_\odot$ confined within a radius of 0.9 km. We also find that the strong correlation between tidal deformability and neutron star radii observed for pure nucleonic stars does persist even with a nucleon-quark phase transition and provides an upper limit on the radius of $R_{1.4} \lesssim 12.9$ km for a $1.4M_\odot$ neutron star., 13 pages, 4 figures, to appear in EPJST

Physics has been the chief agent in transforming molecular biology into molecular structural biology. This chapter gives an overview of different areas of physics as a minimum requirement for the experimental and theoretical understanding of biomolecular interactions and dynamics. The layout of the topics is somewhat similar to one that would appear in an exclusive textbook on basic physics—classical mechanics, wave motion, kinetic theory and thermodynamics, and quantum and statistical physics; nevertheless, the presentation here is purely introductory. In each of the topics, mathematical expressions and equations have been judiciously used to deliver some quantitative sense. All such is expected to facilitate meaningful deliberations in the subsequent chapters.

The first detection of gravitational waves from the binary neutron star merger event GW170817 has started to provide important new constraints on the nuclear equation of state at high density. The tidal deformability bound of GW170817 combined with the observed two solar mass neutron star poses a serious challenge to theoretical formulations of realistic equations of state. We analyze a fully comprehensive set of relativistic nuclear mean-field theories by confronting them with the observational bounds and the measured neutron-skin thickness. We find that only a few models can withstand these bounds which predict a stiff overall equation of state but with a soft neutron-proton symmetry energy. Two possible indications are proposed: Circumstantial evidence of hadron-quark phase transition inside the star and new parametrizations that are consistent with ground state properties of finite nuclei and observational bounds. Based on extensive analysis of these sets, an upper limit on the radius of a $1.4M_\odot$ neutron star of $R_{1.4}\lesssim 12.9$ km is deduced., Matches with the published version

We consider causal higher order theories of relativistic viscous hydrodynamics in the limit of one-dimensional boost-invariant expansion and study the associated dynamical attractor. We obtain evolution equations for the inverse Reynolds number as a function of Knudsen number. The solutions of these equations exhibit attractor behavior which we analyze in terms of Lyapunov exponents using several different techniques. We compare the attractors of the second-order M\"uller-Israel-Stewart (MIS), transient DNMR, and third-order theories with the exact solution of the Boltzmann equation in the relaxation-time approximation. It is shown that for Bjorken flow the third-order theory provides a better approximation to the exact kinetic theory attractor than both MIS and DNMR theories. For three different choices of the time dependence of the shear relaxation rate we find analytical solutions for the energy density and shear stress and use these to study the attractors analytically. By studying these analytical solutions at both small and large Knudsen numbers we characterize and uniquely determine the attractors and Lyapunov exponents. While for small Knudsen numbers the approach to the attractor is exponential, strong power-law decay of deviations from the attractor and rapid loss of initial state memory is found even for large Knudsen numbers. Implications for the applicability of hydrodynamics in far-off-equilibrium situations are discussed., Comment: 16 pages, 6 figures. Final version as appeared in Phys. Rev. C

In this article, there are 18 sections discussing various current topics in the field of relativistic heavy-ion collisions and related phenomena, which will serve as a snapshot of the current state of the art. Section 1 reviews experimental results of some recent light-flavored particle production data from ALICE collaboration. Other sections are mostly theoretical in nature. Very strong but transient magnetic field created in relativistic heavy-ion collisions could have important observational consequences. This has generated a lot of theoretical activity in the last decade. Sections 2, 7, 9, 10 and 11 deal with the effects of the magnetic field on the properties of the QCD matter. There are several unanswered questions about the QCD phase diagram. Sections 3, 11 and 18 discuss various aspects of the QCD phase diagram and phase transitions. Recent years have witnessed interesting developments in foundational aspects of hydrodynamics and their application to heavy-ion collisions. Sections 12, 15, 16 and 17 of this article probe some aspects of this exciting field. Transport coefficients together with their temperature- and density-dependence, are essential inputs in hydrodynamical calculations. Sections 5, 8 and 14 deal with calculation/estimation of various transport coefficients (shear and bulk viscosity, thermal conductivity, relaxation times, etc.) of quark matter and hadronic matter. Sections 4, 6 and 13 deals with interesting new developments in the field. Section 4 discusses color dipole gluon distribution function at small transverse momentum in the form of a series of Bells polynomials. Section 6 discusses the properties of Higgs boson in the quark gluon plasma using Higgs-quark interaction. Section 13 discusses modification of coalescence model to incorporate viscous corrections and application of this model., Comment: 109 pages, 49 captioned figures, compilation of the contributions as presented in the `Workshop on Dynamics of QCD Matter', 15th to 17th August 2019, NISER Bhubaneswar, India, published version

