Search

Background: Various barriers lead to a shortage of organs for transplantation in Malaysia. One drive to improve the organ donation rate operates through future healthcare practitioners and practitioner advocacy. This scoping review was carried out to establish and summarise findings about organ donation-related articles among the public, health sciences students and health personnel. A further aim was to synthesise the latest data on knowledge and attitudes towards organ donation in the Malaysian population. Methods: PubMed, Scopus, Google Scholar and the Malaysian Medical Repository (MyMedR) were used for a search conducted up to May 2022. Relevant search terms included 'Organ donation' and 'Malaysia'. Journal articles related to knowledge, attitudes and intention were grouped under the general public and health science. Students and health personnel were included. Eligible studies were reviewed by two independent reviewers. Any disagreements were resolved by consensus with a third reviewer. Results: The 31 included articles revealed an increased level of awareness among the public regarding organ donation. The analysis identified that nonrecognition of brainstem death (38.5%), no knowledge of how to contact the Organ Transplant Coordinator (82.3%) and never approaching the families of a potential donor (63.9%) led to a lack of confidence among healthcare practitioners to promote organ donation. Conclusion: The shortage of organ donors is the result of the failure to identify the expected donor, obtain consent and procure the organs due to the passivity of Malaysian health professionals in promoting the organ donation process. [ABSTRACT FROM AUTHOR]

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel [ABSTRACT FROM AUTHOR]

Abstract: The intended purpose of a device is a key reference when regulators decide whether or not to regulate it as a medical device. However, when coming into consumer health domain, it is sometimes difficult to decide whether a device (or system) has a general purpose or not. The authors discussed the regulatory policy around health device connectivity, operating system and software market, and proposed to regulate them with enough granularity. [Copyright &y& Elsevier]

Background: Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (a-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia. Methods: A cross-sectional computer-assisted telephone interview survey of a representative sample of multi-racial Malaysians aged 18 years and above was conducted between July and December 2009. Results: Of a total of 3723 responding households, 2846 (76.4%) have heard of thalassaemia. Mean knowledge score was 11.85 (SD ± 4.03), out of a maximum of 21, with higher scores indicating better knowledge. Statistically significant differences (P < 0.05) in total knowledge score by age groups, education attainment, employment status, and average household income were observed. Although the majority expressed very positive attitudes toward screening for thalassaemia, only 13.6% of married participants interviewed have been screened for thalassaemia. The majority (63.4%) were unsupportive of selective termination of foetuses diagnosed with thalassaemia major. Conclusion: Study shows that carrier and premarital screening programs for thalassaemia may be more effective and culturally acceptable in the reduction of pregnancies with thalassaemia major. The findings provide insights into culturally congruent educational interventions to reach out diverse socio-demographic and ethnic communities to increase knowledge and cultivate positive attitudes toward prevention of thalassaemia. [ABSTRACT FROM AUTHOR]

Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β0-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah. [ABSTRACT FROM AUTHOR]

β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population. [ABSTRACT FROM AUTHOR]