Search

Background and Aims Condensed tannins, responsible for berry and wine astringency, may have been selected during grapevine domestication. This work examines the phylogenetic distribution of condensed tannins throughout the Vitaceae phylogenetic tree. Methods Green berries and mature leaves of representative true-to-type members of the Vitaceae were collected before ‘véraison’, freeze-dried and pulverized, and condensed tannins were measured following depolymerization by nucleophilic addition of 2-mercaptoethanol to the C4 of the flavan-3-ol units in an organic acidic medium. Reaction products were separated and quantified by ultrahigh pressure liquid chromatography/diode array detection/mass spectrometry. Key Results and Conclusions The original ability to incorporate epigallocatechin (EGC) into grapevine condensed tannins was lost independently in both the American and Eurasian/Asian branches of the Vitaceae, with exceptional cases of reversion to the ancestral EGC phenotype. This is particularly true in the genus Vitis, where we now find two radically distinct groups differing with respect to EGC content. While Vitis species from Asia are void of EGC, 50 % of the New World Vitis harbour EGC. Interestingly, the presence of EGC is tightly coupled with the degree of leaf margin serration. Noticeably, the rare Asian EGC-forming species are phylogenetically close to Vitis vinifera, the only remnant representative of Vitis in Eurasia. Both the wild ancestral V. vinifera subsp. sylvestris as well as the domesticated V. vinifera subsp. sativa can accumulate EGC and activate galloylation biosynthesis that compete for photoassimilates and reductive power.

Fusarium oxysporum f. sp radicis-vanillae (Forv), the causal agent of Root and Stem Rot disease, is the main pathogen affecting vanilla production. Sources of resistance have been reported in Vanilla planifolia G. Jackson ex Andrews, the main cultivated vanilla species. Here we developed the first high-density genetic map in this species with 1,804 GBS-generated single nucleotide polymorphism (SNP) markers using 125 selfed progenies of the CR0040 traditional vanilla cultivar. Sixteen linkage groups (LG) were successfully constructed, with a mean of 113 SNPs and an average length of 207 cM per LG. The map had a high density with an average of 5.45 SNP every 10 cM and an average distance of 1.85 cM between adjacent markers. The first 3 LG were aligned against the first assembled chromosome of CR0040 and the other 13 LG were correctly associated with the other 13 assembled chromosomes. The population was challenged with the highly pathogenic Forv strain Fo072 using the root-dip inoculation method. Five traits were mapped and 20 QTLs were associated with resistance to Fo072. Among genes retrieved in the CR0040 physical regions associated with QTLs, genes potentially involved in biotic resistance mechanisms have been highlighted, coding for kinases, E3 ubiquitin ligases, pentatricopeptide repeat-containing proteins, and one leucine-rich repeat receptor underlying the qFo72_08.1 QTL. This study should provide useful resources for marker-assisted selection in V. planifolia.

Microsatellite data used to produce genetic structuring (Fig. 2) and PCoA (Fig. S3) are accessible on the online UMR PVBMT Cirad dataverse (https://doi.org/10.18167/DVN1/3OFMLH).; International audience; The leafless Vanilla species complex from the South-West Indian Ocean (SWIO) region has long been a taxonomic challenge, due to limited patterns of morphological differentiation and an absence of variation within chloroplast sequences. This complex includes seven known morphospecies: V. madagascariensis, V. bosseri, V. decaryana, and V. perrieri endemic to Madagascar, V. humblotii presumed as endemic to the Comoros Archipelago, but also present in Madagascar, V. roscheri from the East African coast, and V. phalaenopsis endemic to Seychelles. A previous population genetic study using microsatellite markers allowed us to distinguish, in addition to the five recognized Malagasy taxa, two other genetic clusters present in the East of the island. An integrative taxonomy approach was therefore conducted by combining microsatellite and morphological data used in the previous study with new data sets, and by adding ITS sequencing data, to validate the taxonomic level of these Malagasy genetic clusters and unravel phylogenetic relationships between SWIO species. As a result, based on phylogenetic, genotypic and morphological evidence, nine species were discriminated in the SWIO region, including seven in Madagascar, with two new eastern species. The leafless Vanilla group originated and diversified in Madagascar, from an ancestor of African descent, with three subsequent independent colonization events from Madagascar to the other territories of SWIO within the two main lineages (white versus yellow flower species). The new Malagasy species, V. allorgeae Andriamihaja & Pailler sp. nov., and V. atsinananensis Andriamihaja & Pailler sp. nov., are described and a new identification key is proposed.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