We obtain general analytical solutions of third-order viscous hydrodynamic equations for Bjorken and Gubser flows in systems with vanishing bulk viscosity and chemical potential, and having a constant shear relaxation time. We also analytically characterize and determine the hydrodynamic attractors for such systems by studying the universal behavior of these solutions at both early and late times. Finally we study the properties of these hydrodynamic attractors for transport coefficients obtained from relativistic kinetic theory in the relaxation-time approximation., 4 pages, 2 figures

The dynamical scaling behavior of hydrodynamic and non-hydrodynamic moments of the distribution function is studied using third-order Chapman-Enskog hydrodynamics and anisotropic hydrodynamics for systems undergoing Bjorken and Gubser expansions, where exact solutions of the Boltzmann equation in Relaxation Time Approximation (RTA) are available for comparison. While dimensionless quantities like normalized shear, pressure anisotropy and normalized entropy show at late times universal scaling relations with small (large) Knudsen number for Bjorken (Gubser) flows, dimensionful quantities like the entropy per unit rapidity do not. Although the two hydrodynamic approximation schemes describe the exact attractors for normalized shear with high accuracy, their description for the normalized entropy is less precise. We attribute this to non-negligible couplings to non-hydrodynamic modes in the entropy evolution., 4 pages, 2 figures

We present effects of longitudinal expansion of QCD medium on radiative energy loss suffered by heavy quark in a dynamically screened medium. The energy loss expression to the first order in opacity is obtained by incorporating viscous corrections to the equilibrium phase-space distribution function as well as expansion of the medium. Theoretical formalism accounts for medium modified polarization tensor and time dependent cooling because of rapid longitudinal expansion of the QCD medium in relativistic heavy ion collision experiments along with modified phase space. For manifestation we have used distribution function obtained from Grad’s 14-moment expansion in relativistic viscous hydrodynamic evolution. Viscous correction is shown to enhance the radiative energy loss and the result is time dependent. We have also shown $$\eta /s$$ dependence of radiative energy loss for the Grad’s 14-moment distribution function. Our results for energy loss lie within the static plasma results and results obtained considering only ideal Bjorken expansion.

We study the evolution of hydrodynamic and non-hydrodynamic moments of the distribution function using anisotropic and third-order Chapman-Enskog hydrodynamics for systems undergoing Bjorken and Gubser flows. The hydrodynamic results are compared with the exact solution of the Boltzmann equation with a collision term in relaxation time approximation. While the evolution of the hydrodynamic moments of the distribution function (i.e. of the energy momentum tensor) can be described with high accuracy by both hydrodynamic approximation schemes, their description of the evolution of the entropy of the system is much less precise. We attribute this to large contributions from non-hydrodynamic modes coupling into the entropy evolution which are not well captured by the hydrodynamic approximations. The differences between the exact solution and the hydrodynamic approximations are larger for the third-order Chapman-Enskog hydrodynamics than for anisotropic hydrodynamics, which effectively resums some of the dissipative effects from anisotropic expansion to all orders in the anisotropy, and are larger for Gubser flow than for Bjorken flow. Overall, anisotropic hydrodynamics provides the most precise macroscopic description for these highly anisotropically expanding systems., Comment: 15 pages, 5 figures (Added reference, extended discussion of Figure 5)