An ambitious vanilla (Vanilla planifolia Jacks. ex Andrews) breeding program was started in Madagascar in the early 1950s to control Fusariosis, a serious crop disease caused by the soil fungus Fusarium oxysporum. The breeding program has produced tens of thousands of new vanilla genotypes of which a small number have been selected and conserved. This article examines the history of the Malagasy breeding work during the second half of the twentieth century, and outlines a possible strategy to exploit the data and exceptional genetic resources it has produced. The National Center for Research Applied to Rural Development has preserved 19 of the very diverse and original hybrids at the vanilla station in Ambohitsara (Antalaha, Madagascar). Two of them are particularly remarkable, namely Manitra ampotony for its exceptionally high vanillin content and Tsy taitra for its strong resistance to Fusariosis and its aromatic profile, which is similar to that of Bourbon vanilla. However, the global vanilla industry remains fragile because varietal diversity now available cannot overcome current and foreseeable constraints. The hybrids formed from multiple crosses between V. planifolia and three aromatic species, (V. pompona Schiede, V. tahitensis J.W. Moore and V. phaeantha Rchb.f.), constitute a preferred resource for further vanilla breeding. Facilitating its wide use by current research and extension teams is, in our opinion, essential to meet the growing need of producers for better-adapted varieties to supply the market of one of the most highly prized natural flavors in the world.

The Vanilla genus is a complex taxonomic group characterized by a vegetative reproduction mode combined with intra- and inter-specific hybridizations, and polyploidy events. These factors strongly impact the diversification of the genus and complicate the delimitation of taxa. Among the hundred Vanilla species, Vanilla planifolia Jacks. ex Andrews and Vanilla × tahitensis J. W. Moore are the main cultivated aromatic species. We applied Genotyping-by-Sequencing to explore the genetic diversity of these two cultivated vanilla species, seven closely related species and nineteen interspecific hybrids. The inter- and intra-specific relationships of 133 vanilla accessions were examined based on 2004 filtered SNPs. Our results showed a strong genetic structuring between the nine species studied, with wild species showing much lower heterozygosity levels than cultivated ones. Moreover, using Bayesian clustering analyses, the kinship of several hybrids could be verified. We evidenced in particular that Vanilla sotoarenasii and Vanilla odorata C.Presl may be the parental species of V. x tahitensis. The analysis of 1129 SNPs for 84 V. planifolia accessions showed a clear genetic demarcation between the vegetatively propagated traditional vanilla cultivars compared to the accessions derived from sexual reproduction, and a higher genetic diversity and lower heterozygosity of the latter (Ho = 0.206) compared to the former (Ho = 0.362). Our data are consistent with a single-step domestication for V. planifolia in accordance with the recent history of its cultivation. It also opens avenues to breed new V. planifolia varieties adapted to biotic and abiotic constraints and to reduce mutational load induced by clonal propagation.

Black spot symptoms were reported on vanilla plants in Reunion Island in 2011. They have repeatedly reduced annual pod production by 10% to 30%. The disease is characterized by dark spots that appear in slight depressions on flowers, pods, leaves and stems. The spots then develop into broad clearly depressed necrotic plaques. Morphological and molecular analyses, as well as pathogenicity tests, identified the fungus Colletotrichum orchidophilum (Ascomycota) as the causal agent of the disease. Inoculation tests in controlled conditions confirmed that the two C. orchidophilum strains isolated from fruit lesions are pathogenic on the leaves and fruits of Vanilla planifolia (accessions CR0001 and CR0020). However, these strains induced symptoms only when the epidermis of leaves and fruits had been punctured by a needle. In the absence of injury, no symptom appeared. Colletotrichum arxii and Fusarium proliferatum (Ascomycota) are fungal species that are also frequently isolated from black spot lesions. However, they are not pathogenic to vanilla. This is the first report of C. orchidophilum in Reunion Island. It is also the first demonstration of C. orchidophilum's pathogenicity to an orchid. Simple preventive control measures were proposed to reduce the incidence of black spot disease in vanilla plots.

Vanillin is the most important flavor compound in the vanilla pod. Vanilla planifolia vanillin synthase (VpVAN) catalyzes the conversion of ferulic acid and ferulic acid glucoside into vanillin and vanillin glucoside, respectively. Desorption electrospray ionization mass spectrometry imaging (DESI-MSI) of vanilla pod sections demonstrates that vanillin glucoside is preferentially localized within the mesocarp and placental laminae whereas vanillin is preferentially localized within the mesocarp. VpVAN is present as the mature form (25 kDa) but, depending on the tissue and isolation procedure, small amounts of the immature unprocessed form (40 kDa) and putative oligomers (50, 75 and 100 kDa) may be observed by immunoblotting using an antibody specific to the C-terminal sequence of VpVAN. The VpVAN protein is localized within chloroplasts and re-differentiated chloroplasts termed phenyloplasts, as monitored during the process of pod development. Isolated chloroplasts were shown to convert [14C]phenylalanine and [14C]cinnamic acid into [14C]vanillin glucoside, indicating that the entire vanillin de novo biosynthetic machinery converting phenylalanine to vanillin glucoside is present in the chloroplast.

International audience; In Vanilla species (Orchidaceae), the influence of sexual and asexual mating systems on the spatial structuring of population genetic diversity is understudied. These elements are crucial in restoration program to limit inbreeding depression and to maintain the genetic diversity of natural populations. In the remnant fragments of tropical dry forest in Mayotte (Comoros Archipelago, Indian Ocean), the clarification of the reproductive strategies of the orphan leafless Vanilla humblotii Rchb. f. will provide a better understanding of its fine-scale spatial genetic structure. Approaches combining reproductive biology and fine-scale spatial genetic structure analyses using ten mi-crosatellite markers in 49 individuals sampled in the only remaining large population of V. humblotii were employed to unravel the reproductive strategies of this species. The results showed that V. humblotii displays un-scented flowers and is allogamous and pollinator-dependent although also self-compatible. A total absence of pollen movements and a low level of natural fruit set (~1%) are reported, although a wild bee (Allodape obscuripennis Strand, Xylocopinae) and a bird (Nectarinia coquerelli,Nectarinidae) visitedthe flowers. A high ge-notypic diversity (G/N = 0.88) and a phalanx clonal growth are detected, and seed dispersal is higher than pollen dispersal. The phalanx distribution of the repeated genotypes (ramets arisen from the same genet) is responsible for significant autocorrelations detected at small distances. Limited inbreeding was detected although geitonogamy could have been enhanced by vegetative reproduction. This study highlights the need to perform interdisciplinary studies to unravel the reproductive strategy of clonal plant species with a deceptive pollination system.