We study viscous effects on heavy quark radiative energy loss in a dynamically screened medium with boost-invariant longitudinal expansion. We calculate, to first order in opacity, the energy loss by incorporating viscous corrections in the single-particle phase-space distribution function within relativistic dissipative hydrodynamics. We consider the Grad's 14-moment and the Chapman-Enskog-like methods for the nonequilibrium distribution functions. Our numerical results for the charm quark radiative energy loss show that, as compared to static fluid, an expanding ideal (nonviscous) fluid causes a much smaller energy loss. Viscosity in the evolution lead to somewhat enhanced energy loss which is insensitive to the underlying viscous hydrodynamic models used. Further inclusion of viscous correction induces larger energy loss, the magnitude and pattern of this enhancement crucially depend on the form of viscous corrections used., 10 pages, 7 figures

We study the effects of hydrodynamic fluctuations in non-boost-invariant longitudinal expansion of matter formed in relativistic heavy ion collisions. We formulate the theory of thermal noise within second-order viscous hydrodynamics treating noise as a perturbation on top of the non-boost-invariant flow. We develop a numerical simulation model to treat the (1+1)-dimension hydrodynamic evolution. The code is tested to reproduce the analytic results for the Riemann solver for expansion of matter in vacuum. For viscous hydrodynamic expansion, the initial energy density distribution are obtained by reproducing the measured charged hadron rapidity distribution at the RHIC energies. We show that the longitudinal rapidity correlations arising from space-time dependent thermal noise and from an induced thermal perturbation have distinct structures. In general, the rapidity correlations are found to be dominated by temperature fluctuations at small rapidity separation and velocity fluctuations at large rapidities. We demonstrate that thermal noise produce ridge-like two-particle rapidity correlations which persist at moderately large rapidities. The magnitude and pattern of the correlations are quite sensitive to various second-order dissipative formalisms and to the underlying equations of state, especially at large rapidities. The short-range part of the rapidity correlation is found to be somewhat enhanced as compared to that in boost-invariant flow of matter., Comment: 17 pages, 12 figures

We review the transport models that are widely used to study the properties of the quark-gluon plasma formed in relativistic heavy-ion collisions at RHIC and LHC. We show that transport model analysis of two important and complementary observables, the anisotropic flow of bulk hadrons and suppression of hadron yields at high transverse momentum, provide exciting new information on the properties of the plasma formed.

We formulate a general theory of thermal fluctuations within causal second-order viscous hydrodynamic evolution of matter formed in relativistic heavy-ion collisions. The fluctuation is treated perturbatively on top of a boost-invariant longitudinal expansion. Numerical simulation of thermal noise is performed for a lattice QCD equation of state and for various second-order dissipative evolution equations. Phenomenological effects of thermal fluctuations on the two-particle rapidity correlations are studied., 11 pages, 5 figures

We evaluate the effects of preequilibrium dynamics on observables in ultrarelativistic heavy-ion collisions. We simulate the initial nonequilibrium phase within A MultiPhase Transport (AMPT) model, while the subsequent near-equilibrium evolution is modeled using (2+1)-dimensional relativistic viscous hydrodynamics. We match the two stages of evolution carefully by calculating the full energy-momentum tensor from AMPT and using it as input for the hydrodynamic evolution. We find that when the preequilibrium evolution is taken into account, final-state observables are insensitive to the switching time from AMPT to hydrodynamics. Unlike some earlier treatments of preequilibrium dynamics, we do not find the initial shear viscous tensor to be large. With a shear viscosity to entropy density ratio of $0.12$, our model describes quantitatively a large set of experimental data on Pb+Pb collisions at the Large Hadron Collider(LHC) over a wide range of centrality: differential anisotropic flow $v_n(p_T) ~(n=2-6)$, event-plane correlations, correlation between $v_2$ and $v_3$, and cumulant ratio $v_2\{4\}/v_2\{2\}$., Comment: 10 pages, v2: minor revision

The India-based Neutrino Observatory (INO) collaboration is planning to build a magnetised Iron CALorimeter (ICAL) detector to study atmospheric neutrinos and to measure their oscillation parameters. The ICAL will use 50 kton iron as target mass and about 28,800 Resistive Plate Chambers (RPCs) of 2×2 m 2 in area as active detector elements. As part of its R&D programme, a stack of 12 glass RPCs of 1×1 m 2 in area has been set up to study and characterise the performance of the RPCs. In this paper, we describe our study on the optimisation of gas flow through the RPCs. We conclude that the refreshing frequency of gas can be reduced by a factor of 30 with leak free RPCs, without compromising performance of the RPCs.

The India-based Neutrino Observatory (INO) collaboration has proposed to build a 50 kton magnetized Iron Calorimeter (ICAL) detector with the primary goal to study neutrino oscillations, employing Resistive Plate Chambers (RPCs) as active detector elements. A prototype of the ICAL detector has been built in order to develop and characterize the intrinsic sub-systems, like RPCs, gas system, electronics and data acquisition system, etc. This paper describes in detail the readout electronics as well as the VME-based data acquisition system for the prototype detector.

Higher order harmonic flow $v_n$ (with $n\ge4$) in heavy-ion collisions can be measured either with respect to their own plane, or with respect to a plane constructed using lower-order harmonics. By assuming that higher flow harmonics are the superposition of medium nonlinear and linear responses to initial anisotropies, we propose a set of nonlinear response coefficients $\chi_n$'s, which are independent of initial state by construction. In experiments, $\chi_n$'s can be extracted as the ratio between higher order harmonic flow measured in the plane constructed by $v_2$ and $v_3$, and moments of lower order harmonic flow. Simulations with single-shot hydrodynamics and AMPT model lead to results of these nonlinear response coefficients in good agreement with the experimental data at the LHC energy. Predictions for $v_7$ and $v_8$ measured with respect to plane of lower order harmonics are given accordingly., Comment: 4 pages and 2 figures. Proceedings of Quark Matter 2015, Kobe, Japan

The India-based Neutrino Observatory Collaboration is planning to set up a magnetized 50 kt iron calorimeter (ICAL) with resistive plate chambers (RPC) as active detectors to study neutrino oscillations and precisely measure its parameters. A prototype detector stack is set up at TIFR (18°54′N, 72°48′E) to track cosmic ray muons. Using the muon data, angular distribution of cosmic ray muons at the sea level is studied here.

The India-based Neutrino Observatory (INO) collaboration has proposed to build a 50 kton Iron-Calorimeter (ICAL) to study neutrino oscillations. About 28,800 Resistive Plate Chambers will be used as active detector elements in this experiment. Preliminary studies are currently underway and as a part of it, a prototype detector was developed which now serves as a cosmic-ray telescope and as a test-bench to study the indigenously built RPCs. A VME-based data acquisition system was designed for this prototype system. Modern software tools were used in the designing of the DAQ software. The design and development of this DAQ system are discussed.

The India-based Neutrino Observatory (INO) collaboration is planning to set up a magnetized 50 kton iron-calorimeter with resistive plate chambers (RPC) as active detectors to study neutrino oscillations. A prototype detector stack (without magnet) comprising 12 layers of RPCs of 1 m×1 m in area has been set-up to track cosmic ray muons. To study its capability and the feasibility of distinguishing between up-going and down-going particles, the velocity of cosmic muons recorded in this stack has been measured. The measurement procedure, calibration and results are described here.

The India-based Neutrino Observatory (INO) collaboration is planning to build a 50 kt magnetised iron calorimeter (ICAL) detector using glass Resistive Plate Chambers (RPCs) as active detector elements. A stack of 12 such glass RPCs of 1 m ×1 m in area is tracking cosmic ray muons for over three years. In this paper, we will review the constructional aspects of the stack and discuss the performance of the RPCs using this cosmic ray data.