International audience; Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla was studied and demonstrated that COMT genes in Vanilla are organized with four exons and three introns. At least two to four different versions (either allelic or paralogous) of the COMT multigenic family in the genus Vanilla (in terms of intron sizes) were detected. The three introns were differentially variable, with intron-1 being the most length-polymorphic. Patterns of variations were in accordance with known phylogenetic relationships in the genus obtained with neutral markers. In particular, the genus displayed a strong Old World versus New World differentiation with American fragrant species being characterized by a specific 99 bp intron-1 size-variant and a unique 226 bp intron-3 variant. Conversely, leafless species of the genus displayed unexpected variations in intron lengths. Due to their role in primary (lignin) and secondary (phenolics, e.g., vanillin, alkaloids) metabolisms, COMT genes might not be neutral markers, and represent candidate functional markers for resistance, aromatic or medicinal properties of Vanilla species. Investigating the orthologous/paralogous status of the different genes revealed (in terms of intron size) will allow the evolution of the COMT genes to be studied. (Résumé d'auteur)

UMR AGAP - équipe PHIV - Plateforme d'histocytologie et d'imagerie cellulaire végétale; Root and stem rot (RSR) disease caused by Fusariurn oxysporurn f. sp. radicis-vanillae (Forv) is the most damaging disease of vanilla (Vanilla planifolia and V. x tahitensis, Orchidaceae). Breeding programs aimed at developing resistant vanilla varieties are hampered by the scarcity of sources of resistance to RSR and insufficient knowledge about the histopathology of Forv. In this work we have (i) identified new genetic resources resistant to RSR including V planifolia inbreds and vanilla relatives, (ii) thoroughly described the colonization pattern of Forv into selected vanilla accessions, confirming its necrotic non-vascular behavior in roots, and (iii) evidenced the key role played by hypodermis, and particularly lignin deposition onto hypodermal cell walls, for resistance to Forv in two highly resistant vanilla accessions. Two hundred and fifty-four vanilla accessions were evaluated in the field under natural conditions of infection and in controlled conditions using in vitro plants root-dip inoculated by the highly pathogenic isolate Fo072. For the 26 accessions evaluated in both conditions, a high correlation was observed between field evaluation and in vitro assay. The root infection process and plant response of one susceptible and two resistant accessions challenged with Fo072 were studied using wide field and multiphoton microscopy. In susceptible V planifolia, hyphae penetrated directly into the rhizodermis in the hairy root region then invaded the cortex through the passage cells where it induced plasmolysis, but never reached the vascular region. In the case of the resistant accessions, the penetration was stopped at the hypodermal layer. Anatomical and histochemical observations coupled with spectral analysis of the hypodermis suggested the role of lignin deposition in the resistance to Forv. The thickness of lignin constitutively deposited onto outer cell walls of hypodermis was highly correlated with the level of resistance for 21 accessions tested. The accumulation of p-coumaric and sinapic acids, two phenolic precursors of lignin, was observed in the resistant plants inoculated with Fo072, but not in the susceptible one. Altogether, our analyses enlightened the mechanisms at work in RSR resistant genotypes and should enhance the development of novel breeding strategies aimed at improving the genetic control of RSR of vanilla.

International audience; Root and stem rot (RSR) is a very detrimental disease of vanilla worldwide. Fusarium oxysporum is frequently associated with the disease but other Fusarium species are also reported. In this international study, 52 vanilla plots were surveyed in three of the most important vanilla producing countries (Madagascar, Reunion Island and French Polynesia) in order to determine the aetiology of RSR disease. Subsets from the 377 single-spored Fusarium isolates recovered from rotten roots and stems in the surveys were characterized by molecular genotyping (EF1α and IGS gene sequences) and pathogenicity assays on Vanilla planifolia and V. ×tahitensis, the two commercially grown vanilla species. Fusarium oxysporum was shown to be the principal species responsible for the disease, representing 79% of the isolates recovered from the RSR tissues, 40% of which induced severe symptoms on inoculated plantlets. Fusarium oxysporum isolates were highly polyphyletic regardless of geographic origin or pathogenicity. Fusarium solani, found in 15% of the samples and inducing only mild symptoms on plantlets, was considered a secondary pathogen of vanilla. Three additional Fusarium species were occasionally isolated in the study (F. proliferatum, F. concentricum and F. mangiferae) but were nonpathogenic. Histopathological preparations observed in wide field and multiphoton microscopy showed that F. oxysporum penetrated the root hair region of roots, then invaded the cortical cells where it induced necrosis in both V. planifolia and V. ×tahitensis. The hyphae never invaded the root vascular system up to 9 days post-inoculation. As a whole, the data demonstrated that RSR of vanilla is present worldwide and that its causal agent should be named F. oxysporum f. sp. radicis-vanillae. (Résumé d'auteur)