The new state of matter produced at Relativistic Heavy Ion Collider reveals a strongly coupled quark-gluon plasma with an extremely small shear viscosity to entropy density ratio eta/s. We calculate the eta/s of an equilibrated hadron matter characterized by a relativistic hadron resonance gas with a Hagedorn mass spectrum that grows exponentially with the hadron mass. We find with increase in temperature of the system the eta/s value decreases due to rapid increase in the multiplicity of massive resonances. In the vicinity of the critical temperature for deconfinement transition, the minimum value of eta/s in the Hagedorn resonance gas is found to be consistent with the current estimates for a strongly coupled quark-gluon plasma., Comment: 5 pages, RevTex, to appear in PLB

Within a relativistic mean-field model with nonlinear isoscalar–isovector coupling, we explore the possibility of constraining the density dependence of nuclear symmetry energy from a systematic study of the neutron skin thickness of finite nuclei and neutron star properties. We find the present skin data supports a rather stiff symmetry energy at subsaturation densities that corresponds to a soft symmetry energy at supranormal densities. Correlation between the skin of 208Pb and the neutron star masses and radii with kaon condensation has been studied. We find that 208Pb skin estimate suggest star radii that reveals considerable model dependence. Thus precise measurements of neutron star radii in conjunction with skin thickness of heavy nuclei could provide significant constraint on the density dependence of symmetry energy.

Complete evolution of the strongly interacting matter formed in ultrarelativistic heavy-ion collisions is studied within a coupled Boltzmann and relativistic viscous hydrodynamics approach. For the initial nonequilibrium evolution phase, we employ the AMPT model that explicitly includes event-by-event fluctuations in the number and positions of the participating nucleons as well as of the produced partons with subsequent parton transport. The ensuing near-equilibrium evolution of quark-gluon and hadronic matter is modeled within the (2+1)-dimensional viscous hydrodynamics. We probe the role of parton dynamics in generating and maintaining the spatial anisotropy in the preequilibrium phase. Substantial eccentricities epsilon_n are found to be generated in the event-by-event fluctuations in parton production from initial nucleon-nucleon collisions. For ultracentral heavy-ion collisions, the model is able to explain qualitatively the unexpected hierarchy of the harmonic flow coefficients v_n(p_T)(n=2-6) observed at LHC. We find that the results for v_n(p_T) are rather insensitive to the variation (within a range) of the time of switchover from AMPT parton transport to hydrodynamic evolution. The usual Grad and the recently proposed Chapman-Enskog-like (nonequilibrium) single-particle distribution functions are found to give very similar results for v_n(n=2-4). The model describes well both the RHIC and LHC data for v_n(p_T) at various centralities, with a constant shear viscosity to entropy density ratio of 0.08 and 0.12, respectively. The event-by-event distributions of v_{2,3} are in good agreement with the LHC data for midcentral collisions. The linear response relation v_n = k_n epsilon_n is found to be true for n=2,3, except at large values of epsilon_n, where a larger value of k_n is required, suggesting a small admixture of positive nonlinear response even for n=2,3., 8 pages, 9 figures, v2: Same as the published version. Title changed

By employing a Chapman-Enskog like iterative solution of the Boltzmann equation in relaxation-time approximation, we derive a new expression for the entropy four-current up to third order in gradient expansion. We show that unlike second-order and third-order entropy four-current obtained using Grad's method, there is a non-vanishing entropy flux in the present third-order expression. We further quantify the effect of the higher-order entropy density in the case of boost-invariant one-dimensional longitudinal expansion of a system. We demonstrate that the results obtained using third-order evolution equation for shear stress tensor, derived by employing the method of Chapman-Enskog expansion, show better agreement with the exact solution of the Boltzmann equation as well as with the parton cascade BAMPS, as compared to those obtained using the third-order equations from the method of Grad's 14-moment approximation., 8 pages, 8 figures, published version

We apply principal component analysis to the study of event-by-event fluctuations in relativistic heavy-ion collisions. This method brings out all the information contained in two-particle correlations in a physically transparent way. We present a guide to the method, and apply it to multiplicity fluctuations and anisotropic flow, using ALICE data and simulated events. In particular, we study elliptic and triangular flow fluctuations as a function of transverse momentum and rapidity. This method reveals previously unknown subleading modes in both rapidity and transverse momentum for the momentum distribution as well as elliptic and triangular flows., Comment: 6 pages, revised

With the help of finite element (FE) computational models of femur, pelvis or hip joint to perform quasi-static stress analysis during the entire gait cycle, muscle force components (X, Y, Z) acting on the hip joint and pelvis are to be known. Most of the investigators have presented only the net muscle force magnitude during gait. However, for the FE software, either muscle force components (X, Y, Z) or three angles for the muscle line of action are required as input. No published algorithm (with flowchart) is readily available to calculate the required muscle force components for FE analysis. As the femur rotates about the hip center during gait, the lines of action for 27 muscle forces are also variable. To find out the variable lines of action and muscle force components (X, Y, Z) with directions, an algorithm was developed and presented here with detailed flowchart. We considered the varying angles of adduction/abduction, flexion/extension during gait. This computer program, obtainable from the first author, is able to calculate the muscle force components (X, Y, Z) as output, if the net magnitude of muscle force, hip joint orientations during gait and muscle origin and insertion coordinates are provided as input.

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is subdiffusive, with mean square displacement (MSD) growing as $t^{\alpha}$ with $\alpha \simeq 0.43$. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859–73). We compare these results with dynamics of watermolecules at the surface of an anionicmicelle, cesiumperfluorooctanoate(CsPFO). Watermolecules on the surface ofCsPFOalso exhibit slowtranslation and non-exponential orientational dynamics.

Spectra and correlations from RHIC are analyzed to determine the phase space density and total entropy. The phase space density for pions is higher and the entropy is thus lower than some expectations, but there seems to be enough entropy carried by other species, especially baryons, to roughly match the total entropy expected from lattice gauge calculations.

Using a multiphase transport model, we study the production of a new strange dibaryon (\Omega\Omega)_{0+} in dense hadronic matter formed in relativistic heavy ion collisions. The (multi-)strange baryons (\Xi and \Omega) are produced by strangeness-exchange reactions between antikaons and hyperons in the pure hadronic phase. The rescattering between the omegas at midrapidity leads to a production probability of \simeq 3x10^{-7} (\Omega\Omega)_{0+} per event at the RHIC energy of \sqrt s=130A GeV. The production probability would be enhanced by two orders of magnitude if (\Omega\Omega)_{0+} and omega reach chemical equilibrium during heavy ion collisions. We further find that the yield of (\Omega\Omega)_{0+} increases continuously from SPS to the highest RHIC energy., Comment: 4 pages, RevTex, 3 figs included

The performance of a dual time of flight (TOF) spectrometer using two 24 cm×10 cm area X – Y position sensitive Multi-Wire Proportional Counters (MWPC) is reported. Good separation of compound nuclear fission channel from elastic, quasi-elastic and non-compound fission channels have been achieved. Time calibration of the spectrometer using a technique, dependent on the detector independence of the mass or kinetic energy distributions gave a three times better mass resolutions compared to the conventional calibration technique using elastically scattered projectiles in a heavy ion induced fission reaction. Detail experimental methods in determining fission fragment mass and angular distribution have been presented and discussed.

A relativistic transport model is used to study Xi- production in 2-11A GeV Au+Au collisions. Introducing the strangeness-exchange reactions between antikaons and hyperons as the sources for Xi-, we find that the cascade yield in these collisions is in reasonable agreement with the data. Although the Xi- abundance does not reach chemical equilibrium unless the cross section for strangeness-exchange reactions is enhanced by six times, it exhibits the strongest enhancement with increasing centrality of collision and with increasing beam energy., Comment: Title changed, Modified version, 5 pages, RevTex

We investigate the condensation of charged $K^-$ meson and neutral $\bar K^0$ meson in dense neutron star matter. Calculations are performed in relativistic mean field models in which both the baryon-baryon and (anti)kaon-baryon interactions are mediated by meson exchange. It is found that $\bar K^0$ condensation is quite sensitive to the antikaon optical potential and depends more strongly on the nucleonic equation of state. For moderate values of antikaon potential and a rather stiff equation of state, a significant region of maximum mass star will contain $\bar K^0$ meson. The critical density of $\bar K^0$ condensation is always higher than that of $K^-$ condensation. With the appearance of $K^-$ and $\bar K^0$ condensates, pairs of $p-K^-$ and $n-\bar K^0$ are produced with equal proportion leading to a perfectly symmetric matter of nucleons and antikaons in neutron stars. Along with $K^-$ condensate, $\bar K^0$ condensate makes the equation of state much softer resulting in smaller maximum mass stars compared to the case without any condensate., Comment: 34 pages;13 figs;Revtex; change of title; a figure added; version to appear in Nucl. Phys. A

A relativistic version of the Landau theory of Fermi liquid in the presence of an ultrastrong magnetic field is developed. The direct and exchange interactions via the exchanges of both the scalar and the vector bosons are considered. The model is applied to a system of weakly interacting strange quark matter to study the stability of the system.