Background The objective of the work was to characterize fungal endophytes from aerial parts of Vanilla planifolia. Also, to establish their biotransformation abilities of flavor-related metabolites. This was done in order to find a potential role of endophytes on vanilla flavors. Results Twenty three MOTUs were obtained, representing 6 fungal classes. Fungi from green pods were cultured on mature green pod based media for 30 days followed by 1H NMR and HPLC-DAD analysis. All fungi from pods consumed metabolized vanilla flavor phenolics. Though Fusarium proliferatum was recovered more often (37.6 % of the isolates), it is Pestalotiopsis microspora (3.0 %) that increased the absolute amounts (quantified by 1H NMR in μmol/g DW green pods) of vanillin (37.0 × 10−3), vanillyl alcohol (100.0 × 10−3), vanillic acid (9.2 × 10−3) and p-hydroxybenzoic acid (87.9 × 10−3) by significant amounts. Conclusions All plants studied contained endophytic fungi and the isolation of the endophytes was conducted from plant organs at nine sites in Réunion Island including under shade house and undergrowth conditions. Endophytic variation occured between cultivation practices and the type of organ. Given the physical proximity of fungi inside pods, endophytic biotransformation may contribute to the complexity of vanilla flavors. Electronic supplementary material The online version of this article (doi:10.1186/s12870-015-0522-5) contains supplementary material, which is available to authorized users.

International audience; A multiple cell imaging approach combining immunofluorescence by confocal microscopy, fluorescence spectral analysis by multiphotonic microscopy, and transmission electron microscopy identified the site of accumulation of 4-O-(3-methoxybenzaldehyde) β-d-glucoside, a phenol glucoside massively stockpiled by vanilla fruit. The glucoside is sufficiently abundant to be detected by spectral analysis of its autofluorescence. The convergent results obtained by these different techniques demonstrated that the phenol glucoside accumulates in the inner volume of redifferentiating chloroplasts as solid amorphous deposits, thus ensuring phenylglucoside cell homeostasis. Redifferentiation starts with the generation of loculi between thylakoid membranes which are progressively filled with the glucoside until a fully matured organelle is obtained. This peculiar mode of storage of a phenolic secondary metabolite is suspected to occur in other plants and its generalization in the Plantae could be considered. This new chloroplast-derived organelle is referred to as a 'phenyloplast'.

International audience; Jumellea fragrans and Jumellea rossii, both named “Faham”, are two epiphytic orchids endemic to the Mascarene Islands (Reunion, Mauritius) widely used for their aromatic and medicinal properties. Cultivation of these orchids is currently non-existent, so gathering and poaching in natural populations provide the supply. Continued use of this resource and the reduction of its natural habitat now result in a drastic decline of its natural populations. In order to prevent the decline of these taxa, to preserve its natural evolution in the wild, and to answer to the local consumers demand, we initiate a multidisciplinary project. The main aim of the so-called “ORCHIFAH” project is to provide the scientific background requisite for the production of Faham at an industrial level. An ecological approach is set to characterise the environmental conditions (light, temperature, watering) for an optimal biomass production. In vitro conditions of asymbiotic germination are currently determined. The biochemical components variation of populations of the two species are analysed by RMN spectrometry. The development of an appropriated extractive mode of volatile compounds is planned. All this information will help us to accurately characterise the biology of Faham and the conditions of its production, essential prerequisites for the development of an agricultural production chain. The results will also allow us to determine the conservation status of the species and recommendations for the management of wild populations. The poster will explicit the different steps of the implementation of an agricultural production chain. The first results in each field will be presented.