We present a new derivation of relativistic dissipative hydrodynamic equations, which invokes the second law of thermodynamics for the entropy four-current expressed in terms of the single-particle phase-space distribution function obtained from Grad's 14-moment approximation. This derivation is complete in the sense that all the second-order transport coefficients are uniquely determined within a single theoretical framework. In particular, this removes the long-standing ambiguity in the relaxation time for bulk viscosity thereby eliminating one of the uncertainties in the extraction of the shear viscosity to entropy density ratio from confrontation with the anisotropic flow data in relativistic heavy-ion collisions. We find that in the one-dimensional scaling expansion, these transport coefficients prevent the occurrence of cavitation even for rather large values of the bulk viscosity estimated in lattice QCD., 5 pages, 2 figures, version to appear in PRC (Rapid Comm)

We derive relativistic viscous hydrodynamic equations invoking the generalized second law of thermodynamics for two different forms of the non-equilibrium single-particle distribution function. We find that the relaxation times in these two derivations are identical for shear viscosity but different for bulk viscosity. These equations are used to study thermal dilepton and hadron spectra within longitudinal scaling expansion of the matter formed in relativistic heavy-ion collisions. For consistency, the same non-equilibrium distribution function is used in the particle production prescription as in the derivation of the viscous evolution equations. Appreciable differences are found in the particle production rates corresponding to the two non-equilibrium distribution functions. We emphasize that an inconsistent treatment of the non-equilibrium effects influences the particle production significantly, which may affect the extraction of transport properties of quark-gluon plasma., Comment: 6 pages, 4 figures, matches the published version

Derivations of relativistic second-order dissipative hydrodynamic equations have relied almost exclusively on the use of Grad's 14-moment approximation to write $f(x,p)$, the nonequilibrium distribution function in the phase space. Here we consider an alternative Chapman-Enskog-like method, which, unlike Grad's, involves a small expansion parameter. We derive an expression for $f(x,p)$ to second order in this parameter. We show analytically that while Grad's method leads to the violation of the experimentally observed $1/\sqrt{m_T}$ scaling of the longitudinal femtoscopic radii, the alternative method does not exhibit such an unphysical behavior. We compare numerical results for hadron transverse-momentum spectra and femtoscopic radii obtained in these two methods, within the one-dimensional scaling expansion scenario. Moreover, we demonstrate a rapid convergence of the Chapman-Enskog-like expansion up to second order. This leads to an expression for $\delta f(x,p)$ which provides a better alternative to Grad's approximation for hydrodynamic modeling of relativistic heavy-ion collisions., Comment: 9 pages, 2 figs. Version 2: same as the published version. Appendix A expanded

Correlators between event planes of different harmonics in relativistic heavy-ion collisions have the potential to provide crucial information on the initial state of the matter formed in these collisions. We present a new procedure for analyzing such correlators, which is less demanding in terms of detector acceptance than the one used recently by the ATLAS collaboration to measure various two-plane and three-plane correlators in Pb-Pb collisions at LHC. It can also be used unambiguously for quantitative comparison between theory and data. We use this procedure to carry out realistic simulations within the transport model AMPT. Our theoretical results are in excellent agreement with the ATLAS data, in contrast with previous hydrodynamic calculations which only achieved qualitative agreement. We present predictions for new correlators, in particular four-plane correlators, which can easily be analyzed with our new method., Comment: 6 pages, 3 figures. v2: Further explanations added; results unchanged

In intermediate energy heavy ion collisions, hot nuclear systems formed may disassemble by any of the three distinct mechanisms, namely, sequential fission, prompt multifragmentation or sequential evaporation. For identical multifragment channels considered for these three mechanisms, the correlation functions for intermediate mass fragments (IMFs) which are sensitive to the spatial-temporal extent of the emission process are exploited to delineate the different possible break-up scenarios.

The effective fission barrier of a hot nucleus in nuclear multifragmentation in the sequential binary decay model depends on the configuration of the neighbouring fragments generated in the previous stages of binary decay. Taking this into consideration, various observables related to multifragmentation in intermediate energy nuclear collisions are evaluated in the transition state model. The effect of recombination of the fragments during dynamical evolution of the system is also taken into account. The results of our calculations are confronted with the experimental data from fragmentation in the reaction Au on Cu at 600 MeV/nucleon bombarding energy.

Fragmentation of exotic nuclear shapes like toroids and bubbles predicted to be formed in intermediate energy heavy ion central collisions within the framework of BUU type calculations is studied in a statistical model with microcanonical simulation of prompt multifragmentation. The relatively smaller interfragment Coulomb interaction energy in the exotic shapes results in an enhanced production of intermediate mass fragments (IMFs) compared to that in the compact spherical configuration. The differences in the spatial geometry of the fragmenting shapes manifested in the inclusive charge distributions are further projected sharply in the IMF-IMF correlations. We exploit the correlation function to delineate the different fragmenting configurations.

Hot nuclear systems formed in intermediate-energy heavy-ion collisions may disassemble into a number of fragments either by sequential binary decay or one-step prompt multifragmentation. Any pair of these fragments during dynamical evolution may come very close to one another and recombine. The fused complex may undergo further fragmentation if sufficiently excited. Using the transition-state model for binary decay and the microcanonical model for prompt multifragmentation, the effect of this recombination is studied for a number of observables.

Dilepton production in the low-invariant-mass region in p+p and Au + Au collisions at sNN=200 GeV and in Pb + Au collisions at 158 AGeV is studied in the relativistic hadron resonance gas model with Hagedorn mass spectrum that grows exponentially. The model provides good agreement with the observed yield and spectra of stable hadrons and resonances produced in both p+p and nucleus-nucleus collisions. While the measured dilepton yields in p+p collisions are well understood in the model with Dalitz and direct decays of conventional neutral meson sources, a sizable amount of the mesons produced from the Hagedorn states still cannot explain the large enhancement observed in the invariant mass region 200–700 MeV/c2 in Pb + Au and especially in Au + Au collisions. In a multiphase transport (AMPT) model, the dilepton produced from the standard hadronic sources in absence of Hagedorn states underpredicts the data to a larger extent. The study suggests that Hagedorn states in conjugation with in-medium modification of the properties of ρ mesons may be essential for the enhanced dilepton production.

Within a multiphase transport (AMPT) model, where the initial conditions are obtained from the recently updated HIJING 2.0 model, the recent anisotropic flow and suppression data for charged hadrons in Pb+Pb collisions at the LHC center of mass energy of 2.76 TeV are explored to constrain the properties of the partonic medium formed. In contrast to RHIC, the measured centrality dependence of charged hadron multiplicity dN_ch/deta at LHC provides severe constraint to the largely uncertain gluon shadowing parameter s_g. We find final-state parton scatterings reduce considerably hadron yield at midrapidity and enforces a smaller s_g to be consistent with dN_ch/deta data at LHC. With the parton shadowing so constrained, hadron production and flow over a wide transverse momenta range are investigated in AMPT. The model calculations for the elliptic and triangular flow are found to be in excellent agreement with the RHIC data, and predictions for the flow coefficients v_n(p_T, cent) at LHC are given. The magnitude and pattern of suppression of the hadrons in AMPT are found consistent with the measurements at RHIC. However, the suppression is distinctly overpredicted in Pb+Pb collisions at the LHC energy. Reduction of the QCD coupling constant alpha_s by ~30% in the higher temperature plasma formed at LHC reproduces the measured hadron suppression., Comment: Talk given by Subrata Pal at the 11th International Conference on Nucleus-Nucleus Collisions (NN2012), San Antonio, Texas, USA, May 27-June 1, 2012. To appear in the NN2012 Proceedings in Journal of Physics: Conference Series (JPCS)