The genus Vanilla which belongs to the Orchidaceae family comprises more than 110 species of which two are commercially cultivated (Vanilla planifolia and Vanilla xtahitensis). The cured pods of these species are the source of natural vanilla flavor. In intensive cultivation systems the vines are threatened by viruses such as Cymbidium mosaic virus (CymMV). In order to investigate the effect of CymMV on the growth and metabolome of vanilla plants, four accessions grown in intensive cultivation systems under shadehouse, CR01 (V. planifolia), CR17 (V. xtahitensis), CR03 (V. planifolia × V. xtahitensis) and CR18 (Vanilla pompona), were challenged with an isolate of CymMV. CymMV infected plants of CR01, CR03 and CR17 had a reduced growth compared to healthy plants, while there was no significant difference in the growth of CR18 vines. Interestingly, CR18 had qualitatively more phenolic compounds in leaves and a virus titre that diminished over time. No differences in the metabolomic profiles of the shadehouse samples obtained by nuclear magnetic resonance (NMR) were observed between the virus infected vs. healthy plants. However, using in- vitro V. planifolia plants, the metabolomic profiles were affected by virus infection. Under these controlled conditions the levels of amino acids and sugars present in the leaves were increased in CymMV infected plants, compared to uninfected ones, whereas the levels of phenolic compounds and malic acid were decreased. The metabolism, growth and viral status of V. pompona accession CR18 contrasted from that of the other species suggesting the existence of partial resistance to CymMV in the vanilla germplasm.

International audience; The cultivated species Vanilla planifolia is a typical example of a crop introduced from its area of origin (America) to new regions where natural pollinators are absent. Although the Vanilla cultivars are exclusively vegetatively propagated, a high degree of phenotypic variation is observed among the cultivars in their introduction areas such as Reunion Island. To test several hypotheses explaining this variation-different introduction events, somatic mutations and sexual reproduction (through manual pollination)-we used AFLP markers to elucidate the patterns of introduction of V. planifolia. Most of the accessions cultivated in the world were derived from a single accession, possibly the Mexican cultivar Mansa. The patterns of diversification of this cultivated species were also studied and compared with other cultivated (V. tahitensis) and wild (V. pompona and V. bahiana) species. Except for one particular phenotype ('Aiguille'), which may come from sexual reproduction, cultivated accessions exhibit very low levels of genetic diversity. They have evolved by the accumulation of point mutations through vegetative multiplication. The genetic diversity revealed could not explain the phenotypic diversity, which may be related to epigenetics or polyploidy. This new understanding of the basis of genetic diversity of vanilla may assist to improve management of genetic resources. (Résumé d'auteur)

International audience; The genus Vanilla belongs to the Orchidaceae family and Vanilla planifolia, probably endemic from tropical forests in Eastern Mexico, is the main source for commercial vanilla. There has recently been an important number of publications covering Vanilla taxonomy, particularly using molecular genetics, but the taxonomy of the genus is still unclear and numerous synonyms remain. Recent studies showed that inter-specific hybridization and perhaps even polyploidization played an important role in the evolution of the genus. There has also been an important increase in the knowledge of the genetic diversity and reproductive biology of V. planifolia in natural conditions, showing that mating system diversity exists in Vanilla and that this genus could be a good model to study the role of fragrance in orchid evolution. Recent studies on the genetic consequences of V. planifolia domestication are also presented and raise major scientific questions regarding the origin of phenotypic diversity in a vegetatively propagated crop. Finally, all these studies have demonstrated the urgent need for preservation of the genetic resources of V. planifolia (primary and secondary gene pools, and cultivated resources) and current conservation efforts are presented. (Résumé d'auteur)

A survey was carried out to identify the viruses infecting vanilla in French Polynesia and to assess their incidence. Virus identification was based on enzyme-linked immunosorbent assay (ELISA) and, for potyviruses, on the sequence of part of the coat protein and inoculation assays. Between 1998 and 1999, 3,610 vanilla plants from 49 plots in the Society Islands were indexed. Cymbidium mosaic virus (CymMV) was detected in 500 vines from 10 plots in the Leeward Islands. The data suggest that this virus has spread widely since its first detection in French Polynesia in 1986, most likely through the dissemination of symptomless infected cuttings. Viruses belonging to the Potyvirus genus were found in 674 plants from 27 plots in the four islands surveyed. Three distinct potyviruses have been identified: (i) Vanilla mosaic virus, (ii) Watermelon mosaic virus, and (iii) and a virus related to Bean common mosaic virus. The symptoms induced on Vanilla tahitensis by the three potyviruses can be differentiated from each other and from those due to CymMV. A significant proportion of the plants surveyed (97/476) were symptomatic but tested negative by ELISA for CymMV and the Potyvirus group. Odontoglossum ringspot virus was not detected in any sample tested.

In Reunion Island (Indian Ocean) and other humid tropical areas, cultivated vanilla is represented mainly by the species Vanilla planifolia G. Jackson, syn. V. fragrans (Salisb.) Ames, indigenous to Mexico and Central America. Other cultivated species are V. tahitensis J.W. Moore in South Pacific Islands and V. pompona Schiede in the West Indies. V. pompona is naturally distributed in Central and South America, and the origin of V. tahitensis is still questioned. The use of RAPD markers permitted to separate neatly individuals from the three species studied. Low levels of genetic diversity were detected in V. planifolia in cultivation areas such as Reunion Island and Polynesia (Pacific Ocean), in accordance with the vegetative mode of dispersion of vanilla, and the history of recent introduction in these regions. Nevertheless, the occurrence of different introductions from which modern vanilla cultivars have evolved in these areas was demonstrated. Species-specific RAPD markers were selected and used successfully to analyse putative V. planifolia × V. tahitensis hybrid specimens. Within the sampling limit of the present study, it was also suggested that V. tahitensis is probably not a species of direct hybrid origin ( V. planifolia × V. pompona ) but rather a species related to V. planifolia . These results are essential to guide further genetic analysis of cultivated vanilla specimens in introduction areas.

Partial coat protein sequence analysis of Cucumber mosaic virus (CMV) isolates from Vanilla tahitensis crops in French Polynesia and V. planifolia crops on Réunion Island detected several different sequence variants of CMV isolates that were related to their geographic origin. French Polynesian isolates showed high molecular variability and clustered into two subgroup IB clades and one putative subgroup IA clade. The Réunion isolates grouped into a single subgroup IB clade. Experimental inoculation with a New Zealand isolate (NZ100) belonging to the CMV-II subgroup, demonstrated that vanilla is able to be infected by a very diverse range of CMV isolates.

The papaya strain of Papaya ringspot virus (PRSV-P), the cause of papaya ringspot disease, was confirmed in French Polynesia and the Cook Islands by double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA). In French Polynesia, the virus has probably been on the islands of Tahiti and Moorea for several years, but appears not to have spread to eight other islands. In contrast, PRSV-P has only recently appeared in the Cook Islands and is now the subject of an eradication campaign.

This paper lists the known distribution of 57 plant viruses and viroids in the 22 Pacific Island countries covered by the Secretariat of the Pacific Community (American Samoa, Cook Islands, FSM (Micronesia), Fiji, French Polynesia, Guam, Kiribati, Marshall Islands, Nauru, New Caledonia, Niue, Northern Mariana Islands, Palau, Papua New Guinea, Pitcairn Islands, Solomon Islands, Tokelau, Tonga, Tuvalu, Vanuatu, Wallis and Futuna, Western Samoa).